ID: 1119577563

View in Genome Browser
Species Human (GRCh38)
Location 14:75740613-75740635
Sequence CTTTGAAATTGGCAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 281}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119577563_1119577571 30 Left 1119577563 14:75740613-75740635 CCCTCCACCTGCCAATTTCAAAG 0: 1
1: 0
2: 0
3: 20
4: 281
Right 1119577571 14:75740666-75740688 TCTCTTAGAAGCCATTTTTTTGG 0: 1
1: 0
2: 1
3: 24
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119577563 Original CRISPR CTTTGAAATTGGCAGGTGGA GGG (reversed) Intronic
900577616 1:3391224-3391246 CCTTGAAATGGGCGGGAGGAGGG + Intronic
901313182 1:8285484-8285506 CTTTTAAATTTCCAGGTGAAAGG - Intergenic
901956417 1:12788775-12788797 CCTTGAAATGGGCAGGAAGAGGG + Intergenic
901979796 1:13024830-13024852 CCTTGAAATGGGCAGGAAGAGGG + Intronic
902002287 1:13204108-13204130 CCTTGAAATGGGCAGGAAGAGGG - Intergenic
902021518 1:13349872-13349894 CCTTGAAATGGGCAGGAAGAGGG - Intergenic
902441958 1:16436301-16436323 GCTTGAACCTGGCAGGTGGAGGG + Intronic
902658363 1:17884934-17884956 GTTAGTAATGGGCAGGTGGAAGG + Intergenic
904914409 1:33959660-33959682 CTTTGAGTTTGGCAGGTGTGAGG - Intronic
905771460 1:40640544-40640566 CCTTCAAATAGGCAGCTGGATGG - Intronic
906991494 1:50744186-50744208 CTTGGATAGTGGCAGGTGCATGG - Intronic
907378461 1:54064780-54064802 ATTTGAACCTGGGAGGTGGAGGG - Intronic
907904644 1:58773276-58773298 CTCTGAACTTGCTAGGTGGAGGG - Intergenic
909473833 1:76059831-76059853 CTTTGAAATTTGCTGGTAAATGG + Intergenic
910848352 1:91625952-91625974 CTTTGAAAGTTGCAGGGAGAGGG + Intergenic
911354441 1:96798553-96798575 CTTTTAGAATGGCAGATGGAGGG + Intronic
913374442 1:118135040-118135062 CTTTGTGATTGGCACATGGAAGG + Intronic
914329907 1:146658149-146658171 GTTTGAACCTGGGAGGTGGAAGG - Intergenic
915080811 1:153350441-153350463 CTGTGAAATTCACAGCTGGAGGG - Intergenic
917581261 1:176380313-176380335 GTTTTAAATTGGCAGGTGGTGGG + Intergenic
921252715 1:213312426-213312448 CTGAGAAATTGGCACCTGGAAGG + Intergenic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
922338170 1:224634484-224634506 GCTTGAAACTGGGAGGTGGATGG + Intronic
922375315 1:224958103-224958125 GTTTGAAAATGGCAAGTTGAAGG + Intronic
923664811 1:235990681-235990703 CTATGAATTTGGCAGGGGAATGG + Intronic
924669681 1:246110843-246110865 CTTTTAAATTGGTAGGTGTAAGG - Intronic
924907031 1:248466442-248466464 ATTTAAAAATGGCAGGTGGAGGG - Intergenic
924917080 1:248581696-248581718 GTTTAAAAATCGCAGGTGGAGGG + Intergenic
1063564264 10:7158792-7158814 TTTTGAAATTTGCAGGACGAAGG - Exonic
1063647950 10:7904672-7904694 CATTGCAACTGGCAGGTGGGTGG + Intronic
1063923447 10:10954326-10954348 CCTTGAACCTGGAAGGTGGAGGG - Intergenic
