ID: 1119571240

View in Genome Browser
Species Human (GRCh38)
Location 14:75675333-75675355
Sequence GGGTTTAAACAAAAATAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 307}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119571240_1119571244 3 Left 1119571240 14:75675333-75675355 CCATGCTATTTTTGTTTAAACCC 0: 1
1: 0
2: 2
3: 13
4: 307
Right 1119571244 14:75675359-75675381 AAGGCGTTTCATTGCTCTCTAGG 0: 1
1: 0
2: 0
3: 6
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119571240 Original CRISPR GGGTTTAAACAAAAATAGCA TGG (reversed) Intronic
902095960 1:13946070-13946092 GGGTTTATTTAAAAATAGGAAGG - Intergenic
906425386 1:45707868-45707890 AAGGTTAAACAAAAATAACAAGG + Intronic
907425710 1:54378252-54378274 GGGGTTAAACAAAAATCAGAAGG - Intronic
907529001 1:55074335-55074357 GGATTTAAACATAAATAGGCCGG + Intronic
907943687 1:59112973-59112995 GGGATTAAACAAAAAAGGCTGGG - Intergenic
908941228 1:69436912-69436934 GGGTTTAAACTAAAGTAGGGAGG - Intergenic
909502079 1:76345839-76345861 TGGTTTGATCAAAAATAGCAAGG - Intronic
910467786 1:87518608-87518630 GGGGTCAAACAAAATTAGGAGGG - Intergenic
910755812 1:90689307-90689329 CAGTTTAAAAAAAAAAAGCAGGG + Intergenic
911000464 1:93159935-93159957 ACGCTTAAACAAAAATAGAAAGG + Intronic
911659979 1:100490446-100490468 TAGTTTAGACAAAAATAGTACGG + Intronic
917189492 1:172399703-172399725 GGATTTAAAAAAAAATAACTGGG + Intronic
919137058 1:193522510-193522532 TTGATTAAACAAAAATAACATGG + Intergenic
919675673 1:200380411-200380433 GGGTTGAAGCAAAACTGGCATGG - Intergenic
922314178 1:224427275-224427297 GGGCTTAAAAAAAAATTTCAGGG + Intronic
922843342 1:228662918-228662940 TGATTTAAACAGAAATATCATGG - Intergenic
923617459 1:235549695-235549717 GAGTTTTAACAAAAGAAGCAAGG + Exonic
923660520 1:235953090-235953112 GGGTTTAGACAAATGTATCATGG + Intergenic
924508415 1:244708303-244708325 GGGTTTAAAAAAAAACCCCAAGG - Exonic
1063802960 10:9602457-9602479 GGGTTAAAACAAAAAGAACCTGG + Intergenic
1064008229 10:11714810-11714832 CTGTTTAAAAAAAAAAAGCAGGG + Intergenic
1065400008 10:25288448-25288470 GTGATTAAACAAAAATAGCATGG - Intronic
1066071792 10:31823155-31823177 GGGTTTAGAAAGAAATAACATGG - Intronic
1067072799 10:43148171-43148193 GATTTTCAACAAGAATAGCAAGG - Intronic
1067359597 10:45566368-45566390 GGGTACAAAAAAAAATAGAATGG - Intronic
1068300996 10:55138876-55138898 GGGTTTAAAAAAATATACAAAGG - Intronic
1068520843 10:58075781-58075803 TAGTTTTAACAAATATAGCACGG + Intergenic
1068585178 10:58790519-58790541 GGTTTTAAACAAATATGGGAAGG - Intronic
1068747440 10:60549193-60549215 GGGTGTACACAAAAACACCATGG + Intronic
1068865889 10:61895648-61895670 GGCTTTCAACAAAGATAGTAGGG - Intergenic
1070963839 10:80517559-80517581 GGGTTAAACCAAAAATAACAGGG - Intronic
1071065221 10:81624835-81624857 AGGTTTAAACAAATATTCCAAGG - Intergenic
1073406541 10:103302749-103302771 GGGTTAAAAAAAAAATAACCAGG - Intergenic
