ID: 1119579517

View in Genome Browser
Species Human (GRCh38)
Location 14:75764609-75764631
Sequence CTCCATCAGCAGTCATTCTA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119579517_1119579520 13 Left 1119579517 14:75764609-75764631 CCCTAGAATGACTGCTGATGGAG 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1119579520 14:75764645-75764667 GATAGAGAGTCTGAATTCAAAGG 0: 1
1: 0
2: 2
3: 12
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119579517 Original CRISPR CTCCATCAGCAGTCATTCTA GGG (reversed) Exonic
905980449 1:42221122-42221144 CTGCCTCAGCATTCAATCTATGG + Intronic
909371596 1:74889012-74889034 ATACATCAGCAGTCATTGAAGGG - Intergenic
911684992 1:100765402-100765424 TTCCTTCAGTAGTAATTCTAAGG + Intergenic
912035930 1:105313528-105313550 CTCCAGAAGCAATCATTATAAGG + Intergenic
912481935 1:109989059-109989081 CTACAACAGCAGCCACTCTAAGG - Intronic
913502808 1:119487620-119487642 GGCCATCAGAAGTCATTTTAGGG + Intergenic
1063608901 10:7546560-7546582 ATTCATCAGCAATCACTCTAAGG - Intergenic
1065246803 10:23767193-23767215 CACCATCAGCTGTAATTCTCAGG - Intronic
1068267799 10:54676649-54676671 CAACTTCAGCAGTAATTCTAAGG - Intronic
1068874625 10:61983086-61983108 TTCCAACAGCAGTTATTTTAAGG - Intronic
1074067245 10:110027694-110027716 CTCCACTAGCAGTTTTTCTAGGG + Intronic
1075149997 10:119919375-119919397 GTAGATCAGCAGTCATTATATGG + Intronic
1075448094 10:122527841-122527863 CTGCAACAGCAGTCATCCTGGGG - Intergenic
1077977925 11:7268694-7268716 CTCTATCTCCAGTCATTCTCTGG + Intronic
1083389202 11:62335709-62335731 TTCCATCAACAATCATTTTATGG - Intergenic
1086105628 11:83144126-83144148 CTCCTTCACCAGTGATTCTGGGG - Intergenic
1088283114 11:108156801-108156823 ATCCATCAGCATTCATGCAAAGG - Intergenic
1089600035 11:119608113-119608135 CTACATCTGCAGACACTCTATGG - Intergenic
1090679102 11:129034203-129034225 CTCCATCAGCAGATATCCTAGGG + Intronic
1091315641 11:134612016-134612038 CTCCATCATCAGCCATGCCAGGG - Intergenic
1091390065 12:120768-120790 GTGCATCAACAGTCATTCCATGG - Intronic
1091513847 12:1157898-1157920 CTCAATCAGCAGATACTCTAAGG + Intronic
1091631702 12:2166275-2166297 TACCATCAGTAGTCATTCTTTGG + Intronic
1098337384 12:69417905-69417927 CCCCATCAGCAGTTTTTTTAAGG - Intergenic
1102367569 12:112352309-112352331 CTCCATCCACAGATATTCTAAGG - Intronic
1104078220 12:125409201-125409223 CTGGCTCAGCAGGCATTCTAGGG - Intronic
1105827524 13:24135770-24135792 CTCACCCAGCAGTAATTCTAAGG - Intronic
1106037290 13:26055105-26055127 ATCCATCAGCAGTCTGTTTAGGG + Intergenic
1107769332 13:43773221-43773243 CTCCTTAAGCAGTCATTGAAGGG - Intronic
1113617865 13:111693877-111693899 CTCCGTCAGCAGTCAGCCTGGGG + Intergenic
1113623398 13:111779138-111779160 CTCCGTCAGCAGTCAGCCTGGGG + Intergenic
1114435433 14:22702622-22702644 GTCCTTCAGCAGCCATTCTGTGG + Intergenic
1117122195 14:52580031-52580053 CTTTATAAGCAGTCTTTCTAAGG + Intronic
1119579517 14:75764609-75764631 CTCCATCAGCAGTCATTCTAGGG - Exonic
1119735356 14:76978000-76978022 CTCCATCAGCAGCCATGTAAGGG + Intergenic