1064111235 10:12540999-12541021 CTGTGTAATTGTCAGGTGGAGGG + Intronic
1064483007 10:15758348-15758370 TTTAGAAATTAGCAGGAGGAAGG - Intergenic
1066038026 10:31513426-31513448 ATTTGATATTGCCAGTTGGAAGG - Intronic
1066093511 10:32050188-32050210 CTTTGAAGTGGGGATGTGGAGGG - Intronic
1066451490 10:35534102-35534124 GTTTGAAACTGGGAGGTGCAGGG - Intronic
1069561001 10:69429309-69429331 CCTTGAACCTGGGAGGTGGAGGG + Intergenic
1069903927 10:71721247-71721269 CTTAGGAGCTGGCAGGTGGAGGG - Intronic
1071703447 10:87968476-87968498 CTTTTGAACTGGCAGGTAGAAGG - Exonic
1072556161 10:96515311-96515333 GTTAGAAACTGGCAGGTGGAAGG + Intergenic
1072564976 10:96609939-96609961 CTGTGAGAGAGGCAGGTGGAGGG - Intronic
1073169903 10:101497455-101497477 CTTTGGAATGCCCAGGTGGAAGG + Intronic
1078580315 11:12534456-12534478 CTTTGATACTGGCATTTGGAAGG + Intergenic
1078706364 11:13747636-13747658 CTTTGAAGTTTAGAGGTGGAAGG - Intergenic
1079312437 11:19378587-19378609 CTTTTGAAATGGCAGATGGAGGG + Intronic
1080590523 11:33719537-33719559 ATTTGAGCTTGGGAGGTGGAGGG + Intronic
1080696439 11:34606733-34606755 CTTAGAAATTTGAGGGTGGAAGG - Intergenic
1081046699 11:38282313-38282335 CTTTCAAATTGGCAGCTGTCAGG + Intergenic
1083230240 11:61312893-61312915 CCTTGAAATTGGAAGGTTGCTGG - Intronic
1085005173 11:73081349-73081371 GCTTGAACTTGGGAGGTGGAGGG + Intronic
1085235063 11:75008327-75008349 CTGTCAAGTTGGCAGGTGGAGGG + Exonic
1086404822 11:86490428-86490450 CTTTGAAGGTAGCATGTGGAAGG - Intronic
1086984334 11:93232133-93232155 CTTTGAGACTTGCAGGTAGAGGG + Intergenic
1087056173 11:93938784-93938806 CATTGAAATTCACAGGTAGAAGG + Intergenic
1088434963 11:109802234-109802256 ATTTGCAATTGGCAAGTGGGAGG - Intergenic
1088913876 11:114212357-114212379 CTTTGAAAATGCCTGGGGGAGGG - Intronic
1091577362 12:1750450-1750472 CTAGGTACTTGGCAGGTGGAGGG + Intronic
1091725758 12:2845504-2845526 CTTGGAAAGGGGGAGGTGGAGGG + Intronic
1092264581 12:6970832-6970854 CTTTCAAAATGGCAGCCGGAAGG + Intergenic
1092949961 12:13492626-13492648 CTTTGGAAATGGCAGGAAGAAGG + Intergenic
1093574621 12:20712552-20712574 GGTTGAAATTGGTAGGTGGCAGG - Intronic
1094293614 12:28879161-28879183 CTTTGAACCTGGGAGGCGGAGGG + Intergenic
1095758193 12:45795199-45795221 CTTTGATACTGGCACATGGAGGG - Intronic
1096749850 12:53751762-53751784 CACTGAAAAAGGCAGGTGGATGG - Intergenic
1097810074 12:64009527-64009549 CTTTCAAATTGTCTGCTGGAAGG + Intronic
1099718346 12:86327987-86328009 CTTTGAAAATGGGAGGTTGGAGG - Intronic
1100036870 12:90262344-90262366 CTTTCAAGTTGCCAGGAGGAAGG - Intergenic
1100602681 12:96125654-96125676 GTTTGAATGTGGCAGGTGGGGGG - Intergenic
1103774313 12:123355101-123355123 GCTTGAACTTGGGAGGTGGAGGG - Intronic
1105282697 13:18977783-18977805 CTGTAAAGTTGGCAGGTAGAAGG + Intergenic
