ID: 1119572963

View in Genome Browser
Species Human (GRCh38)
Location 14:75692678-75692700
Sequence CTGTGTATGGGGAGCGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 251}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119572963 Original CRISPR CTGTGTATGGGGAGCGAGGC AGG Intronic
900029543 1:360993-361015 CTGTGTATGGTAAGAGAGACGGG - Intergenic
900582401 1:3415610-3415632 GTTTGTGCGGGGAGCGAGGCCGG + Intronic
900736066 1:4300261-4300283 CTGGCTCTGGGGAGAGAGGCTGG + Intergenic
900908214 1:5575737-5575759 CTGTGCATGGGGACAGAGGTGGG - Intergenic
901029831 1:6300633-6300655 CTGTGTTTGTGGAGAGAGGCCGG - Intronic
901407150 1:9056939-9056961 CAGTGTTTGGGGACCTAGGCAGG - Intronic
901533376 1:9867337-9867359 GTATCTATGGGGAGCCAGGCAGG - Intronic
902503503 1:16925510-16925532 CTGTGTATGGGAAGAGACACTGG + Intronic
903166590 1:21524711-21524733 CTGGGGAGGGGGAGCAAGGCAGG + Intronic
903951438 1:26998085-26998107 CTTTGAAAGGGGAGCAAGGCCGG + Intronic
905147901 1:35902295-35902317 CTGTTTTTGGGGTGCGAAGCAGG - Exonic
905393355 1:37651981-37652003 CTGTGTGGGGGAAGCGAGGGTGG + Intergenic
905970558 1:42138693-42138715 CTGGGTATGGGGAGAGTGGGAGG - Intergenic
906361997 1:45168946-45168968 TTGTTTATGGGGAACCAGGCAGG - Intronic
906688807 1:47779340-47779362 GTGTGTGTGGGGAGAGGGGCTGG + Intronic
907459117 1:54594707-54594729 CTGTGCATGGGGAGGGTAGCTGG + Intronic
909941455 1:81616280-81616302 CTGTTGATGGGGAGAGAGGTAGG - Intronic
912431179 1:109629255-109629277 CTGGGTATGGGGAGGGCAGCCGG + Intronic
916990576 1:170239640-170239662 CTGTGTATGGGTGGGGAGGGAGG + Intergenic
917436761 1:175029960-175029982 CTGTGTGTGGGAACCGAGGATGG - Intergenic
917716048 1:177739144-177739166 CTGTGTAGAGGGAGCGGGGAAGG + Intergenic
918235272 1:182574354-182574376 CTGGGTATGGGAAGTGAGGGAGG + Exonic
920766069 1:208835130-208835152 CTGTGTGTGTGGGGAGAGGCAGG - Intergenic
921300591 1:213748022-213748044 CTGTGTATGAGGAGCCAGGTGGG + Intergenic
921305105 1:213788533-213788555 CAGGGTATGGGGAGGGAGTCAGG - Intergenic
921752885 1:218817994-218818016 CTCTGTAAGGGGAGGGGGGCGGG - Intergenic
1063584343 10:7337918-7337940 CTGTGTTTTGGGGGCCAGGCTGG - Intronic
1069556600 10:69402422-69402444 CTGTGTTTGGGTAGAGAGGGAGG - Intergenic
1069598732 10:69689472-69689494 CTGGGTATGGGAAGCCAGGCAGG - Intronic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1070190800 10:74110201-74110223 CTGTGCATGGGGAGTGGGGGAGG + Intronic
1070673728 10:78397514-78397536 CAGGGTATGGAGAGCCAGGCAGG + Intergenic
1070770050 10:79077032-79077054 CTGTGTATGGGGAAGCAGGGAGG + Intronic
1072256030 10:93621135-93621157 GTGTGTGTGGGGAGAGTGGCGGG - Intronic
1074325604 10:112447547-112447569 GTGTCTATGAGGCGCGAGGCTGG + Intronic
1074910968 10:117908486-117908508 CTGCTTATGGGGAGGGAGGAAGG - Intergenic
