ID: 1119567428

View in Genome Browser
Species Human (GRCh38)
Location 14:75640678-75640700
Sequence TGCTGACTGGCTGTCACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119567422_1119567428 3 Left 1119567422 14:75640652-75640674 CCAGGCATCCTTGCCCCTTCTGT 0: 1
1: 0
2: 3
3: 33
4: 346
Right 1119567428 14:75640678-75640700 TGCTGACTGGCTGTCACTGATGG 0: 1
1: 0
2: 1
3: 18
4: 178
1119567424_1119567428 -10 Left 1119567424 14:75640665-75640687 CCCCTTCTGTAAATGCTGACTGG 0: 1
1: 0
2: 1
3: 14
4: 172
Right 1119567428 14:75640678-75640700 TGCTGACTGGCTGTCACTGATGG 0: 1
1: 0
2: 1
3: 18
4: 178
1119567423_1119567428 -5 Left 1119567423 14:75640660-75640682 CCTTGCCCCTTCTGTAAATGCTG 0: 1
1: 0
2: 1
3: 23
4: 220
Right 1119567428 14:75640678-75640700 TGCTGACTGGCTGTCACTGATGG 0: 1
1: 0
2: 1
3: 18
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119567428 Original CRISPR TGCTGACTGGCTGTCACTGA TGG Intronic
902196328 1:14801329-14801351 GGCTGACTGGCGCTCACTGTCGG + Intronic
902328113 1:15716005-15716027 TGCTGACTGGGTGCCTCTGGGGG + Intronic
903360500 1:22774017-22774039 TGATGACTGGCTCTCAGTGGTGG - Intronic
905290414 1:36917915-36917937 TTCTGAGTGGCTGTGACTGGGGG - Intronic
908248338 1:62245381-62245403 TGCTGTCTGGGTGTGACTGAGGG + Intronic
908560054 1:65297285-65297307 TGCTGACTACCTTTGACTGAGGG + Intronic
910042412 1:82868630-82868652 TGCTGACTAGCTGTTCCTCATGG + Intergenic
911065459 1:93784061-93784083 TGCTGGCTGGCTGTTAATGCTGG - Intronic
914916501 1:151822486-151822508 GGCTGGCTGGCTGTCATTCATGG - Intronic
916058015 1:161081295-161081317 TGGTGAGGGGCAGTCACTGAAGG + Intronic
917452203 1:175156524-175156546 TGCTGACTGGATTTCAAGGAGGG - Intergenic
918048458 1:180954983-180955005 TGCTGGCTGGAAGTCACAGAGGG - Intergenic
923275997 1:232396907-232396929 TGCTGCCTGGTTCACACTGATGG + Intergenic
924140763 1:241020813-241020835 TCTTGACTGTCTGGCACTGATGG - Intronic
1062894363 10:1091642-1091664 TGCTGACTGGTGCTGACTGATGG + Intronic
1063101217 10:2951456-2951478 TGGTGACTGGCTGTCGCAGGTGG - Intergenic
1069597406 10:69681390-69681412 TTCTGACTGGCTATCACAAATGG - Intergenic
1070588477 10:77784212-77784234 TTCTGAATTGCTGTCACAGATGG - Intergenic
1071178168 10:82951883-82951905 TGGTGTCTGCCTGTCACTAAAGG + Intronic
1074780247 10:116797261-116797283 GGCTGACAGGCTGCCACTGAAGG + Intergenic
1076620393 10:131783627-131783649 TGATGACTGGGTGTCTCTAAGGG - Intergenic
1078454024 11:11461178-11461200 TCCTGACGGGCTGGCACTGCTGG + Intronic
1078805883 11:14702902-14702924 TACTGACTCCCTGTCACTTATGG + Intronic
1079111889 11:17609831-17609853 TCCTCAGTGGCTGTCACTGGTGG - Exonic
1080323659 11:31044592-31044614 TTTTGGCTGGCTGTCACTCAGGG - Intronic
1081123512 11:39294549-39294571 TTCTGTCTAGCTGTCACTCAAGG - Intergenic
1081661898 11:44893492-44893514 TGCTCACTGGCTGTGCCTGCTGG - Intronic
1084745864 11:71168699-71168721 TGCTGACTGCCTGTGATTGCAGG - Intronic
1089390005 11:118094969-118094991 GGGTGACTGGATGTCACTCATGG - Intronic