1074399001 10:113126556-113126578 GCGTTTAAAAAAAAAAGGCAGGG - Intronic
1074802741 10:117017884-117017906 GGGTTTTAGGAAAAATACCACGG - Intronic
1075785409 10:125046064-125046086 GGGTTTAAAAAAAAAATACATGG + Intronic
1075919526 10:126198766-126198788 GGGTTTAAAGAAAAATAAAATGG - Intronic
1077759072 11:5070891-5070913 GAGTTTAAACAAAAATATCGAGG + Intergenic
1079613912 11:22467336-22467358 GGGTTGAAACTAAAATAACATGG + Intergenic
1079738653 11:24030052-24030074 CGGTATAAAGAAAAATAGAATGG - Intergenic
1081215979 11:40399089-40399111 GTGTTCAAAGAACAATAGCAAGG + Intronic
1081611883 11:44567774-44567796 GGGCTTACACAAGAATACCAGGG + Intronic
1083111109 11:60408159-60408181 GATTTTCAACAAAAATACCAAGG - Intronic
1083194612 11:61077962-61077984 GGTTTTATACAAAACTAGAAAGG + Intergenic
1085685098 11:78614511-78614533 AGCTTTGAACAAAAATGGCAAGG - Intergenic
1092651129 12:10636467-10636489 GTGTGTAAACCAAAATGGCAAGG + Intronic
1092658488 12:10713469-10713491 GGTTTTAAACAAAGTGAGCAAGG + Intronic
1093343750 12:18013544-18013566 TGGTTTCAACTAAAAAAGCATGG - Intergenic
1095233716 12:39772402-39772424 GATTTAAAAAAAAAATAGCACGG - Intronic
1095350989 12:41212372-41212394 GGATGTAAATAAAAATAGTAGGG - Intronic
1095918752 12:47507658-47507680 GAGGTTAAAGAAAAAAAGCATGG - Intergenic
1097463142 12:59888564-59888586 TCGTTTAAACAACTATAGCAAGG - Intergenic
1098167470 12:67713180-67713202 GTGTTTAAACAAAAACAGCAAGG + Intergenic
1098955722 12:76687643-76687665 GGTGTTAAACATAAAGAGCAGGG + Intergenic
1099039989 12:77640872-77640894 TGCTTTTAACAAAAATTGCATGG - Intergenic
1102846796 12:116193646-116193668 TTTTTTAAACAAAAATAGCGAGG - Intronic
1104294651 12:127500881-127500903 GAGTTTAATCAGGAATAGCAGGG - Intergenic
1105959932 13:25323712-25323734 GAGTTTAAATTAAAATAGGATGG + Intronic
1106028751 13:25979330-25979352 GGGTTTAAAAAAACCTGGCATGG + Intronic
1107039062 13:35930154-35930176 GGGTTTAAACAAAAATGTTCTGG - Intronic
1107823052 13:44303817-44303839 GGGCTAAAGCCAAAATAGCAAGG - Intergenic
1109175495 13:59150293-59150315 GGGGTTAAATAAAAACAACAGGG - Intergenic
1109862037 13:68212398-68212420 GAGTCTAAAGGAAAATAGCAAGG + Intergenic
1111245459 13:85532844-85532866 GGGTTTACAAATAAATAGTAGGG - Intergenic
1111678866 13:91420015-91420037 GGGTTTATCCCAAAGTAGCAAGG + Intronic
1113662317 13:112116176-112116198 TTGTTTAAAAAAAAATAGGAAGG - Intergenic
1114903035 14:27089523-27089545 GGTTTTAAACAAAGATTGAAGGG + Intergenic
1114977698 14:28122730-28122752 CACTTTAAACTAAAATAGCAAGG + Intergenic
1115326006 14:32139038-32139060 GGATTTATCCAAAAAAAGCAAGG - Intronic
1115444795 14:33477626-33477648 GTGTTTAATCAGAACTAGCAGGG - Intronic
1117021788 14:51578421-51578443 GGGTTTAAACCAAAAGAGGTCGG + Intronic
1117426358 14:55602221-55602243 TGGTTTCAACTAATATAGCAAGG - Intronic
1119571240 14:75675333-75675355 GGGTTTAAACAAAAATAGCATGG - Intronic
1121207023 14:92178162-92178184 GGGTTTAATCCAGAATTGCATGG + Intergenic