1076145610 10:128117436-128117458 CTGTCTCTGGGGAGCCAGGTGGG - Intronic
1076146463 10:128126212-128126234 CGGTGTGTGCGGAGCGTGGCGGG - Exonic
1076314058 10:129528476-129528498 CTGTGAAGCGAGAGCGAGGCTGG + Intronic
1076314168 10:129529133-129529155 CTGTGAAGCGAGAGCGAGGCTGG + Intronic
1077498515 11:2898267-2898289 CTGGGTCTGGAGAGAGAGGCAGG - Intronic
1078456910 11:11482581-11482603 CTGTGTATGGGAATCCAAGCTGG - Intronic
1079334964 11:19563282-19563304 CTGTGTTTGGGAAGAGAGACTGG - Intronic
1083327212 11:61878842-61878864 CTGAGCCTGGGGAGAGAGGCAGG + Exonic
1084068332 11:66718369-66718391 CTGGGTGTGGGGAGAGTGGCCGG - Intronic
1084122603 11:67078145-67078167 CTGTGTGTGGCGGGCTAGGCAGG - Intergenic
1086891108 11:92259007-92259029 CTGTGTGTGGGGGGCGGGGGTGG + Intergenic
1088627768 11:111744023-111744045 CTGTGTAAGTGGAGAGAAGCGGG + Intronic
1089432771 11:118436904-118436926 CCGTGTTTGGGGAGAGCGGCGGG + Exonic
1089787757 11:120920370-120920392 ATGTGTTTGGGGACCGAGGTGGG - Intronic
1091875314 12:3928929-3928951 CTGTATATGGGGAGGTGGGCAGG - Intergenic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1096412980 12:51390811-51390833 CTGTGTATGGGGGTGGAGGGTGG - Intronic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1102959695 12:117084709-117084731 CTGAGTCAGGGGAGGGAGGCTGG - Intronic
1103791720 12:123476884-123476906 CTGTGTGTGGGGAACGAAGAAGG + Intronic
1104407271 12:128528456-128528478 GTGTTTTTGGGGAGCGCGGCTGG + Intronic
1104967326 12:132514146-132514168 CCGTGTGTGGGGAGACAGGCTGG + Intronic
1105407847 13:20146182-20146204 CCGTGTGTGGGGAGCCAGCCAGG - Intronic
1105700673 13:22933505-22933527 GTGTGTGTGGGGAGCGGGGATGG - Intergenic
1105853468 13:24355660-24355682 GTGTGTGTGGGGAGCGGGGATGG - Intergenic
1108465737 13:50713857-50713879 GTGTGTCTGAGGAGGGAGGCAGG - Intronic
1112575883 13:100636336-100636358 CCGCGGGTGGGGAGCGAGGCTGG - Intronic
1114524768 14:23360584-23360606 CTGGATATGGTGAGCCAGGCTGG + Exonic
1117340862 14:54790009-54790031 GTGTGTGTGTGGAGCAAGGCTGG - Exonic
1117551838 14:56844518-56844540 CTATTTATGTGGAGCAAGGCAGG - Intergenic
1118048641 14:62002605-62002627 CTGTCTCCGGGGAGAGAGGCAGG - Intronic
1119572963 14:75692678-75692700 CTGTGTATGGGGAGCGAGGCAGG + Intronic
1119574334 14:75704875-75704897 ATGTGTATGGTGAGCAAGGGAGG + Intronic
1120227865 14:81810943-81810965 CTGTGTATGGAGAGAGATGGAGG - Intergenic
1122092020 14:99347164-99347186 CTGGGTGTGGGGAGGAAGGCGGG - Intergenic
1122246284 14:100405511-100405533 CAGGGGATGGGGAGGGAGGCTGG + Intronic
1122328043 14:100894491-100894513 CTGTGTATGGGGACCCAGGGCGG - Intergenic
1122989244 14:105229248-105229270 CTGAGGATGCGGAGCCAGGCTGG + Intronic
1124422805 15:29537500-29537522 CTGTATATAGGGTGCGTGGCTGG - Intronic
1125766278 15:42138623-42138645 CTGAGTATGAGGACAGAGGCTGG - Intergenic