1092263394 12:6963901-6963923 TGTTGGCTGGCTGCCACTAAGGG + Intergenic
1093718917 12:22415071-22415093 TGCTGTCTGCCAGGCACTGATGG + Intronic
1096477485 12:51917311-51917333 TGCTGCCTGGTTGTTACTGTGGG + Intronic
1102460707 12:113097911-113097933 TGCTGATTGGCTGCCACGGTGGG + Exonic
1102629967 12:114269443-114269465 TACTGACATGCTGTCACTGCAGG + Intergenic
1104070694 12:125342808-125342830 TGATGACCGGCTGCCACTGGTGG + Intronic
1105794657 13:23839057-23839079 AGCTGACTGGCTGTCAAAGTCGG + Intronic
1106374741 13:29174942-29174964 GGCTGAATGGTTGTCAGTGAAGG - Intronic
1107366238 13:39680672-39680694 TCCTTGCTGGCTGTCACTGAGGG + Intronic
1110706323 13:78604335-78604357 TCCTAAGTGGCTGTCACTGGCGG - Intergenic
1111441915 13:88291994-88292016 TGCTGGCGGGCTGGCACTGCTGG - Intergenic
1115353382 14:32421746-32421768 TGTTGACTGAATGTCACTGTAGG + Intronic
1116311018 14:43326779-43326801 TGCTGGCAGGCTGGCACTGCTGG - Intergenic
1116449513 14:45049103-45049125 TCCTTGCTGGCTGTCAGTGAGGG + Intronic
1116481050 14:45391984-45392006 TGCTACCTGGCTATCACTGCTGG - Intergenic
1117233959 14:53752218-53752240 TGCTACCTGGCTATCACTGCTGG - Intergenic
1119567428 14:75640678-75640700 TGCTGACTGGCTGTCACTGATGG + Intronic
1120060166 14:79973156-79973178 TGCTGGTTGGCTGTGACTAAGGG - Intergenic
1121160250 14:91732065-91732087 TGCTGATTGGCTGTTACCAAAGG - Exonic
1123018941 14:105388610-105388632 TGGTGCCGGGCTGTCCCTGAGGG + Intronic
1123138085 14:106049155-106049177 TGCTGGTTGGCTGTTATTGAGGG - Intergenic
1124091869 15:26612991-26613013 TCCTGAGTAGCTGTGACTGAAGG - Intronic
1126162533 15:45627402-45627424 TTCTGAGTGGCTGTGACTGCAGG + Intronic
1126237147 15:46399396-46399418 TGCTGACTGAGGTTCACTGATGG - Intergenic
1126267230 15:46768871-46768893 CGCAGACTGGCTGACACTTAGGG + Intergenic
1126423026 15:48495221-48495243 TGCTGGCAGACTGTCATTGATGG - Exonic
1127964807 15:63915618-63915640 TGCTCAGTGGCTGGCACTGCTGG - Intronic
1135615333 16:23906851-23906873 TGCTGCCTAGCTGGCACTGGAGG - Intronic
1137885529 16:52098969-52098991 TGCTGTCTTCCTGTAACTGAGGG + Intergenic
1138066159 16:53943423-53943445 TGCTGGCTGGCTGTTTCTTAGGG + Intronic
1138240407 16:55423081-55423103 TTCTGACTTTCTGTCACTAATGG - Intronic
1139231261 16:65284743-65284765 TGCTGATTGGTTTTCAGTGATGG - Intergenic
1140071359 16:71653162-71653184 TGCAGACTTGCTGTGGCTGATGG + Intronic
1141030936 16:80587824-80587846 TGCTGAATGGCTGGGACTGCAGG + Intergenic
1141362439 16:83408743-83408765 GGCTGACTTGCTTTAACTGAAGG - Intronic
1142004783 16:87684520-87684542 TGCTTGCCGGCTGTCCCTGACGG + Intronic
1142033586 16:87850479-87850501 TGGTGACTCGCAGTCACCGATGG - Intronic
1145250587 17:21294944-21294966 TGCTGACTGGCTCTCTGAGATGG + Intronic
1146213212 17:30957952-30957974 TGCTGACTGCGGGGCACTGATGG - Exonic
1146582107 17:34047667-34047689 TGCTGACTTGCTGTGACCAATGG + Intronic
1146757448 17:35445837-35445859 AGCTGACTGGCTGGCAGGGAAGG + Intronic
1147346950 17:39804639-39804661 AGATGACTGGCTATCACTGTGGG - Intronic