1107354635 13:39553854-39553876 CAGGGAAATTGGCAGGTGGCTGG - Intronic
1108813581 13:54262664-54262686 TTTTGGAAATGCCAGGTGGAGGG + Intergenic
1109526879 13:63586987-63587009 TTTTTAAATAGGCAGGAGGAAGG - Intergenic
1110633836 13:77741762-77741784 CTTTAAAATGGGCAGTGGGATGG - Intronic
1110755673 13:79171366-79171388 CTTTGGATTTGGCTGATGGATGG - Intergenic
1111892881 13:94105572-94105594 CTTTGAAATGGACAGGCTGAAGG + Intronic
1116182400 14:41551649-41551671 CTTTAAAATTAGCAGGGAGATGG + Intergenic
1116235177 14:42271151-42271173 GTTTGAACCTGGTAGGTGGAGGG - Intergenic
1117093306 14:52271649-52271671 CTTTTAAGGTGGCAGGTTGAGGG - Intronic
1117779133 14:59214318-59214340 CTTCCAAGTTGGCAGGTGCAAGG + Intronic
1117943927 14:60998133-60998155 CTTTGATATGGGCAGGAGGCAGG + Intronic
1118641083 14:67793172-67793194 GTTTGAACCTGGGAGGTGGAGGG + Intronic
1119277533 14:73372148-73372170 ACTTGAACTTGGGAGGTGGAGGG + Intronic
1119577563 14:75740613-75740635 CTTTGAAATTGGCAGGTGGAGGG - Intronic
1123682552 15:22773147-22773169 CTGTGAAAGTGCCAGGTTGAAGG + Intronic
1123762532 15:23443933-23443955 CTGTGAAAGTGCCAGGTTGAAGG + Exonic
1123929916 15:25161766-25161788 CTGTGTTATTGGCAGATGGAAGG + Intergenic
1124334302 15:28845671-28845693 CTGTGAAAGTGCCAGGTTGAAGG + Intergenic
1125260890 15:37823615-37823637 ATTTGAATTTGGCTGGTGGCGGG - Intergenic
1126614805 15:50566611-50566633 GTTTGAACCTGGGAGGTGGAGGG + Intronic
1127092175 15:55478272-55478294 TTTTCAAATTGGCAGGTTAAAGG - Intronic
1128220312 15:65964227-65964249 CTTTGGAAGTGGGGGGTGGAGGG + Intronic
1131310502 15:91286188-91286210 CTGTGACATTGGCAAGTGCATGG + Intronic
1131784741 15:95899991-95900013 ATTAGAAATTGGCTGCTGGAGGG + Intergenic
1131859481 15:96637234-96637256 CTATGATAATGGCAGGTGGGTGG + Intergenic
1133649663 16:7799783-7799805 CTTTGAGATTGGCAAGTACAGGG - Intergenic
1133709663 16:8389172-8389194 TTTTGAAATTGGTAGGTGATGGG + Intergenic
1133760771 16:8796873-8796895 ATTTGGAATTGCCTGGTGGAAGG - Intronic
1134136387 16:11679239-11679261 CGCTGACATTGGCAGGTGGAGGG + Exonic
1134731588 16:16466646-16466668 CATTTAAATTGGCAGATTGAGGG + Intergenic
1134819269 16:17233051-17233073 CTTTGTATGTGGCAGGTGAAGGG - Intronic
1137757437 16:50913864-50913886 CTTTAAAATGAGAAGGTGGAGGG + Intergenic
1138537412 16:57667322-57667344 CTTGGCAATTGGAAGGTGAAGGG - Intergenic
1138870312 16:60875990-60876012 GCTTGAACTTGGGAGGTGGAGGG - Intergenic
1139231941 16:65291868-65291890 CTCAGAAATTGGTAGCTGGAAGG - Intergenic
1139426920 16:66886820-66886842 TTTTGCAGTTGGCAGGTGCAGGG - Exonic
1140003648 16:71052765-71052787 GTTTGAACCTGGGAGGTGGAAGG + Intronic
1140050572 16:71477670-71477692 CTTTAGAATAGGCAAGTGGATGG - Intronic