1126861424 15:52886622-52886644 CTGTGCATGGGAAGCGAGAGGGG - Intergenic
1127292961 15:57586564-57586586 CTGGGTATGGGGATGGAGGGTGG - Intergenic
1128703563 15:69821866-69821888 CTGTGTCTGAGGACCGTGGCGGG - Intergenic
1129460195 15:75696712-75696734 CTGTTTATGGGGAGGAAGGGTGG - Intronic
1130300964 15:82679845-82679867 GTGTCTCTGGGCAGCGAGGCAGG - Intronic
1131056867 15:89380018-89380040 CTGTGTATGTGCAGAGAGACAGG - Intergenic
1131515308 15:93072975-93072997 ATGGGTATGGGGAGAGGGGCAGG - Exonic
1134022348 16:10929838-10929860 CTGTTTATTGGGAGGGAGGAGGG + Exonic
1134135539 16:11674309-11674331 CTGTTTGTGGCGAGCGAGGCAGG + Intronic
1135688708 16:24519217-24519239 CAGTGTCTGGAGATCGAGGCAGG - Intergenic
1137684251 16:50374784-50374806 CTGAGGAGGGGGAGGGAGGCAGG + Intergenic
1139488136 16:67270957-67270979 CCGTGGATGGGGAGGCAGGCAGG - Exonic
1142765016 17:2059797-2059819 CTGGGACTGGGGAGGGAGGCAGG - Intronic
1143028500 17:3954402-3954424 CTGGGTATGTGGGGCGGGGCTGG - Intronic
1143267682 17:5652718-5652740 CAGTATATGGGGAGGGAGGAAGG + Intergenic
1143780043 17:9224588-9224610 CTGTGGAAGGGGCGGGAGGCTGG - Intronic
1144791554 17:17862398-17862420 CTGTGGATGAGGGGCCAGGCAGG + Intronic
1146184720 17:30717366-30717388 CTGTGTGTGGGGAGGGTTGCTGG - Intergenic
1146747462 17:35345230-35345252 CTGGGTAAGGAGAGTGAGGCAGG - Intergenic
1148247923 17:46047615-46047637 CTTTGTAGGGGGCGGGAGGCGGG + Intronic
1148791612 17:50176354-50176376 CTAGATATGGAGAGCGAGGCCGG + Intergenic
1148829769 17:50424128-50424150 CTGTGGATGGGGAGGAGGGCTGG - Intergenic
1149141815 17:53440274-53440296 CTGTGTATGGTGAGGGGGGATGG - Intergenic
1149505610 17:57191303-57191325 CTGTGGATTGGGTGAGAGGCAGG + Intergenic
1149560533 17:57604955-57604977 TTGTGTGTGGGGAGGGGGGCGGG + Intronic
1149725863 17:58893675-58893697 CTGTCGATAGGGAGGGAGGCTGG + Intronic
1150386467 17:64765519-64765541 CTGAGAATGGGGAGGGAGGAGGG - Intergenic
1150661268 17:67081790-67081812 ATGTGTATGTGGGGCGGGGCAGG + Intronic
1151213458 17:72561549-72561571 CTGTGTCTGGGGAGTCAGGCTGG - Intergenic
1152723033 17:81932096-81932118 CTGTGTGAGGGGAGCTGGGCTGG - Intergenic
1152847849 17:82613566-82613588 CAGTGTATGGGAAACAAGGCCGG - Intronic
1152950214 17:83225567-83225589 CTGTGTATGGTAAGAGAGACGGG + Intergenic
1153554004 18:6291667-6291689 CTGTGTATGGTGAGAGATACGGG - Intronic
1155035241 18:22020377-22020399 CTGAGTATGGGTAGAGAGGAAGG - Intergenic
1155526508 18:26721314-26721336 CTGGGGATGGGGATGGAGGCAGG + Intergenic
1155925647 18:31652413-31652435 TGGTGTCTGGGGGGCGAGGCAGG - Intronic
1156134927 18:34026269-34026291 GTGTGCATGGGGAGGGAGGAGGG - Intronic
1156610014 18:38714766-38714788 CTGCGTATGTGGAGGGAAGCTGG + Intergenic
1157011129 18:43650232-43650254 CTGTGTTTTGGGAGAGAGGAAGG + Intergenic