1148604915 17:48921902-48921924 TCCTGACTGGCTGTGACTGCAGG - Intronic
1148737984 17:49875594-49875616 TGATGACTGGCTGTGGCTCAGGG + Intergenic
1151210123 17:72538185-72538207 TGCTAACTGGCTGTCTCTCCAGG - Intergenic
1151755004 17:76069581-76069603 TCCTGAGTGGCTGGGACTGAAGG - Intronic
1151957888 17:77389549-77389571 TGATAAATGGCTGTCGCTGAAGG - Intronic
1152803046 17:82340448-82340470 TGCTGAGAGGCTGTCAGTGATGG + Intergenic
1153337624 18:3940929-3940951 TGCTGTCTCTCTGTCACTGTGGG - Intronic
1153666767 18:7373282-7373304 TGTTTCCTGCCTGTCACTGAGGG + Intergenic
1154111247 18:11570279-11570301 TACTGACTGGCTGTGGCTGAGGG - Intergenic
1154949262 18:21192205-21192227 TGCTGGCTGGCTTTGACTCAAGG + Intergenic
1158390380 18:57040191-57040213 TTCTCGCTGGCTGTCACTGGAGG + Intergenic
1162711398 19:12597376-12597398 TCCTGCATGGCTGTCACTCAGGG - Intronic
1164839508 19:31381735-31381757 TCCTGACTGGATGTCACCTATGG + Intergenic
929090681 2:38214326-38214348 GCCTGGGTGGCTGTCACTGAAGG + Intergenic
929530129 2:42745315-42745337 TGCTCACTGGCTGTCCTAGAGGG - Intronic
930024303 2:47020993-47021015 TGATGTCTGGGTGGCACTGAAGG + Intronic
930420878 2:51151804-51151826 TGCTGGCGGGCTGGCACTGCTGG + Intergenic
930620066 2:53634523-53634545 TGGTGACTGGTTGTCAGTGAGGG - Intronic
931206396 2:60149722-60149744 TGCTCACTGGCTTTCCTTGAAGG - Intergenic
933420659 2:82041943-82041965 TGAGGACTGCCTGTCACTGTAGG - Intergenic
935563522 2:104583138-104583160 TGCTGAGTGGCTGTTACTTGGGG - Intergenic
936232590 2:110716163-110716185 TGCTGTCTGGCTGACATTAATGG + Intergenic
936512263 2:113157643-113157665 TGCGGAGCGGCTGTCGCTGAGGG + Intronic
937250445 2:120520321-120520343 TCCTGAGTGGCTGGCACTGCAGG - Intergenic
938355370 2:130641874-130641896 TGCTGACTTTCTGTCACAGACGG - Intronic
938475468 2:131607252-131607274 TGCTGACTTTCGGTCACGGATGG - Intergenic
944437380 2:199704740-199704762 TGCTGATTGGCTGTGTGTGAGGG - Intergenic
945869156 2:215208048-215208070 TGCTGGCAGGCTGGCACTGCTGG - Intergenic
946398637 2:219456520-219456542 TTCTGACAGGCTGTGAGTGATGG - Intronic
948862963 2:240761819-240761841 TGGTGTGTGGCTGTCATTGACGG - Intronic
1169288395 20:4328479-4328501 TCCTGCCAGGCTGTGACTGATGG + Intergenic
1171091360 20:22288496-22288518 TGCTGACTGGCACTTACTAATGG + Intergenic
1171900035 20:30847813-30847835 TGCTGACTGCCTGTGATTGCAGG - Intergenic
1175923267 20:62459689-62459711 GTCTGACTGGCTGTCCCCGAAGG + Intergenic
1176239881 20:64070952-64070974 TGCTGCCTGGCAGTGACTGCAGG + Intronic
1176410765 21:6448332-6448354 TAAAGACTGGGTGTCACTGAAGG + Intergenic
1179055131 21:37924695-37924717 TTTTTACTGGCTGTCAGTGAGGG + Intergenic
1179686258 21:43056654-43056676 TAAAGACTGGGTGTCACTGAAGG + Intronic
1180122840 21:45765451-45765473 TGCTGACTTGGTGTGACTGAGGG - Intronic
1181359095 22:22321614-22321636 TGCAGACTGGCATTCAGTGATGG + Intergenic
1181642944 22:24214359-24214381 TGCACACTGGCTGGCACTGCTGG + Intergenic
1183073178 22:35410506-35410528 TTCTGTTTGGCTGTCACTGTGGG + Intronic