1122183086 14:99970088-99970110 GGGCTTAAACAAATACAGGAAGG + Intergenic
1122512182 14:102278278-102278300 TAGATTAAATAAAAATAGCAGGG + Intronic
1122744329 14:103889127-103889149 GGGTTTAAAAAAAAAAAAAAAGG - Intergenic
1123473996 15:20576011-20576033 GGGATTAAAAAAAAAAGGCATGG + Intergenic
1126445190 15:48735260-48735282 GGGTCAAAAGAAAAATCGCAAGG + Intronic
1127255016 15:57282607-57282629 GGGTTTGAAAAGAAACAGCAAGG + Intronic
1129302575 15:74634076-74634098 GGGTTTAAATGAGAACAGCAGGG - Intronic
1130618186 15:85433548-85433570 GGGTTTAAACCAAAAAACAAAGG - Intronic
1131500057 15:92953574-92953596 GTGTGTAAACAAAAAGAGCTGGG + Intronic
1131864608 15:96694252-96694274 GAGTTTAAACAGAAATAGTCAGG + Intergenic
1131912442 15:97222986-97223008 GTGTTTAAAGAATAATACCAAGG - Intergenic
1132911285 16:2313732-2313754 CGGTTTCTACAAAAATAGCTGGG + Intronic
1134445024 16:14324472-14324494 GGAGTTAAAGAAAAATTGCAGGG - Intergenic
1134645875 16:15865390-15865412 GGATTTACACAAAAACAGGATGG - Intergenic
1134755585 16:16664532-16664554 GAGTTTAGACAAAAGTACCATGG - Intergenic
1134990481 16:18694629-18694651 GAGTTTAGACAAAAGTACCATGG + Intergenic
1135044793 16:19146378-19146400 GGATTTAAAGAAAAAGAGAATGG + Intronic
1135184016 16:20299116-20299138 GGGGTTAAACAAAAAAATCTTGG + Intergenic
1137906561 16:52328370-52328392 GGATTTAAAAAAAAATCGAAAGG + Intergenic
1137908040 16:52345777-52345799 GATTTTAAACAAAGATAGAAAGG + Intergenic
1138164765 16:54791095-54791117 AGTCTTAAAAAAAAATAGCAGGG - Intergenic
1138171664 16:54855976-54855998 AGGTATAAACAAATATGGCAGGG - Intergenic
1139208243 16:65050322-65050344 GGCTTTAAACAAATGTGGCATGG - Intronic
1139344696 16:66295212-66295234 TTGTTTTAACAATAATAGCAAGG - Intergenic
1140391175 16:74588255-74588277 GGATTTAAATAAAAATGGTAGGG + Intronic
1140462686 16:75153565-75153587 GGGTTTACAGAAAAATTGAATGG + Intronic
1140750938 16:78022939-78022961 GGTTTTAAAAAAAAACAACAGGG + Intronic
1141511766 16:84516906-84516928 GGGGTTAAATAAAAACAGCAAGG + Intronic
1143980801 17:10867893-10867915 TGCTTTAATGAAAAATAGCATGG + Intergenic
1146630181 17:34463970-34463992 ATGTTTAAACAACAACAGCACGG - Intergenic
1146652576 17:34615661-34615683 GGGATTAAAAAAAAACAGCAGGG + Intronic
1147043077 17:37732675-37732697 TCGTTTAAAAAAAAATAGCTGGG + Intronic
1149586786 17:57794162-57794184 TGGTTTAAACAAAAGTAACCTGG + Intergenic
1150369096 17:64620395-64620417 GGATTTATAGAAAAATAGGATGG - Intronic
1150684505 17:67309774-67309796 CGGTTTAAAAAAAAAAATCAAGG + Intergenic
1153698345 18:7666684-7666706 ATGTTTAGACAAAAACAGCAGGG - Intronic
1155645148 18:28068804-28068826 GGGTTGTATCTAAAATAGCATGG - Intronic
1156593481 18:38518865-38518887 GGGTTTAAACTAAACATGCATGG + Intergenic
1158147693 18:54334511-54334533 GGGTTTGACCATAAAAAGCAAGG - Intronic
1158427568 18:57353186-57353208 GGGTTAAAAAAAAAATAACAGGG - Intronic
1158700927 18:59745537-59745559 GGGTTTGGACAAATATATCATGG + Intergenic