1157881472 18:51325039-51325061 CTGTGTGTGGGCAGAGAGGTGGG + Intergenic
1160779364 19:871003-871025 CTGTGTTTGGGGACCAATGCAGG + Intronic
1161324326 19:3656125-3656147 GTGGGGATGGGGAGCCAGGCAGG + Intronic
1162974063 19:14198327-14198349 CTGTGTGTGGGGAGGGTTGCTGG + Intronic
1163549146 19:17955784-17955806 CTGTGTGTGGGGGGCGGGGGCGG - Intronic
1166784460 19:45359358-45359380 CTGGGGCTGGGTAGCGAGGCCGG - Intronic
1167445425 19:49534411-49534433 CGGTGTATGGGGAGCAGGGTCGG - Intronic
1167456456 19:49598834-49598856 CTGGGTTTAGGGAGAGAGGCAGG + Intronic
1168076528 19:53983158-53983180 GTGTGCATGGGGGGCGGGGCGGG + Exonic
1168305484 19:55433087-55433109 CTGTGTCGGGGGATCCAGGCTGG + Exonic
925366851 2:3316554-3316576 CTGTGAGTTGGGAGAGAGGCAGG - Intronic
927556532 2:24037912-24037934 CTGTGTCTGGGCAGCGATGCTGG + Exonic
927683903 2:25157914-25157936 CTGTGTATGGGAAAGGGGGCTGG - Exonic
928059250 2:28093929-28093951 GTGTATATGGGAAGCCAGGCTGG + Intronic
930946144 2:57078371-57078393 CTGTGTAAGGAGAGGGGGGCGGG - Intergenic
931618060 2:64181630-64181652 GTGTGTATGGAGCGGGAGGCAGG + Intergenic
931924243 2:67054048-67054070 GTGTGTATGGTGGGTGAGGCAGG - Intergenic
932460452 2:71878850-71878872 CTGTGTGTGGGGAGCACAGCTGG - Intergenic
932837402 2:75050453-75050475 CTCTGGATGGGGAAGGAGGCGGG - Intronic
932849863 2:75174040-75174062 CTGGGTTTTGGGAGTGAGGCAGG - Intronic
934561511 2:95315868-95315890 CTGTGGATGGGGCCCGAGGCAGG - Intronic
934615702 2:95769361-95769383 CCCAGTATGGGGAGAGAGGCTGG + Intergenic
935601837 2:104929833-104929855 TTGTCTTTTGGGAGCGAGGCAGG - Intergenic
935943618 2:108267277-108267299 CAGTGTGTGGGGAGCTAGCCAGG - Intergenic
935982028 2:108636804-108636826 CTCTGTGTGGGGAGAGAGGAAGG + Intronic
938378457 2:130823578-130823600 ATCTGTGTGGGGAGCTAGGCCGG + Intergenic
940514674 2:154666995-154667017 TTGTGTATGTGGTGCGAGGAAGG - Intergenic
943789586 2:191917344-191917366 TTGTGTGTGGGGAGTGAGGGGGG + Intergenic
946228763 2:218278999-218279021 CTGTGGTTGGGCAGGGAGGCAGG - Intronic
946569625 2:221009472-221009494 GTGTGTATGGGGATGGATGCGGG - Intergenic
948379280 2:237541598-237541620 CTGTTCAAGGGGAGCGAGTCAGG + Intronic
948401036 2:237685665-237685687 CTGGGTGTGGGGAGCGGGGAGGG - Intronic
948888923 2:240897457-240897479 CTGTGTGTGGGGACCTAGGCAGG - Intergenic
949031232 2:241798446-241798468 CCCTATATGGGGAGCGAGGGTGG + Intronic
1169526845 20:6437676-6437698 AAGTGGATGGGGAGCGAGGTTGG + Intergenic
1170530077 20:17282220-17282242 GTGTGTATGGAGAGAGAGGTAGG - Intronic
1170659141 20:18319119-18319141 CTTTCTATGGGCAGGGAGGCAGG + Intergenic
1172186604 20:33034923-33034945 CTGTGGCTGGGGAGGAAGGCCGG + Intronic
1172783672 20:37451966-37451988 CTGAGGATGGGGAGCTGGGCAGG - Intergenic
1172875935 20:38164428-38164450 TTGTGTGTGGGGAGGGAGTCAGG + Intronic