1140219548 16:73033636-73033658 CTGTGAAAGTGTGAGGTGGAAGG - Intronic
1140309771 16:73837930-73837952 CTTTGAAAATAGCAGGAGGCTGG - Intergenic
1140658989 16:77169310-77169332 ATTTGACATAGGCAGGAGGAAGG - Intergenic
1142018839 16:87767184-87767206 ATTTTAAATGGGAAGGTGGAAGG - Intergenic
1142262620 16:89049989-89050011 CTGTGAAATTCGGAGGTGGAGGG + Intergenic
1142475119 17:184112-184134 CTTTGAAGAAGTCAGGTGGAGGG + Intergenic
1143212548 17:5199392-5199414 GCTTGAACCTGGCAGGTGGAAGG - Intergenic
1144838265 17:18169361-18169383 ACTTGAAACTGGCAGGTGGAGGG + Intronic
1145004531 17:19329951-19329973 AGTGGAAATTGGCAGGAGGAGGG - Intronic
1146254095 17:31379042-31379064 CTTTTAAATTGGCAGCTAAAAGG - Intronic
1146427531 17:32756300-32756322 CTTTTGAACTGGCAGGTAGAAGG - Intronic
1146603918 17:34241858-34241880 CTTTGAGACTGGCATGTGAATGG + Intergenic
1147662383 17:42123607-42123629 GTTTGAACCTGGGAGGTGGAGGG + Intronic
1148622467 17:49044725-49044747 CTGGGAGATTGGTAGGTGGAGGG + Intronic
1150189147 17:63219491-63219513 GTTTGAACCTGGGAGGTGGAGGG - Intronic
1150992214 17:70272486-70272508 CTAATAAATTGGCAGATGGAAGG + Intergenic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1155852817 18:30793748-30793770 CTGTGAAAGAGGCATGTGGATGG - Intergenic
1157326092 18:46669668-46669690 CTTGGAGATGGGAAGGTGGAAGG + Intronic
1157526937 18:48390746-48390768 TTTTGAGATAGGCATGTGGATGG - Intronic
1157556602 18:48616829-48616851 CTCTAGATTTGGCAGGTGGAGGG + Intronic
1157773422 18:50371169-50371191 CTGTGAACTTGGAAAGTGGATGG - Intergenic
1158439864 18:57466140-57466162 GTTCTTAATTGGCAGGTGGAAGG + Intronic
1159927794 18:74284146-74284168 GCTTGAACTTGGGAGGTGGAAGG + Intronic
1160164466 18:76497345-76497367 CCTAGAAAATGGCAGCTGGAGGG + Exonic
1160725038 19:614092-614114 CTTGGACAGTGGCAGGGGGAAGG + Intronic
1161255887 19:3309286-3309308 GTTTGAACCTGGGAGGTGGAGGG + Intergenic
1161936517 19:7375785-7375807 CTTTGAACCTGCCAGGAGGAGGG + Exonic
1163389818 19:17023662-17023684 CCTTGAACCTGGGAGGTGGAGGG - Intronic
1164564269 19:29314791-29314813 CTTGGTCATTGGCAGGAGGAGGG - Intergenic
1165470675 19:36002640-36002662 TTTTGAACCTGGGAGGTGGAGGG - Intergenic
1165734645 19:38168302-38168324 CCTTGAACCTGGGAGGTGGAGGG + Intronic
1166700821 19:44880568-44880590 GCTTGAACTTGGGAGGTGGAGGG - Intronic
1168564014 19:57407658-57407680 CTTTGAAAGGTGGAGGTGGAAGG - Intronic
925238711 2:2302451-2302473 CTTTGAAATGGTGAGGAGGAGGG + Intronic
925816655 2:7758349-7758371 TTTGAAAATTGGCAAGTGGAAGG - Intergenic
926529640 2:14027969-14027991 GTTGAAAATTGGCAGGTGGGTGG - Intergenic
927407804 2:22791904-22791926 GTTTGAAATGGGCCAGTGGAAGG - Intergenic
929535184 2:42778410-42778432 GTTTGAACCTGGGAGGTGGAGGG - Intronic