1159583510 18:70261389-70261411 GGGTTTAACCAAAGAAAGCTTGG + Intergenic
1159649862 18:70965433-70965455 GGGTTTTAAGAAAAAAAGAAGGG - Intergenic
1159651068 18:70980225-70980247 GGCTTTCAATAAAATTAGCAAGG + Intergenic
1160472480 18:79149419-79149441 AGGTTTAAAAAAAAAGATCATGG + Intronic
1162146550 19:8615783-8615805 TGGTTTAAATAAAAAGAGAATGG - Intergenic
1162246444 19:9405600-9405622 AGGTGTAAATATAAATAGCAGGG + Intergenic
1164487833 19:28676297-28676319 GATTTAAAACAAAAATAGCCAGG + Intergenic
1166221552 19:41368254-41368276 CGTTTAAAAAAAAAATAGCAGGG + Intronic
1167308062 19:48720170-48720192 GGGTTTAAAGAAAAAGAGGCAGG + Intergenic
1168548476 19:57273524-57273546 AGTTTAAAACAAAAAAAGCAAGG - Intergenic
926255621 2:11193445-11193467 GAGATTAAACAAAAACAGAAAGG + Intronic
927910729 2:26897488-26897510 GGGTTTATTCAAAAAATGCAAGG - Intronic
929066962 2:37987096-37987118 GGGATTAAGCAATTATAGCAAGG + Intronic
929710859 2:44265171-44265193 GAGTTTTAACAAAAATGACATGG + Intergenic
929921826 2:46177962-46177984 GGATTTAAAAAAAAATGGCTGGG + Intronic
930152129 2:48069790-48069812 GGTTTTAAATAAAAATACCTGGG + Intergenic
930214149 2:48676134-48676156 TTGTTTAAAGAAAAAAAGCAAGG - Intronic
930760343 2:55028059-55028081 GGGTTTACTAAAAATTAGCATGG - Intronic
931769278 2:65483828-65483850 GATTTTAACCAAATATAGCAAGG - Intergenic
932244937 2:70189105-70189127 CTGTTTAAAAAAAAATGGCATGG + Intronic
937289380 2:120772949-120772971 GGGTTTATGCTAAAATATCAAGG - Intronic
938888129 2:135674812-135674834 GGGATTAAAAAAAAAAGGCAGGG - Intronic
940275292 2:151933761-151933783 GGGTTTTAAAAAAAATTGTAGGG + Intronic
940890404 2:159030157-159030179 GGGTGAAAAAAAAAATTGCAAGG + Intronic
941015149 2:160347387-160347409 GTGTTTAAATAAACATAGTATGG - Intronic
941871967 2:170395281-170395303 AATTTTAAACAAAAATAGTATGG - Intronic
941995447 2:171597460-171597482 TGGTTTAAAAAAAAATAAAAAGG - Intergenic
942306515 2:174612774-174612796 GGATTTAAAAAAAAATCACAGGG + Intronic
943802220 2:192075414-192075436 GAGTTTAAACAAAGACAACATGG + Intronic
944930962 2:204518672-204518694 GGGTTTAAAGATAACGAGCAAGG + Intergenic
945422009 2:209649646-209649668 GATTTCAAACTAAAATAGCATGG - Intronic
946694187 2:222335675-222335697 TAGTTTAAAAAAAAATAGCTGGG - Intergenic
947096947 2:226577287-226577309 GGGTTTGAAGAAAAACAACAGGG - Intergenic
1169244290 20:4013928-4013950 GTTTTAAAACCAAAATAGCAAGG + Intronic
1169291283 20:4355255-4355277 GGGTGGAAACAAGAATACCAAGG - Intergenic
1169536565 20:6549642-6549664 ACTTTTAAACAAAGATAGCAAGG + Intergenic
1170392325 20:15889161-15889183 TGGTATAAACACAAATACCATGG + Intronic
1170737282 20:19022878-19022900 GGGTTGGAACAAAAATAAAATGG + Intergenic
1170775000 20:19367485-19367507 GGGTTTAAAAAAAAAAAGGCAGG - Intronic
1171052183 20:21870393-21870415 GTGTTTTAATTAAAATAGCAGGG + Intergenic
1172558864 20:35867990-35868012 AGGTTTAAAACAAAATAGTAAGG + Intronic
1174760891 20:53206465-53206487 GGGTTAAAACAAATAGAGAAGGG + Intronic