1173003610 20:39123199-39123221 GAGTGTAAGGGGAGGGAGGCAGG + Intergenic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1175408198 20:58748787-58748809 CTGTGGTTGGGGAGGGAGGGAGG - Intergenic
1175429625 20:58891993-58892015 CTGTCTGTGGGGGGCGAGGCCGG + Intronic
1175620562 20:60443574-60443596 CTGTGTATGAGGCACGATGCTGG + Intergenic
1178044976 21:28682896-28682918 CTGTGTAGGGGGAGCGGGGAGGG + Intergenic
1178845326 21:36169681-36169703 CTGGGTGTGGGCAGCGAGGCGGG + Intronic
1180085525 21:45506445-45506467 GTGTGTCTGAGGAGCCAGGCTGG - Intronic
1180594815 22:16966184-16966206 CTGTGAGTGGGGAGCCAAGCAGG + Exonic
1183017022 22:34997100-34997122 CTGTGTATGGCTCGCCAGGCAGG - Intergenic
1184268003 22:43360301-43360323 CTGTGGGTGGGGAGTGAAGCGGG + Intergenic
1184533689 22:45072255-45072277 GTGTGTACGGGGGGCGAGGGTGG - Intergenic
1185229276 22:49670914-49670936 CTGGGGATGGGGAGGGAGGCTGG + Intergenic
1185280662 22:49968588-49968610 CTGTGGAGGGCGGGCGAGGCGGG - Intergenic
950567947 3:13782359-13782381 CTCTGTGTGGGGAGGGAGGTCGG - Intergenic
950727061 3:14923416-14923438 GTGTGTAAGGGGACAGAGGCAGG + Intronic
952591065 3:34954253-34954275 CTGTGTATGGGGAAGGAGATAGG + Intergenic
954709410 3:52497890-52497912 ATGGGTTTGGGCAGCGAGGCAGG + Intronic
954922370 3:54202985-54203007 CTGTGTCTGGGGATCATGGCTGG + Intronic
955101574 3:55854838-55854860 CTGGGGATGGGGAAGGAGGCTGG + Intronic
956182112 3:66527284-66527306 CTCTGTATGGGGTGGGGGGCGGG + Intergenic
958033390 3:88142013-88142035 GTGTGTGTGGGGAGGGGGGCTGG + Exonic
958151014 3:89695536-89695558 CTGTGTGTAGGGAGAGGGGCAGG - Intergenic
960020097 3:112940140-112940162 TTTTGTATGGGGTGAGAGGCAGG - Intronic
961388084 3:126535842-126535864 CTGTGTATGGGCAGCCAGAAAGG - Intronic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076293 3:195817475-195817497 CTGTGTAAGGAGAACGAGGCCGG - Intergenic
968089812 3:195892948-195892970 TTGTGTATGGGGAGGCAGGGGGG - Intronic
968485934 4:861778-861800 CTCTGTATGGGCAGTGGGGCTGG - Intronic
968702714 4:2064449-2064471 CTGTGCTTGGTGAGCAAGGCTGG - Exonic
968731619 4:2271801-2271823 CGGGGTATGGTGAGGGAGGCGGG + Intronic
968870422 4:3239235-3239257 CTGGGTGAGGGGAGCGAGGGTGG + Intronic
968881336 4:3301661-3301683 CTGGGGATGGAGAGTGAGGCCGG + Intronic
969147167 4:5134015-5134037 CTGTTGATGGGGAGAGAGTCAGG - Intronic
969542692 4:7803535-7803557 CTGTGGTTGGGGATCGGGGCCGG - Intronic
969699910 4:8762277-8762299 CACTGTATGGGGAGTGAAGCTGG - Intergenic
969898491 4:10326929-10326951 TTGTGTATGGGGAGAGAGTGAGG + Intergenic
971037144 4:22706080-22706102 TTCTGGATGGGGAGAGAGGCAGG + Intergenic
972359656 4:38315208-38315230 CTGTGCGTGAGGAGAGAGGCTGG + Intergenic
978525750 4:109663474-109663496 TTGTGGAAGGGGAGAGAGGCAGG - Intronic
978583700 4:110256578-110256600 CTGTGTCTGGGGAGGGCTGCAGG + Intergenic
