ID: 1119574543

View in Genome Browser
Species Human (GRCh38)
Location 14:75707111-75707133
Sequence AGCAAAAATCTGGCCCAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119574543 Original CRISPR AGCAAAAATCTGGCCCAATT TGG (reversed) Intronic
905044648 1:34986027-34986049 ATCAGACATCTGGCCAAATTTGG - Intronic
905597011 1:39216447-39216469 AGCAAAATTGTGACCCAAATAGG + Intronic
905652160 1:39663735-39663757 AGCAGACATCTGGCCCAAGCTGG + Intronic
906506150 1:46381236-46381258 ACCAAAAATCTGGCCTGAATGGG - Intergenic
910053951 1:83009161-83009183 AGCATGAATCTGGCACATTTGGG - Intergenic
910511452 1:88010994-88011016 AGCAAAAACATGACTCAATTTGG - Intergenic
911928334 1:103866384-103866406 AACAAAAATCTGGCTCTATTTGG - Intergenic
912470509 1:109903659-109903681 AGCAAATATCTGACCTAATCAGG + Intergenic
912596137 1:110878264-110878286 AGCGAAAATCTGCCCCAGTGAGG - Intronic
913188360 1:116391121-116391143 AGTAAAAATCTGACCAAAGTGGG + Intronic
913571633 1:120125992-120126014 AGCAAAAATATAGACAAATTTGG + Intergenic
914292554 1:146287613-146287635 AGCAAAAATATAGACAAATTTGG + Intergenic
914553598 1:148738396-148738418 AGCAAAAATATAGACAAATTTGG + Intergenic
915282354 1:154831174-154831196 AGCCAAAAGCTGGCCCACCTAGG + Intronic
916310968 1:163398475-163398497 AGCAGAAATCTACTCCAATTGGG + Intergenic
916476329 1:165172824-165172846 AGCAAAACTGAGGCCCAGTTTGG - Intergenic
924539381 1:244967395-244967417 AGCTAATATGTGCCCCAATTAGG + Intergenic
924589349 1:245388446-245388468 AGAGGAAATCTGGCCCAATCAGG - Intronic
1063048963 10:2424603-2424625 AGGAAAAATAAGGGCCAATTTGG + Intergenic
1065192061 10:23221554-23221576 AGCAATAATCTTGGCTAATTTGG + Intronic
1065449303 10:25839544-25839566 AGCAAAATTCTAGCCCCACTTGG - Intergenic
1065757413 10:28945137-28945159 AACAAAAATCTGGTCCTATGAGG - Intergenic
1068145670 10:53067365-53067387 ATAAAAAATCTGACCTAATTTGG + Intergenic
1068187702 10:53607802-53607824 AGTATCAATCTGGCTCAATTAGG - Intergenic
1069025400 10:63534651-63534673 AGCAAAAATCTGAGGCAATTGGG - Intronic
1070338850 10:75478366-75478388 GGCAAAAATATGGCCTACTTGGG - Intronic
1072006662 10:91257111-91257133 AATAAAAAGATGGCCCAATTTGG + Intronic
1072218374 10:93307256-93307278 AGCAAAAATCTCCCCTAATTGGG + Intronic
1072497449 10:95976183-95976205 AGGAAAAATCTAGCCAAAATGGG - Intronic
1073609341 10:104927987-104928009 GGCAAAAATCAGGCAGAATTTGG + Intronic
1074032618 10:109703822-109703844 AGCAAAGATCTTGCCCATTGAGG - Intergenic
1075320463 10:121487547-121487569 AGCAGAAATCAGTCCCAATGAGG + Intronic
1075361601 10:121841230-121841252 AGCCACAATCTGGCCCATTAGGG + Exonic
1075748082 10:124742390-124742412 AACAAAAACCTGGCCTAATAAGG + Intronic
1079544760 11:21619786-21619808 ATCAAAGATCTCTCCCAATTGGG - Intergenic
1081041399 11:38218758-38218780 CAGAAAAATCTGGCCCAATATGG - Intergenic
1082674908 11:56085570-56085592 AGCAAAAATATTGCCTAATAAGG + Intergenic
1083773697 11:64882651-64882673 AGCCAGAACATGGCCCAATTTGG + Intronic
1086399530 11:86449059-86449081 AGCAGAAATCTGGCCCCATATGG + Intronic
1088636401 11:111825150-111825172 AGTAGAAATTTGGACCAATTAGG - Intronic
1091634058 12:2184030-2184052 AGAAAAAGACTGGGCCAATTAGG - Intronic