1176209889 20:63914213-63914235 GGGTTTTAACAACAATTACAAGG - Intronic
1176895924 21:14378391-14378413 GGTTTTAAACAAAAATGGAATGG - Exonic
1177016523 21:15795872-15795894 GGATTAAAAAAAAATTAGCATGG - Intronic
1177194417 21:17887703-17887725 GCATTTAACCAAAAATACCATGG - Intergenic
1178413033 21:32381470-32381492 GCATTTAAAAAAAAAAAGCAGGG + Intronic
1179393378 21:41014417-41014439 GGATTAAAACAGAAAGAGCATGG + Intergenic
1182645422 22:31804965-31804987 AGATTTAAAGAAAAATGGCAAGG - Intronic
1184060692 22:42079350-42079372 TTGTTTAAACACAGATAGCACGG + Exonic
949403521 3:3690405-3690427 AGATTTAAACAAAAATAGCTAGG - Intergenic
951105990 3:18743688-18743710 GGGATTAAACAAAATTATAAGGG + Intergenic
951595205 3:24311361-24311383 GGGCTTAAGCAAAATTAGGAGGG + Intronic
951891920 3:27575539-27575561 GGGTTCAACAAAATATAGCAAGG - Intergenic
952100817 3:30011061-30011083 GAGTGTGAACAAAAATAGAAAGG + Intergenic
952941325 3:38446529-38446551 ATGTATTAACAAAAATAGCATGG + Intergenic
953400806 3:42614710-42614732 GGGTTTAAAAACAAAAACCAAGG - Intronic
953486006 3:43296753-43296775 GAGTTTTAACAAGAATAACAGGG + Intronic
954322500 3:49841690-49841712 GGGTTCAAACAAAGGCAGCATGG + Intronic
956849594 3:73216836-73216858 GATTTTCAACAAAAATACCAAGG + Intergenic
957103039 3:75851378-75851400 GGGTTAAAACGAAAATACCTCGG - Intergenic
957810681 3:85217776-85217798 GGGTTTAATGACAAATATCATGG + Intronic
959093751 3:101931323-101931345 AGGTTTAAACAAAAATACTCTGG + Intergenic
959275416 3:104271350-104271372 CAGTTTAATCAAAAATAGCAGGG + Intergenic
959303216 3:104628965-104628987 TCCATTAAACAAAAATAGCAAGG + Intergenic
959903223 3:111683200-111683222 GGGTTGAAATATAAATAGCGAGG + Intronic
959977238 3:112474372-112474394 TGGTGAAAACAAAAATAACAGGG - Intronic
960313191 3:116142107-116142129 GGATTTAAACACTTATAGCATGG + Intronic
963546441 3:146664699-146664721 TGGATCAAACAAAAATAGCTAGG + Intergenic
964585615 3:158296291-158296313 GGATTTCAACAAACATAGAAGGG + Intronic
964819989 3:160757763-160757785 GGGTGTAATCAAAAACAGGAAGG - Intronic
964945439 3:162217967-162217989 GGGGTCAAAACAAAATAGCAAGG + Intergenic
965531648 3:169776283-169776305 GGATTTATACCAAAATAGAAAGG + Intronic
965568167 3:170143458-170143480 AGGTTTTATCAAAAATACCAAGG + Intronic
965876801 3:173333446-173333468 GGGTATAAACAGAGATAGGAAGG - Intergenic
968153010 3:196353865-196353887 GTGTTTAAAAAAAAAAAGCTAGG - Exonic
969915255 4:10484551-10484573 AGCTTTAAAAAAAAATGGCAGGG + Intergenic
970552406 4:17195566-17195588 TAGTTTAAAAAAAAATAGGAGGG + Intergenic
974373478 4:61046519-61046541 TGCTTTAAACAAAAATCTCAGGG - Intergenic
974576940 4:63738101-63738123 GAGTTTTAAGAAAAATAGAAGGG - Intergenic
975366058 4:73529152-73529174 GTGTTTCAACAAATAGAGCATGG - Intergenic
975809698 4:78154386-78154408 GGTTTTAAACAAATAGACCAAGG - Intronic
976010637 4:80484091-80484113 GGGTAAAAACGAAAATAACAAGG - Intronic
977790790 4:101100020-101100042 GAGTTTAAAAAAAAATGGAAGGG + Intronic