979920134 4:126486542-126486564 ATGTGTATGGGGATAGAGGTTGG + Intergenic
982452237 4:155566805-155566827 CTGTGGGTGGGGAGTGTGGCTGG - Intergenic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
985936771 5:3103352-3103374 TTTTATCTGGGGAGCGAGGCTGG - Intergenic
988404974 5:30812471-30812493 CTGTGTCTTGGGAGTGAGGATGG + Intergenic
989168874 5:38455906-38455928 CTGTGTACGTGAAGGGAGGCTGG - Intronic
990507336 5:56457576-56457598 TTGGATATGGGGAGCAAGGCTGG + Intergenic
991475335 5:67012394-67012416 GTGTGTATGGAGGGTGAGGCTGG - Intronic
992832764 5:80610970-80610992 CTGTGTATGGGAGGGGAGGCCGG - Intergenic
997817466 5:137033025-137033047 CTGGGGATGGGCAGAGAGGCAGG + Intronic
1002359930 5:178662386-178662408 CTGCGTCTGGGGAGAGAGGAGGG - Intergenic
1002744447 5:181459379-181459401 CTGTGTATGGTAAGAGAGACGGG + Intergenic
1005773542 6:29103146-29103168 GTGTGTAGGGGGAGCGGGGAGGG + Intergenic
1006004094 6:30988776-30988798 CTGTGTGTGGGGGGGGAGGGGGG + Exonic
1006104930 6:31710733-31710755 CTGTGTATGGGGAGGGGTGGGGG + Intronic
1006373587 6:33659672-33659694 CTGTGGAGGTGGAGGGAGGCTGG - Intronic
1007729704 6:43938565-43938587 CCGTGTCTGTGGAGCGAGGCTGG + Intergenic
1007974538 6:46087025-46087047 ATGTGTATGGTGAGCTAGGATGG - Intergenic
1008044275 6:46835557-46835579 CTGTGGCTGGGGAGACAGGCAGG + Intronic
1012541118 6:100363046-100363068 GTGTGTGTGGGGAGAGGGGCAGG - Intergenic
1016341210 6:143062986-143063008 CTGTGTTGTGGGAGCAAGGCAGG + Intronic
1017036318 6:150270332-150270354 CTGTGTAAGGGGAGGCATGCTGG + Intergenic
1018027340 6:159816465-159816487 CTGTGGATGGTGAGCTAGGATGG + Intronic
1019182424 6:170198971-170198993 CTGAGAATGGGGATGGAGGCAGG + Intergenic
1019882965 7:3879576-3879598 CTGAGTACCGGGAGCGTGGCTGG - Intronic
1022100377 7:27165800-27165822 GTGTGTATGGGGGGGGAGACGGG - Intronic
1024291411 7:47807337-47807359 CTGTGTAAGGAGAACCAGGCAGG - Intronic
1027570221 7:79856891-79856913 CTGTGTTTGGGGAGAGAGCATGG - Intergenic
1030341502 7:108385892-108385914 CTGTCTATGGAGAGAGAGGGAGG + Intronic
1030689201 7:112515497-112515519 CTGAGTATGGGTAGCTAAGCAGG - Intergenic
1033147107 7:138880809-138880831 GGGGGAATGGGGAGCGAGGCAGG + Intronic
1033641063 7:143263611-143263633 CAGTGTCTGGGGAGTGAGGGCGG + Intronic
1033755589 7:144396492-144396514 TTGTGTATGGGGGGCGGGGCTGG - Intergenic
1034412802 7:150950149-150950171 CTGGGTATGGGGTGGGGGGCGGG - Exonic
1035470648 7:159106755-159106777 CTGGGTAGGGGCAGAGAGGCCGG + Intronic
1035498738 8:74727-74749 CTGTGTATGGTAAGAGAGACGGG - Intronic
1037002948 8:13743129-13743151 GTGTGTGTGGGGAGGGGGGCTGG + Intergenic
1038013465 8:23493709-23493731 CTGTGTATGGGAACAGAGCCAGG - Intergenic
1038437445 8:27545829-27545851 CTGTGTATAGGGAGAAAGCCAGG + Intergenic
1038490811 8:27969737-27969759 CTGTGCATGGGAAGGGTGGCAGG + Intronic