950470457 3:13181959-13181981 TGCTTACTGGCCATCACTGTAGG - Intergenic
950724207 3:14906029-14906051 TGAAGCCTGGCAGTCACTGAAGG - Intronic
951220406 3:20063189-20063211 TTCTGAGTGGCTGTGACTGCAGG + Intronic
951551873 3:23882721-23882743 TGCTGGCAGGCTGGCACTGCTGG + Intronic
951683932 3:25324174-25324196 TCCTGTGTGGCTGTCTCTGATGG + Intronic
953774116 3:45800992-45801014 TGGTGACTGGGAGCCACTGAGGG - Intergenic
954914130 3:54134700-54134722 TGCTGTCTGGCAGTCCCTGCTGG - Intronic
955632864 3:60993474-60993496 TGTTTACTGACTGTCCCTGATGG + Intronic
955786574 3:62547047-62547069 TCCTAACTGGTTGTCTCTGATGG + Intronic
956129233 3:66038708-66038730 CGCTGGCAGGCTGTTACTGAGGG + Intronic
956260133 3:67330140-67330162 TGCTGACTCTCTGTGACTAAAGG - Intergenic
958078226 3:88711838-88711860 TGCTGACTTGATGTCCCTGCAGG - Intergenic
960271526 3:115679651-115679673 TGCTCATTGGCTCTCAATGAAGG + Intronic
961422634 3:126818415-126818437 AGCAGGCTGTCTGTCACTGAGGG - Intronic
963336105 3:143974084-143974106 TTCTGGGTTGCTGTCACTGAGGG + Intronic
966852945 3:184175670-184175692 CGCTGCCTGGCTTTCACTGAAGG + Intronic
966949528 3:184803662-184803684 AGCTCACTGGCTGTCACAGCCGG + Intergenic
967068741 3:185943552-185943574 TGCTGACTGCCAGGCACTGCAGG - Intergenic
968437397 4:601034-601056 TGCTGCCTGGCTGTGGGTGAGGG - Intergenic
973852362 4:54973829-54973851 AGCTGGCTGGCTGTCCCTCAGGG - Intergenic
975353616 4:73373341-73373363 TGGTGACTGGCTCTAACTGTGGG - Intergenic
976511443 4:85914192-85914214 GGCTGAATGGCTGTCACTGAAGG + Intronic
976808559 4:89075129-89075151 TGTTGATTGGCTGGCACTCAGGG - Intronic
979213303 4:118132717-118132739 TACTCCCTGGCTATCACTGATGG + Intronic
981538904 4:145828016-145828038 TGCTCAGTGACTGTCACTGTTGG + Intronic
983641377 4:169946764-169946786 ACCTGACTGGCTGTCAGTGCTGG + Intergenic
985694305 5:1331303-1331325 TGCACACTGCCTGTCACTGCTGG + Intronic
988850103 5:35172417-35172439 TGCTGCCTGGCTGTCACCTTGGG + Intronic
990132628 5:52606111-52606133 TGCTGACTGGCTTTCACGATGGG - Intergenic
990324773 5:54664065-54664087 TGCTGACTTGCTGCCATGGAAGG + Intergenic
993180859 5:84550038-84550060 TCCTGGCTGGCTGTCACCCAAGG - Intergenic
993989833 5:94642212-94642234 TGGTGACTGGCTGCCATTAACGG - Intronic
996453491 5:123654978-123655000 TGTTCACTTGCTGTTACTGAGGG - Intergenic
998140824 5:139698477-139698499 GTGTGACTGGCTGTCTCTGAGGG + Intergenic
1000241314 5:159411077-159411099 TCCTTGCTGGCTATCACTGAGGG + Intergenic
1001011871 5:168106138-168106160 TGCTGAACAGCTGTCACTGGAGG + Intronic
1004058106 6:12161570-12161592 TGCGGGCTAGCTGTGACTGAGGG - Exonic
1004991431 6:21142543-21142565 TGCTGAGTTGCTGCCAATGAGGG - Intronic
1005117720 6:22356591-22356613 TGCTGGCAGGCTGGCACTGCTGG + Intergenic
1005384066 6:25268441-25268463 TCCTTGCTGGCTGTCACTCAGGG - Intergenic
1005833048 6:29686148-29686170 TGGAGGCTGGCTGTCAATGAGGG + Intergenic
1013576399 6:111487154-111487176 TGCTGACTGGCAGGCATTGCTGG + Intergenic
1017529133 6:155270247-155270269 TGCTGACTTGGCGTCACTGATGG - Intronic