977801594 4:101240507-101240529 GTGTTTAAAGAAAAATAACCAGG + Intronic
978081307 4:104595384-104595406 GAGGTTAAAAAAAAATAGCTGGG - Intergenic
978358015 4:107898256-107898278 GGGTCAAAAAAAAAATAGAAGGG - Intronic
978877214 4:113656226-113656248 AGGTTCAAACAAAAATTGCCTGG + Intronic
979056812 4:116005778-116005800 GTGTTTAAACAAAAACAGAAAGG - Intergenic
979222682 4:118247201-118247223 GGGTTTAAAAAAAAAAAAAAAGG + Intronic
979231142 4:118350312-118350334 GGGTGTGAACAAAAGTATCATGG - Intronic
979710869 4:123777858-123777880 GTGTTTGAATGAAAATAGCATGG - Intergenic
982194204 4:152893587-152893609 GGGTATAAATATAAAAAGCAAGG + Intronic
983445914 4:167851958-167851980 AGAATTAAAGAAAAATAGCATGG - Intergenic
983601296 4:169532401-169532423 GGATTTAAACAAATATATAATGG - Intronic
984778237 4:183503205-183503227 GTGAGAAAACAAAAATAGCAGGG + Intergenic
987613808 5:20246216-20246238 GGTTTTATAAAAGAATAGCATGG - Intronic
988223901 5:28386399-28386421 GAGTTTAAAAGAAAATAACATGG - Intergenic
989333274 5:40285339-40285361 GGGTAAAAACAGCAATAGCAAGG + Intergenic
989804513 5:45586668-45586690 GGCTTAAAACAACAATAGGAGGG - Intronic
989836800 5:46003726-46003748 AGCTTTAATCAAACATAGCATGG - Intergenic
991381334 5:66031006-66031028 GGTTTAAAACAAAAATTGTATGG + Intronic
992946414 5:81815480-81815502 GGATTAAAATAAAAATGGCAAGG + Intergenic
993393038 5:87344812-87344834 AGGTATAAAGAAAAATAGCTAGG - Intronic
994513031 5:100731981-100732003 GTGTTTAAACAGAAAGTGCAAGG + Intergenic
994920981 5:106042990-106043012 GGCTATAAAAAAAAAAAGCATGG + Intergenic
995496060 5:112744682-112744704 AGGTATAAACAAAAATATAAAGG + Intronic
996227013 5:121011935-121011957 GCCTTTAAACAAAAATAGATTGG + Intergenic
996542201 5:124642202-124642224 GAGACTAAACAAAAATAGGATGG - Intronic
996860947 5:128065023-128065045 GAGCTTAAACAATAATATCAAGG + Intergenic
998894646 5:146786613-146786635 GGGTTTATACACAAACAGAAAGG - Intronic
1000361933 5:160455859-160455881 GGACTTCAACAAAAATACCAAGG - Intergenic
1001531807 5:172468170-172468192 GGAATTTAAAAAAAATAGCATGG - Intergenic
1002336008 5:178478742-178478764 GGGTTTAAAGCAAAGTAGCCAGG + Intronic
1002486039 5:179537587-179537609 AGGTTTAAAAAAAAATAGGCTGG + Intergenic
1003384101 6:5651518-5651540 GAGTTGCAACAAAAAAAGCAAGG + Intronic
1003865553 6:10359287-10359309 AAGTTTAACCAAAAATAGAATGG + Intergenic
1004563977 6:16778431-16778453 GTGTTGAAACAATAAAAGCAAGG + Intergenic
1004895572 6:20144577-20144599 GGAATTAAACAGGAATAGCAGGG - Intronic
1010140470 6:72608273-72608295 AAGTTTAAAAAAAAATAGAATGG + Intergenic
1010497098 6:76548004-76548026 GGATTTCAACAAAAATTACAAGG - Intergenic
1010616539 6:78019882-78019904 GGCTTTAAACAAAAAAAAAATGG - Intergenic
1010679996 6:78787721-78787743 GGTTTTCAACAAAAATACTAAGG + Intergenic
1011285965 6:85723434-85723456 TGGGGAAAACAAAAATAGCATGG - Intergenic
1011926921 6:92656884-92656906 GGGATTAAATAAATATATCATGG + Intergenic