930059372 2:47275569-47275591 AGTGGAACTTGGCAGGTGGAAGG - Intergenic
931745241 2:65286211-65286233 CTTTGGAAATGGCAGGAGCAGGG + Intergenic
931903462 2:66817921-66817943 CTTTGAGATGGACAGGTGAAAGG + Intergenic
932202405 2:69842910-69842932 ATTTGAAAATGGAAGGTGGGGGG - Intronic
935366160 2:102293103-102293125 CAGTGCAGTTGGCAGGTGGAGGG + Intergenic
937550825 2:123088158-123088180 GGTTGAAAATGGCAGCTGGAAGG - Intergenic
938044619 2:128106791-128106813 CTTTGGAAGGGGCAGGTGGGTGG - Intronic
938070653 2:128306602-128306624 CTTTCTAATTCTCAGGTGGATGG + Intronic
939049609 2:137292347-137292369 ATTTACAATTGGCTGGTGGATGG + Intronic
939530542 2:143354918-143354940 CTTTGAAATTGTGAAATGGAAGG - Intronic
939704199 2:145431721-145431743 CATTGAAATTGGAAGGTAAACGG + Intergenic
943056767 2:182991474-182991496 GCTTGAACTTGGGAGGTGGAGGG + Intronic
944794110 2:203164942-203164964 GCTTGAATCTGGCAGGTGGAGGG - Intronic
945158705 2:206865973-206865995 GTTTGAACTTGGCAGGGGCAAGG - Intergenic
945452405 2:210008776-210008798 GTTTGAATCTGGGAGGTGGAGGG - Intronic
946341389 2:219071512-219071534 TTTTCATATTGGCAGCTGGAAGG - Intergenic
947847193 2:233254150-233254172 CTTTGAAAATGGCATCTTGATGG + Intronic
949057205 2:241934618-241934640 CTGTGAAGTTGGCGGGGGGATGG + Intergenic
1169436911 20:5600905-5600927 GCTTGAACCTGGCAGGTGGAGGG + Intronic
1170134182 20:13055010-13055032 CTAGGAAAGAGGCAGGTGGAAGG + Intronic
1170251132 20:14284059-14284081 CTTTAAAATTGCCATGTGAAAGG + Intronic
1170644734 20:18187724-18187746 CTTACAAACTGTCAGGTGGAGGG - Exonic
1170760731 20:19248662-19248684 CTTTGAAATTGGTATGTTGAAGG + Intronic
1171219880 20:23385627-23385649 GTTTGAACCTGGGAGGTGGAGGG + Intronic
1171258266 20:23708523-23708545 CTCTGACATGAGCAGGTGGATGG - Intergenic
1171275489 20:23853566-23853588 CTCTGACATGAGCAGGTGGATGG - Intergenic
1172477370 20:35248956-35248978 CTCAGAGAGTGGCAGGTGGATGG + Intronic
1172964426 20:38824158-38824180 CAAAGAACTTGGCAGGTGGAAGG + Intronic
1173866102 20:46313551-46313573 CTTGGAACTTGGCAGGTGCTGGG - Intergenic
1173879944 20:46405013-46405035 GTTTGAATTTGGCAAGAGGAAGG - Intronic
1174151732 20:48490583-48490605 CCTTGAACATGGCGGGTGGAGGG - Intergenic
1175608208 20:60328687-60328709 CTGTGAATTAGGGAGGTGGAGGG - Intergenic
1175735633 20:61385201-61385223 CTCTGGAAGTGGCAGGAGGAGGG + Intronic
1178155396 21:29847509-29847531 CCTTGAACCTGGGAGGTGGAGGG + Intronic
1179887525 21:44320644-44320666 GCTTGAACTTGGGAGGTGGAGGG + Intronic
1181959200 22:26610785-26610807 CTTTGAAATGGGGAGAAGGATGG - Intronic
1182627613 22:31659560-31659582 ATCTGAAATTGGCAGTAGGATGG + Intronic
1182653690 22:31872835-31872857 GCTTGAAACTGGGAGGTGGAGGG - Intronic
1183707260 22:39481683-39481705 GGTTGAACTTGGCAGCTGGAAGG + Intronic