1094699773 12:32857840-32857862 AGTAGAAATCTAGCCCAACTTGG + Intronic
1097539286 12:60916601-60916623 AACAAAAATCTGGACAAATTAGG - Intergenic
1101805722 12:108062005-108062027 AGCAGAAATCTAGTCCACTTGGG + Intergenic
1102093758 12:110218100-110218122 AGCAAAAATGTGGCGTGATTTGG + Exonic
1107719002 13:43228656-43228678 AGTACAAATCTGGCACTATTTGG - Intronic
1107830350 13:44369795-44369817 ATCATAAATCTGCCCCACTTAGG - Intergenic
1107852988 13:44589898-44589920 AGCAGAAATCTGGAATAATTGGG + Intergenic
1111680016 13:91430745-91430767 AACAAAAATCTAACCCAAATTGG - Intronic
1112376455 13:98846254-98846276 AGCAAAAATCAGGCCAAAGCAGG + Intronic
1114005500 14:18308622-18308644 AGCTAAAATTTTGCCCATTTTGG - Intergenic
1118083883 14:62393721-62393743 ACCAAAAACCTGGCCCACCTGGG - Intergenic
1118671995 14:68138684-68138706 AGCAAAAGATTGGGCCAATTAGG - Intronic
1118921028 14:70150082-70150104 AGCAAAACGCTGGCCCAGATAGG + Intronic
1119574543 14:75707111-75707133 AGCAAAAATCTGGCCCAATTTGG - Intronic
1120972219 14:90217040-90217062 AGCAAAAGTCTGGCCCAGGGAGG + Intergenic
1121190334 14:92022478-92022500 AGCGAAAATCTGACCTATTTAGG + Intronic
1125221354 15:37339623-37339645 AGTTAAAATCTGCCCCGATTGGG - Intergenic
1130871302 15:87974293-87974315 AACACAAATCAGGCTCAATTTGG - Intronic
1132511656 16:345422-345444 AGCAATAATCTGGCCGGATGCGG + Intronic
1134809436 16:17154711-17154733 AGAAACAATCAGGACCAATTTGG + Intronic
1135475657 16:22772279-22772301 ACCAAGAATCTGGCGCAGTTGGG + Intergenic
1135553817 16:23419001-23419023 AGCAAATATCTGGATAAATTTGG + Intronic
1139696269 16:68677445-68677467 ATCAAAAATCAGGCCGAATGCGG + Intronic
1140715368 16:77721599-77721621 AGGAGAAATGTGACCCAATTAGG - Intergenic
1140812127 16:78588450-78588472 AGCAAAAATCTGCCCTGTTTGGG + Intronic
1141043719 16:80695110-80695132 AACAAACATCTGGCCAGATTTGG - Intronic
1146639822 17:34531911-34531933 AGCAAAAGTCTGGGCTATTTGGG - Intergenic
1150502285 17:65662666-65662688 AGAAAAAAGCTGGCCCAATGAGG - Intronic
1150663449 17:67107312-67107334 AGGGAAAACCTGGCCCCATTAGG + Exonic
1152513366 17:80805293-80805315 TGCAAAAATCTGGCCTAAAGAGG - Intronic
1154531932 18:15355262-15355284 AGCTAAAATTTTGCCCATTTTGG + Intergenic
1155803167 18:30134484-30134506 GGCTAAAATCTGGCAGAATTGGG + Intergenic
1157571267 18:48713835-48713857 AGCAAACATCTTGACCATTTGGG + Intronic
1158506291 18:58048741-58048763 GGTAAAAATCTGGCTTAATTGGG + Intronic
1163173613 19:15549672-15549694 AGGAAAAAGTTGGCCCAATGTGG + Intronic
926107048 2:10159081-10159103 AACAAAAATTAGGGCCAATTTGG - Intronic
928451213 2:31380095-31380117 AGCAAATGACTGGCACAATTGGG + Intronic
929217779 2:39434678-39434700 AGCCAAAATTTGAACCAATTAGG - Intronic
931086430 2:58835962-58835984 AGCAAAAATGAGGATCAATTAGG - Intergenic
931559488 2:63543887-63543909 AACAAAAAACTGATCCAATTTGG - Intronic
931762300 2:65429438-65429460 AGCAAAAATCTAACCAAATATGG + Intronic
935438572 2:103064623-103064645 AGCAAAAATCTGTAACAAATTGG + Intergenic
937020021 2:118641648-118641670 AGCAAAAACCTGACTCAAATTGG - Intergenic
941190010 2:162369742-162369764 TGCAAAAATGTGTCCCAATATGG + Intronic
941531519 2:166676585-166676607 AGCAAATATCTGATCCAATCCGG - Intergenic