1012013338 6:93822001-93822023 GTGTTTAAAAAAAAATGGAATGG - Intergenic
1012166480 6:95960002-95960024 GGGTATATAAAAAAATTGCAGGG - Intergenic
1012291351 6:97459420-97459442 GGGTGTAAAAGAAAATAACAGGG + Intergenic
1013237596 6:108211150-108211172 TTGTTTAAACAAACTTAGCAAGG - Intergenic
1013823080 6:114178868-114178890 GGGGTTAAAAAAAAAAAGAAGGG + Intronic
1014889154 6:126821003-126821025 GAGATTAATCAAAAAAAGCACGG - Intergenic
1020613968 7:10435522-10435544 GCATTTAAATAAAAATGGCAGGG - Intergenic
1020739859 7:12001033-12001055 GGGTCTAAAAAAAAATTGTAGGG - Intergenic
1020921617 7:14272028-14272050 GGTTTTAAATCAAAATATCAAGG - Intronic
1021522286 7:21550137-21550159 TGGTTTAAAAAAAAATGGAAGGG - Intronic
1023251199 7:38263209-38263231 GGAATTAAACAAAAAATGCATGG - Intergenic
1028121566 7:87060864-87060886 GAGTTAAAAAAAAAAAAGCAAGG - Intergenic
1028354860 7:89894541-89894563 GGATTTAAACACAAGTAGTATGG + Intergenic
1028418004 7:90599599-90599621 GGGTATAAACAGAAATTGCAAGG - Intronic
1029639227 7:101808276-101808298 TTGTTTAAAAAAAATTAGCAAGG + Intergenic
1029870396 7:103685247-103685269 GGTGTTGAACAAAAATAGCTGGG - Intronic
1032918260 7:136515882-136515904 GTATTTAAACAAAAATAGGTTGG + Intergenic
1033010107 7:137612472-137612494 GTATTTATACAAAAATAGAAGGG - Intronic
1035194888 7:157209582-157209604 GGGTTTAATCAAATATTGAAAGG - Intronic
1037184013 8:16039923-16039945 GGGTCTATACACAAATAGGAAGG - Intergenic
1038542327 8:28400394-28400416 GGGTTTAAACAAAGTTGGTAGGG + Intronic
1038622381 8:29156305-29156327 TGGTTGAAACAAAAACAGGAAGG + Intronic
1040763663 8:50880440-50880462 TGGTTTAAACAAAAAATACAAGG - Intergenic
1040799963 8:51329473-51329495 GGCTTTAAACAAAATTTACAAGG + Intronic
1041851020 8:62393377-62393399 GGTTTTCAACAAAGATACCAAGG - Intronic
1041899322 8:62963656-62963678 GGATTTAAACTAAAAGAGAAAGG - Intronic
1042628663 8:70791065-70791087 GGATTTAAACATAAATTTCAGGG + Intergenic
1044335682 8:90982358-90982380 GGGTCTTAACTAAAATAGCTAGG - Intronic
1045161780 8:99555680-99555702 GGTTTTAGAGTAAAATAGCAAGG - Intronic
1045631214 8:104125317-104125339 GGGTTTCAACAAAAGCAACATGG - Intronic
1045690191 8:104752376-104752398 GGGTATGAACAAGAATAGCCTGG + Intronic
1046861697 8:119100151-119100173 TGGTTTAATGAAAAAAAGCAAGG - Intronic
1047046868 8:121063471-121063493 GGGATTAAAAACAAATGGCATGG + Intergenic
1048293778 8:133199660-133199682 AGATTTAAATACAAATAGCATGG - Intronic
1048385430 8:133908214-133908236 GAGCAGAAACAAAAATAGCATGG + Intergenic
1048939603 8:139387073-139387095 TGCTTTAAACATAAATAGAAAGG + Intergenic
1049122241 8:140749259-140749281 GTGTTTATCCAAAAATATCATGG - Intronic
1049913141 9:289670-289692 AGGTTTACAGAAAAATTGCATGG + Intronic
1049977935 9:877460-877482 GCTTTTCAACATAAATAGCAGGG - Intronic
1050633052 9:7580967-7580989 GGGTATAGACAAAATTAACAAGG + Intergenic
1050752430 9:8955937-8955959 GGGTATAAATATAAATAGTATGG - Intronic