1185257194 22:49841342-49841364 GTTTGAACCTGGGAGGTGGAGGG - Intergenic
949570219 3:5285378-5285400 CTGTGATATTGGCAACTGGATGG + Intergenic
949709019 3:6853364-6853386 CTTTGAACTTGGCAGTTTCAGGG + Intronic
954732950 3:52680742-52680764 GCTTGAAACTGGGAGGTGGAGGG - Intronic
956580207 3:70803067-70803089 TTTTGAAATTGGCAATTAGAAGG + Intergenic
957496520 3:80998435-80998457 CTTTTAAATTGGGGTGTGGAGGG + Intergenic
958005098 3:87800391-87800413 CTAAGAATTTGCCAGGTGGAAGG - Intergenic
958873332 3:99587715-99587737 CTTTGAAACTGTCAGATTGAAGG - Intergenic
959299757 3:104583095-104583117 CATTCAAAATGGCAGATGGAAGG + Intergenic
960535657 3:118812137-118812159 CTTTGCAAAGGGTAGGTGGATGG + Intergenic
960748519 3:120918106-120918128 CTTTGAAAATGGAAGGGGGCTGG - Intronic
961262168 3:125610953-125610975 ACTTGAACTTGGGAGGTGGAGGG - Intergenic
962511093 3:136101505-136101527 GTTTGAACCTGGGAGGTGGAGGG - Intronic
964998982 3:162927403-162927425 GTTTGAACTCGGGAGGTGGAGGG + Intergenic
966625554 3:182012469-182012491 CTGTGAAATGGGCAGATGGTGGG - Intergenic
967099047 3:186200917-186200939 CTTTGAGAGGGGCAGCTGGAAGG + Intronic
967587427 3:191232681-191232703 ACTTGAAACTGGGAGGTGGAGGG - Intronic
968707196 4:2085140-2085162 CTTCCAAATAGGTAGGTGGAAGG + Intronic
972859200 4:43146563-43146585 CTTGGCAATTGGCAGGTGAGTGG + Intergenic
973869055 4:55146282-55146304 CTTTGAAATGGGCAAGTTGGAGG + Intergenic
975834059 4:78402458-78402480 CCTTGAAAATGGCAGGTATAAGG + Intronic
975836648 4:78429358-78429380 CATAGAAATGGGCAGGAGGAAGG - Intronic
976171076 4:82304948-82304970 CTTAAAAATTGTCAGTTGGAAGG + Intergenic
976655358 4:87482880-87482902 AGTTGAAATTTGTAGGTGGAGGG + Intronic
977441978 4:97079413-97079435 CTTTGAAAATGGAAGAAGGAGGG - Intergenic
978430526 4:108628162-108628184 CTTTGGGATTGGCAGGTGTTTGG - Intronic
980164893 4:129213865-129213887 CTGTGAAATTGGCAGCATGATGG + Intergenic
980785554 4:137549781-137549803 CTTTGAAAGGCCCAGGTGGAAGG + Intergenic
981107859 4:140901856-140901878 CATAGGATTTGGCAGGTGGAGGG + Intronic
982711623 4:158763680-158763702 CTGTAAGATTGTCAGGTGGATGG + Intergenic
984663277 4:182397316-182397338 ACTTGAAACTGGGAGGTGGAGGG + Intronic
986393162 5:7303683-7303705 CTGTGAAAGTGCCAGGTTGAAGG + Intergenic
986551826 5:8965018-8965040 ACTTGAAAGTGGAAGGTGGAAGG + Intergenic
986607821 5:9539907-9539929 TTTGTAAACTGGCAGGTGGAGGG - Intronic
986837551 5:11656574-11656596 TTTTGAAATTGGTGGGTGGTGGG - Intronic
989423848 5:41273021-41273043 GCTTGAACTTGGGAGGTGGAAGG - Intergenic
990468960 5:56095734-56095756 CTGTGAGATTGGAAGGTGGGAGG - Intergenic
994632022 5:102297644-102297666 ATTTGAACTCGGAAGGTGGAGGG + Intergenic
995013570 5:107285475-107285497 CTTTGAAACTGGCAGGAGATAGG - Intergenic