1039060004 8:33565794-33565816 CTGTCCCTGGGGTGCGAGGCTGG - Intronic
1039434009 8:37547271-37547293 GTGTGTATGGGGTGGGGGGCGGG - Intergenic
1041417644 8:57629987-57630009 CTGGGCATGGGGAGCGATGCTGG + Intergenic
1044279480 8:90339198-90339220 CTCAGTATGGGAAGCCAGGCAGG - Intergenic
1046669502 8:117042482-117042504 CTGTGTATGTGAGGCGGGGCGGG + Intronic
1047980964 8:130181659-130181681 CTGTGTGTGGGGAGGGGGCCAGG + Intronic
1048212848 8:132470076-132470098 TTCTGTATGGAGAGAGAGGCTGG - Intronic
1048707427 8:137169483-137169505 CTGTGTTTGTGGAACGAGGTTGG + Intergenic
1048974652 8:139664404-139664426 CTGTGTAGGGGAGGGGAGGCGGG - Intronic
1049283213 8:141761093-141761115 CTGTGTTTGGGGACAGAGGTGGG - Intergenic
1049802037 8:144522353-144522375 CCGTGTGTGGGGCGCGAGCCGGG - Exonic
1049992815 9:1006128-1006150 CGGTAAAGGGGGAGCGAGGCTGG - Intergenic
1050174179 9:2852760-2852782 ATGGGAATGGGGAGTGAGGCAGG + Intergenic
1050772805 9:9224302-9224324 ATGTGTATGGGGAGGGAGAAAGG + Intronic
1053118033 9:35522592-35522614 CTGTGTATAAGGAGCTATGCTGG - Intronic
1053375382 9:37601604-37601626 CGGTGTATGGAGATAGAGGCGGG + Intronic
1053653327 9:40191434-40191456 CTGTGGCTGGGGAGACAGGCAGG - Intergenic
1053903729 9:42820724-42820746 CTGTGGCTGGGGAGACAGGCAGG - Intergenic
1055236988 9:74133953-74133975 CAGGATATGGGGAGCGGGGCAGG + Intergenic
1055611467 9:78030454-78030476 CTGTGTACTGGGGGCGAGGCGGG - Intronic
1056182985 9:84103442-84103464 CTGGGGAGGGGGAGGGAGGCAGG + Intergenic
1057995965 9:99821943-99821965 CTGTGTATGGGGAGCGGAGGAGG - Exonic
1058077953 9:100669567-100669589 GTGTGTGTGGGGAGGTAGGCGGG + Intergenic
1059107216 9:111522076-111522098 CTGTGTACGGGAACAGAGGCTGG + Intergenic
1059394519 9:114025923-114025945 CTGTGCATGGCGGGCAAGGCTGG + Intronic
1060027280 9:120183846-120183868 CTGTATGTGAGGAGCCAGGCAGG + Intergenic
1060196530 9:121627619-121627641 CTGTGTATGAAGAGCGGGGCTGG + Intronic
1061541096 9:131278100-131278122 CTGTGTGCGGGGAGCGAGGGTGG - Intergenic
1061908024 9:133708703-133708725 CAATGTGTGGAGAGCGAGGCTGG - Intronic
1203610258 Un_KI270748v1:89873-89895 CTGTGTATGGTAAGAGAGACGGG + Intergenic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1186325076 X:8467179-8467201 GTGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186664683 X:11705098-11705120 CTGTGTGTGGGGAGAGAGCCAGG + Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187267237 X:17746797-17746819 CAGTGCATGGGGAGGCAGGCTGG - Intronic
1192265824 X:69537411-69537433 CTGTGCATGGGGTGCAAGACTGG - Intergenic
1192497334 X:71624663-71624685 CTGTGTAAGGTGAGAGGGGCTGG + Intergenic
1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG + Intergenic
1197411086 X:126117211-126117233 CTGGGTTTGGGGAGAGAGGTGGG - Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic