ID: 1119567428

View in Genome Browser
Species Human (GRCh38)
Location 14:75640678-75640700
Sequence TGCTGACTGGCTGTCACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119567424_1119567428 -10 Left 1119567424 14:75640665-75640687 CCCCTTCTGTAAATGCTGACTGG 0: 1
1: 0
2: 1
3: 14
4: 172
Right 1119567428 14:75640678-75640700 TGCTGACTGGCTGTCACTGATGG 0: 1
1: 0
2: 1
3: 18
4: 178
1119567423_1119567428 -5 Left 1119567423 14:75640660-75640682 CCTTGCCCCTTCTGTAAATGCTG 0: 1
1: 0
2: 1
3: 23
4: 220
Right 1119567428 14:75640678-75640700 TGCTGACTGGCTGTCACTGATGG 0: 1
1: 0
2: 1
3: 18
4: 178
1119567422_1119567428 3 Left 1119567422 14:75640652-75640674 CCAGGCATCCTTGCCCCTTCTGT 0: 1
1: 0
2: 3
3: 33
4: 346
Right 1119567428 14:75640678-75640700 TGCTGACTGGCTGTCACTGATGG 0: 1
1: 0
2: 1
3: 18
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119567428 Original CRISPR TGCTGACTGGCTGTCACTGA TGG Intronic