1051799564 9:20917254-20917276 GGGATTAAAAAAAAAAAGAAAGG + Intronic
1052045167 9:23785544-23785566 GTGTGAAAACAAAAATAACAAGG + Intronic
1052849671 9:33369366-33369388 GGGTTTTTAAAAAGATAGCATGG - Intronic
1053535708 9:38923553-38923575 TAGTTTAAACCAAAACAGCATGG - Intergenic
1054207929 9:62147958-62147980 TAGTTTAAACCAAAACAGCATGG - Intergenic
1054337597 9:63820694-63820716 GTATTTAAAAAAAAATAGCTAGG - Intergenic
1054630424 9:67440395-67440417 TAGTTTAAACCAAAACAGCATGG + Intergenic
1054963734 9:70998555-70998577 GGGTTTAGACAAATCTAGAATGG + Intronic
1055164451 9:73174489-73174511 AGGTTTACAGAAAAATTGCACGG - Intergenic
1056170271 9:83979372-83979394 AAGTTTAAGCAAAAACAGCAGGG + Intronic
1056425101 9:86467747-86467769 GGGTTAAAAAAAAATCAGCAAGG - Intergenic
1056927231 9:90845234-90845256 GTGTATAAATAAAAATAACATGG - Intronic
1057941737 9:99290943-99290965 TGGTTTAAAAAAAAAGAGAATGG - Intergenic
1058186616 9:101862939-101862961 TGATTTGAAAAAAAATAGCATGG - Intergenic
1058255990 9:102764538-102764560 AGGTTTCAACAAAAATTGTAAGG - Intergenic
1058914730 9:109554788-109554810 GGATATAGACAAAAATATCAGGG + Intergenic
1059493492 9:114689764-114689786 TGGTTTAAAGAAAAATATTAAGG + Intergenic
1060619923 9:125055339-125055361 AGGTTAAATCATAAATAGCATGG + Intronic
1185895934 X:3858958-3858980 TGTTTTAAGCAAAAACAGCAAGG + Intergenic
1185901053 X:3897382-3897404 TGTTTTAAGCAAAAACAGCAAGG + Intergenic
1185906167 X:3935821-3935843 TGTTTTAAGCAAAAACAGCAAGG + Intergenic
1187348802 X:18492885-18492907 GGTTTTGAACAAGAATAGGAGGG - Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1188385538 X:29553161-29553183 GGCTTTCAACAAAAAGTGCAAGG - Intronic
1189152836 X:38725644-38725666 GGGTTTACTCACAAATATCATGG + Intergenic
1189698175 X:43687389-43687411 GGGCTTTAACAAAGACAGCAAGG - Intronic
1193535054 X:82704381-82704403 GTGTTTTAACAAAAATTTCAGGG + Intergenic
1193878044 X:86886323-86886345 GGGTTTAAACAAATGTATAAGGG - Intergenic
1194143477 X:90234647-90234669 AAATTTAAAAAAAAATAGCATGG - Intergenic
1194230588 X:91318434-91318456 GGGTTTATTCAAAAAATGCAAGG + Intergenic
1194406699 X:93504967-93504989 TGTTTTAGACAAAAATAGCTGGG - Intergenic
1194454717 X:94088463-94088485 AGGTTAAAAAAGAAATAGCAGGG + Intergenic
1194499496 X:94662773-94662795 AGGTATAGACAAAAGTAGCAAGG + Intergenic
1194607673 X:96001663-96001685 GGAATTAAACAAATTTAGCATGG + Intergenic
1195397727 X:104429431-104429453 AGGTTTACACACAATTAGCAAGG + Intergenic
1195424871 X:104717501-104717523 GGGTTCATACAAAAATGGGAAGG + Intronic
1195933498 X:110103362-110103384 GGGTTTCCACAGAAAAAGCAGGG + Intronic
1196343363 X:114623012-114623034 GGGTTTAAAAAAAAATTCAAAGG + Intronic
1197308423 X:124872646-124872668 GGTTTCAAAGGAAAATAGCATGG + Intronic
1197309716 X:124889488-124889510 GGGTTTCAAAACAAAAAGCAAGG + Intronic
1197698406 X:129575969-129575991 GGGATGAAAGAAAAATGGCAGGG - Exonic
1200489230 Y:3803968-3803990 AAATTTAAAAAAAAATAGCATGG - Intergenic