941891839 2:170590691-170590713 AAGAAAAATCTGGCTGAATTTGG + Intronic
942707841 2:178797025-178797047 AGCAAAATTTTGGGGCAATTTGG + Intronic
944920731 2:204410507-204410529 AGCAAATCTCTGACCAAATTTGG - Intergenic
946147483 2:217741861-217741883 AGCAATAAGGTGGGCCAATTAGG + Intronic
947776816 2:232718930-232718952 AGAAAAAATATGGCAAAATTTGG - Intronic
948960461 2:241331394-241331416 AGAAAAAATATGGGACAATTTGG - Intronic
1168781595 20:496223-496245 AGCAGACATCAGGCCAAATTTGG - Intronic
1174479525 20:50820981-50821003 AGCAAAGATCTGGCCCTCCTGGG + Intronic
1176765432 21:13012927-13012949 AGCTAAAATTTTGCCCATTTTGG - Intergenic
1177904080 21:26953946-26953968 AGCAAAAATTGGGCTCATTTAGG + Intronic
1180430009 22:15239408-15239430 AGCTAAAATTTTGCCCATTTTGG - Intergenic
1181598381 22:23933631-23933653 ACCAAAAATCTGGACAAACTTGG + Intergenic
1182503087 22:30762783-30762805 AGCAAACATCTGGCCCAGGCAGG - Intronic
949411209 3:3766389-3766411 AGAAAAAGTCTGCACCAATTTGG - Intronic
951417622 3:22444401-22444423 CACAGAAATCTGGCCCAAATTGG - Intergenic
951448284 3:22807417-22807439 AGCAAAAATCAGGAAAAATTTGG - Intergenic
952147492 3:30549029-30549051 AGCAAAATTCTGCACCAATAAGG + Intergenic
952844011 3:37671587-37671609 AGCATAAAACTGGCCCAGGTGGG + Intronic
954946398 3:54428628-54428650 AGCAGAAATAAGGCCCATTTGGG - Intronic
956424317 3:69117807-69117829 TACAAACAACTGGCCCAATTTGG + Intronic
956698826 3:71941107-71941129 AGCAAGAATCTTGCCCAGTCTGG - Intergenic
958115367 3:89209435-89209457 ACCAAAAACCTGGCACAAATTGG + Intronic
959572705 3:107901786-107901808 AACAAAAATTTGGACCAACTAGG + Intergenic
964308343 3:155364248-155364270 AGCAAAAATCTTGCCAAAAAAGG - Intergenic
964419348 3:156485333-156485355 AGGCAAAATGTGGCACAATTTGG - Intronic
969604219 4:8194252-8194274 AGCCCAAATCTGGCCCACCTGGG - Intronic
970030372 4:11667221-11667243 AAGAAAAATCTGCCCCATTTTGG + Intergenic
970074072 4:12197352-12197374 AGCAAACCTCTGGCCAAATTAGG + Intergenic
974535666 4:63170968-63170990 AGTAAAAATGTAGCCCAAATAGG - Intergenic
980045049 4:127978725-127978747 AGTAAGAATTTGACCCAATTTGG + Intronic
982729502 4:158940856-158940878 AGCAAAAATCTCTCCAAGTTTGG + Intronic
984501112 4:180560016-180560038 AGCAAAAATATCTCCCATTTAGG + Intergenic
986917439 5:12639356-12639378 AGCAAAGAGTTGGACCAATTAGG + Intergenic
987314598 5:16712383-16712405 AGCAAAAAAGTGGGCCATTTAGG + Intronic
988735144 5:34013112-34013134 AGCCTAAATCTGACCCAAATGGG + Intronic
989120976 5:38004193-38004215 AGCTAAGATCTGGGACAATTAGG + Intergenic
991968010 5:72110263-72110285 TGCAAAAACCTGACCAAATTAGG - Intronic
993922910 5:93829291-93829313 AAGAAAAATAGGGCCCAATTAGG - Intronic
994032903 5:95165860-95165882 TGCAAAATTCTGGACCAATTGGG - Intronic
994751422 5:103742137-103742159 AACGAAAATGTGGGCCAATTTGG + Intergenic
995054094 5:107740238-107740260 AGAAAGAATCTGGAACAATTTGG - Intergenic
997285893 5:132678193-132678215 AGCAAAAATCTGCCACGATAGGG + Intronic
997674692 5:135704014-135704036 AGCAAATATCTGTGTCAATTTGG + Intergenic
1002071072 5:176679341-176679363 AGGATAAATTTGGCCCATTTTGG + Intergenic
1004669628 6:17783514-17783536 AACAAAAATGTCACCCAATTTGG + Intronic