997320601 5:132975012-132975034 GCTTGAACTTGGAAGGTGGAGGG + Intergenic
997424195 5:133792091-133792113 CTGTGAACCTGGCAGGAGGAAGG - Intergenic
997824239 5:137092074-137092096 CTTGGGTATTGGAAGGTGGATGG - Intronic
998749544 5:145304014-145304036 CTTGGAAATATGCAGGTGAAGGG + Intergenic
1000858715 5:166431046-166431068 TTTTGAAATTTGCAGGTTGGAGG - Intergenic
1001423600 5:171607354-171607376 CTTTAAAATTTCCAGGTAGAAGG + Intergenic
1001649761 5:173307522-173307544 GCTTGAACTTGGGAGGTGGAGGG + Intergenic
1003257467 6:4487130-4487152 CTGTGATTTTGGCAGGTTGAAGG - Intergenic
1004741423 6:18464912-18464934 CTTTGAAATTTCCAGGTGGTGGG + Exonic
1005438496 6:25839831-25839853 CTTTGAAGTTGGCTGTTTGATGG - Intronic
1005477961 6:26226723-26226745 CTTCGAAACTGGTAGGTGAAGGG + Intergenic
1006715639 6:36118196-36118218 ATTTTAAAGTGGCAGATGGATGG - Intergenic
1006732425 6:36246285-36246307 ATTTGAACCTGGGAGGTGGAGGG - Intronic
1009510109 6:64540309-64540331 CTTTGAGATTGGCAGTGTGAAGG - Intronic
1011266028 6:85520123-85520145 GCTTGAAACTGGCAAGTGGAGGG - Intronic
1011558129 6:88589791-88589813 CTTCGGCATTGGCAGGGGGATGG - Intergenic
1012587076 6:100936532-100936554 GACTGAAATTGGGAGGTGGAAGG + Intergenic
1013866661 6:114706428-114706450 CTTTGAAAATGGCTGCTGGAAGG + Intergenic
1014259248 6:119197224-119197246 GCTTGAACCTGGCAGGTGGAGGG + Intronic
1014547922 6:122754375-122754397 CATTGAAATAGGGAGGAGGAAGG - Intergenic
1017213433 6:151881798-151881820 ACTTGAACCTGGCAGGTGGAGGG + Intronic
1017985866 6:159442740-159442762 CTTTGACAGTGTCAGGTGGTAGG + Intergenic
1018434728 6:163749895-163749917 CTTTGAAATTCAGAGATGGATGG + Intergenic
1018618691 6:165710383-165710405 CTTTGCACTTGGCCAGTGGAGGG - Intronic
1022554293 7:31276321-31276343 CGTTGAAATTTGCGGGTGGGTGG - Intergenic
1023120393 7:36903082-36903104 CTGTGAGATGGGCAGGTAGACGG - Intronic
1023477994 7:40601881-40601903 CTTTGAATTTGGCAATTTGAAGG - Intronic
1024134769 7:46395236-46395258 CTCTGAAACTGGCACGTGTAGGG + Intergenic
1025199597 7:56953928-56953950 ATTTGGAATTGGCAGGTAGATGG + Intergenic
1025672349 7:63623005-63623027 ATTTGGAATTGGCAGGTAGATGG - Intergenic
1026864075 7:73811789-73811811 CTGTGCTAGTGGCAGGTGGAGGG - Intronic
1027660277 7:80980630-80980652 GTTTGAATTTGGCAGGTGGCTGG - Intergenic
1028807867 7:95049690-95049712 ATTAGCAATTGGCAGGAGGAAGG - Intronic
1029954703 7:104625692-104625714 GTTTGCAATTTGGAGGTGGAGGG - Intronic
1032197409 7:129797412-129797434 CTCTGAGATTGGGAGGTAGAGGG - Intergenic
1032312980 7:130805647-130805669 GGTTGAGTTTGGCAGGTGGAAGG + Intergenic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033679383 7:143579011-143579033 CACTGACGTTGGCAGGTGGAGGG - Intergenic
1033692454 7:143750433-143750455 CACTGACGTTGGCAGGTGGAGGG + Intergenic
1034043116 7:147900040-147900062 CTTTTAATTTGACAGCTGGAAGG - Intronic
1034576611 7:152005343-152005365 CTTAGAAAAGGGCAGGTGGCTGG - Intronic
1034840396 7:154390421-154390443 CTTTGAGATTGGAAGGTGCTGGG + Intronic
1035088719 7:156286122-156286144 ATATGAATTTGGCAGGGGGAAGG - Intergenic
1036672302 8:10799552-10799574 CTTTGAAATGGACAGGTGAGCGG + Intronic
1037247336 8:16850177-16850199 GCTTGAAATGGGGAGGTGGAGGG + Intergenic
1037362780 8:18091607-18091629 CTTTGAACCTGGGAGGTGGAGGG - Intergenic
1037362859 8:18092302-18092324 GTTTGAACCTGGGAGGTGGAGGG - Intergenic
1037884939 8:22590915-22590937 CCTGGAGATTGGCAGGTGGCTGG + Intronic
1038226472 8:25662837-25662859 CTCAGAAATTGACATGTGGAAGG + Intergenic
1038481048 8:27902061-27902083 CAGTGAAATTGGGAGGTGAAGGG - Intronic
1038942537 8:32321191-32321213 TTTTGAAATTGACTAGTGGATGG - Intronic
1039045531 8:33445949-33445971 CTCTGAACCTGGCAGGTGGTTGG - Intronic
1039593933 8:38774223-38774245 CTCTGAGAATGGCTGGTGGACGG - Intronic
1039681856 8:39747912-39747934 CTTTGAAATTGGATAGTGCATGG - Intronic
1044865240 8:96564342-96564364 CTTTCAACTTTGCAGGGGGATGG + Intronic
1045106757 8:98900157-98900179 ACTTGAACTTGGGAGGTGGAGGG - Intronic
1047860886 8:128965237-128965259 GTTTGAAATTGGCATGGAGAGGG + Intergenic
1048489352 8:134878275-134878297 ACTTGAACTTGGGAGGTGGAGGG - Intergenic
1049377753 8:142297054-142297076 CTGTGAAGTGGGCAGGTGGAAGG - Intronic
1056272545 9:84960508-84960530 TTTTGAGATAGGTAGGTGGATGG + Intronic
1058022280 9:100102178-100102200 GCTTGAATTTGGGAGGTGGATGG - Intronic
1058705780 9:107637225-107637247 CTTTGCAATGTGCAGTTGGAAGG + Intergenic
1059959395 9:119550463-119550485 CTTAGAATTTGAGAGGTGGAAGG + Intergenic
1060136427 9:121159547-121159569 GCTTGAAATTGGGAGGTGGTTGG + Intronic
1060462304 9:123868541-123868563 CTCTGAGATTGGCATGTGGAGGG + Intronic
1186684587 X:11912124-11912146 AATTGAAGTTGGCAGCTGGAAGG + Intergenic
1187945062 X:24417763-24417785 CTTGCAAGTTGGCAGGTGGTTGG - Intergenic
1188868283 X:35341831-35341853 CTTTGATATTGAAAGGTGAAGGG + Intergenic
1190495268 X:51022493-51022515 CATTGAAAGTGGCAAGGGGAAGG + Intergenic
1192781895 X:74302944-74302966 CTTTGAAATTGGGAGGAGTAAGG - Intergenic
1194341554 X:92712220-92712242 GCTTGCAATTGGCATGTGGAGGG + Intergenic
1198654491 X:138898805-138898827 CTGTGCAATTGGCAGTTTGAGGG + Intronic
1198881105 X:141282297-141282319 GCTTGAACTTGGGAGGTGGAGGG - Intergenic
1199458309 X:148054227-148054249 CTGTGAAATAGGAAGGTGCATGG + Intergenic
1199726278 X:150585636-150585658 TTTTGGAATTGGCAGATGCACGG + Intronic
1199915520 X:152336006-152336028 CTTTGAAATTGGCAGGATGCTGG - Intronic
1201370236 Y:13255043-13255065 GTTTGAACTGGGCACGTGGATGG - Intronic