1018130129 6:160722044-160722066 TGGTGAGTGGCTGTCAGTGGGGG - Intronic
1018620484 6:165725554-165725576 TGCTGACTGGCAGGAACCGATGG - Intronic
1019227274 6:170523668-170523690 TGCTGACTCGGTGTCACTGTCGG - Intergenic
1019985023 7:4649380-4649402 TGCTGAGTGCCTGTCTATGATGG - Intergenic
1020415811 7:7944629-7944651 TGCTGGCTTGCTGTAACTGCTGG - Intronic
1021437816 7:20641422-20641444 TCCTGAGTAGCTGGCACTGATGG - Intronic
1022205403 7:28158923-28158945 TACTGACTGGCTTTCAGTCAGGG - Intronic
1022404923 7:30080000-30080022 TGCTGGCTGGGTGTCAATGCTGG - Exonic
1022600742 7:31756850-31756872 TGCTCACTGGCTTTCCCTGCAGG + Intronic
1025857384 7:65294191-65294213 TCCTGAGTGGCTGACACTGCAGG + Intergenic
1029910508 7:104141305-104141327 AGCTGCCTGGCTGTCACTTAAGG + Intronic
1034292672 7:149945309-149945331 TGCTGGGAGGTTGTCACTGATGG - Intergenic
1035434953 7:158852613-158852635 TCCTGACTGGCTGGGACTGCAGG - Intergenic
1037906340 8:22718070-22718092 TGCTGAGTGGCTGATACTGCGGG + Intronic
1040083576 8:43314037-43314059 TGCTGACTTTCAGTCATTGATGG - Intergenic
1041710992 8:60894356-60894378 AGCTGAGTGACTGTCACAGATGG + Intergenic
1045347011 8:101302498-101302520 GCATGACTGGCTGTCACTCAGGG - Intergenic
1045681840 8:104669150-104669172 TGCTGGATGGAGGTCACTGAGGG + Intronic
1046275642 8:111956232-111956254 TACTGATGGGTTGTCACTGAAGG + Intergenic
1048551085 8:135434003-135434025 GTCTGACTGGCTCTCACAGATGG + Intergenic
1048604779 8:135956325-135956347 TGGTGAGTTGCTGTTACTGATGG + Intergenic
1048973911 8:139660713-139660735 TGCATACTGGCTGTCATTAAAGG + Intronic
1051069105 9:13141058-13141080 GGCATACTGGCTGTCACTTAGGG + Intronic
1055961676 9:81826503-81826525 TGCTGAGTGGCTGCCCCCGAAGG + Intergenic
1056542741 9:87587752-87587774 TGCTGAATGGCTCTCCATGAAGG - Intronic
1058919915 9:109603626-109603648 GGATGACAGGGTGTCACTGAGGG - Intergenic
1059189829 9:112314569-112314591 TCCTGAGTGGCTGGGACTGAAGG - Intronic
1060876216 9:127085408-127085430 TGCTGACTGGCTGTCTTTGCTGG + Intronic
1061280613 9:129596084-129596106 TGCTGGCTGGTTGTGACTGTTGG + Intergenic
1062056615 9:134472376-134472398 TCCTGCCTGGCTGTCCCTGAGGG + Intergenic
1062190447 9:135245329-135245351 TGATGACTGGCTGCCACTCTAGG + Intergenic
1187469080 X:19552461-19552483 TGCTGACTGGCAGCCAGTGAAGG + Intronic
1190145767 X:47890329-47890351 TGTTCACTTGCTGTTACTGAGGG + Intronic
1190249246 X:48709616-48709638 TCATGACTGGCTGTGACTGGTGG + Intergenic
1192703393 X:73500715-73500737 CTCTGACTGGCTGACACTTAGGG - Intergenic
1193470413 X:81895220-81895242 TGCTGACTGGCTGACAAAGAAGG + Intergenic
1193937262 X:87637823-87637845 TCCTGAGTGGCTGACATTGAAGG - Intronic
1194777894 X:97988183-97988205 AGCTGACTCACAGTCACTGATGG + Intergenic
1194917375 X:99722544-99722566 TGCTGACTGGAGAACACTGAGGG - Intergenic
1195579131 X:106481924-106481946 TGCTGACTGGCCCTCACTGCAGG + Intergenic
1198501638 X:137255392-137255414 GGCTGACTGGCAGTTAATGATGG - Intergenic
1200967472 Y:9110389-9110411 TGATCACTGGCTGTCTGTGAAGG + Intergenic