1007452694 6:41952219-41952241 AGCAAAAGTCTGTCTCAATTTGG + Intronic
1012180462 6:96146127-96146149 AGTCAAAATCTGGCCCAGTGTGG - Intronic
1012241918 6:96882949-96882971 AGCTAAAATCTGACACAAGTTGG + Intergenic
1013265609 6:108494488-108494510 AGCAAAAATCTGGCAGATTTAGG + Intronic
1017527505 6:155254565-155254587 AGCAAAATTCTCACCTAATTTGG - Exonic
1018451889 6:163916787-163916809 AGGAACACTCTGGCCCATTTGGG + Intergenic
1021824537 7:24535739-24535761 AGCAAATATCTGGAAAAATTTGG + Intergenic
1023880333 7:44315631-44315653 AGCAAAAATGTAGGTCAATTTGG + Intronic
1024723307 7:52163209-52163231 AGAAAAACTCTGTCCCAATGTGG + Intergenic
1024771302 7:52726372-52726394 AGCAAAAATAAGGCCAAATAAGG + Intergenic
1025784321 7:64630767-64630789 TGTAAACATCTGGCCCAGTTTGG + Intergenic
1026658473 7:72277812-72277834 AGCAAATATGTGGGCCAACTGGG + Intronic
1027352145 7:77323235-77323257 AGCTAGAATCTGGCCTACTTAGG + Intronic
1028742395 7:94290636-94290658 AGCAAACAACTGGCTCACTTAGG + Intergenic
1029929365 7:104354433-104354455 AGCAACAAACTGGCCCAAAGTGG - Intronic
1031490666 7:122383877-122383899 AGAACAAATTTGGCCCAAGTAGG + Intronic
1034550369 7:151816634-151816656 AGCAGAAAGCTGGCGCCATTTGG + Intronic
1035134927 7:156693951-156693973 AGCAATAAATTGGCCCCATTTGG - Intronic
1039092312 8:33845259-33845281 ATCACAAATGTGGCCCAAATAGG + Intergenic
1042176376 8:66040698-66040720 AGCAAAAATCTGGCTCAGTGGGG - Intronic
1044871942 8:96628174-96628196 AGGAAGAATCTGGCCCACTTTGG + Intergenic
1046120013 8:109833985-109834007 AGAACAAATTTGGCCCCATTAGG - Intergenic
1047792370 8:128217332-128217354 AAAGAAAATCTGGCCCATTTGGG + Intergenic
1048641515 8:136368377-136368399 AGAAAAGAAATGGCCCAATTAGG + Intergenic
1049195971 8:141315739-141315761 AGCAAAAATAAGGCCCACCTAGG + Intergenic
1054851021 9:69846819-69846841 AGCAAGAATCTGGGCCACCTAGG + Intronic
1055641580 9:78322909-78322931 AGTATAAATCTGGACAAATTTGG + Intronic
1056128011 9:83555387-83555409 AGCAGCAGTCTGGCCAAATTTGG + Intergenic
1059069750 9:111123037-111123059 AGAAAAAATCCTGCACAATTAGG - Intergenic
1059337875 9:113580562-113580584 AGCTAAAAAGTGGCCCCATTGGG + Intronic
1187449795 X:19386473-19386495 AACAAAAATCTGGCTCTCTTGGG + Intronic
1188704253 X:33306468-33306490 AGCAAATACCAGGCCCATTTAGG - Intronic
1188887386 X:35567506-35567528 AGCAAACTTCAGGCCCAGTTGGG + Intergenic
1191167722 X:57407520-57407542 AGCAAAAATCTGGCAGAGATTGG - Intronic
1192072608 X:67957152-67957174 AGCAAACTTCCAGCCCAATTTGG + Intergenic
1192549072 X:72039575-72039597 AACCACAATCTGGCCCATTTTGG + Intergenic
1193198389 X:78659665-78659687 AGTAAACAAATGGCCCAATTTGG - Intergenic
1195493758 X:105505515-105505537 AGAAAAAATGTGCCTCAATTAGG + Intronic
1197836963 X:130705346-130705368 AGCCAAACTCTGGACTAATTAGG + Intronic
1197987325 X:132279622-132279644 ACCAAAAATCTGGCGAAATCTGG - Intergenic
1199046983 X:143186016-143186038 GGCAGAAATCTGGCCCGAATTGG + Intergenic
1199851985 X:151730350-151730372 AACAAAAATCCAGCCCATTTTGG - Intergenic
1200788556 Y:7279866-7279888 AGGAAAATTCTGGCCAATTTAGG - Intergenic
1200928241 Y:8673780-8673802 TGCAAGAATCTGGCCCCATGGGG - Intergenic
1201745873 Y:17372889-17372911 GGCAAAATTTTGACCCAATTAGG + Intergenic