1126578583 15:50221354-50221376 CCCCTTGAGCAGTCATTCTGAGG - Intronic
1128411828 15:67407054-67407076 GTCCATCAGCCATCATTATATGG + Intronic
1130431822 15:83856119-83856141 CTACAGCATCAGTCATTTTAAGG - Intronic
1135739236 16:24959285-24959307 CTCCAAGAGCATCCATTCTAGGG - Intronic
1136093169 16:27935224-27935246 CTCTCTCAGCAGCCATTCCAGGG - Intronic
1150528327 17:65949052-65949074 ATCAATCAGCAGTCATTATTTGG - Intronic
1151394619 17:73814278-73814300 CTGCATCTTCAGTCACTCTAGGG + Intergenic
1157107345 18:44786880-44786902 CTCCATCAGCTGTCGTGCTGAGG + Intronic
1158884004 18:61807979-61808001 TTTCATCATCAGTTATTCTAAGG - Intergenic
1166395316 19:42435438-42435460 CTCCATATACAGTCATTCTGAGG - Intronic
925586257 2:5467535-5467557 CTCCATCATCACACATTGTAAGG - Intergenic
926460439 2:13123290-13123312 TTCCATCACCAGTGATTCTTTGG - Intergenic
928639369 2:33281684-33281706 CTCCATCAGCAGAGACTCTTGGG - Intronic
928905120 2:36359584-36359606 TTCCTTCAGCATTCTTTCTATGG - Intronic
929618208 2:43328817-43328839 CTCCAGCAGCAGCAATCCTAAGG - Intronic
931053131 2:58436751-58436773 CCCCACCTGCAGACATTCTAAGG + Intergenic
936327620 2:111519303-111519325 CTCCACCAGCAGTTTCTCTAGGG + Intergenic
938872868 2:135499313-135499335 CTTTATCCGCATTCATTCTATGG - Intronic
940786558 2:157987884-157987906 CCTCCTCAGCAGTCATCCTATGG + Intronic
941255503 2:163226038-163226060 CTCCATATGCAGTTATTTTATGG - Intergenic
941504351 2:166322961-166322983 AGCAATCAACAGTCATTCTAGGG - Intronic
944567648 2:201006838-201006860 TTCCATTAGTATTCATTCTAAGG - Intronic
945700379 2:213161897-213161919 CTCAATTAGGAGTCATTGTACGG - Intergenic
1170662071 20:18351795-18351817 CTCCATCAGCTGGCATTCAATGG - Intergenic
1173857146 20:46257791-46257813 CTCCATCAACAGTCACTCCCTGG - Intronic
1179557438 21:42189035-42189057 CTCCATAAGCAGTTATTGAAGGG - Intergenic
1180122990 21:45766310-45766332 CTCCAAAAGCAGTCATACTAGGG - Intronic
950499680 3:13355709-13355731 CACCATCAGCAGGCATGCAAAGG + Intronic
951402525 3:22251331-22251353 CTCCACCATCAGTATTTCTATGG + Intronic
953655689 3:44851832-44851854 CGACTTCATCAGTCATTCTAAGG - Exonic
954330186 3:49885679-49885701 CCCCCTCAGCAGTCAGTGTAGGG + Intergenic
958027756 3:88069119-88069141 CCCCATCAGAAGTGATTCTCAGG + Intronic
959687152 3:109159870-109159892 TTCTACCAGCAGTCACTCTAGGG - Intergenic
961218941 3:125184615-125184637 CTCCCTCAGCCCTCATTCCAGGG - Intronic
961945131 3:130678817-130678839 CTCCAGCAGCATTTGTTCTAAGG - Intergenic
962940210 3:140118637-140118659 CCCCAACAGAACTCATTCTAAGG - Intronic
963584769 3:147172434-147172456 CTCCTTCATAAGTCATTCTCAGG + Intergenic
965567312 3:170133992-170134014 GTCCCTGAGCAGTCATCCTAAGG + Intronic
966688293 3:182719990-182720012 GGCCACCAGAAGTCATTCTAGGG + Intergenic
969133723 4:5012667-5012689 CTCCATCTGCATTCCTTCAAAGG - Intergenic
970510621 4:16778092-16778114 CTCCATCAGTAGTCCTTATTGGG + Intronic
970581183 4:17475546-17475568 CCCATTCAGCAGTTATTCTATGG + Intronic
972937275 4:44152544-44152566 TTCCATGAGTAGTCATTCAAAGG + Intergenic
972937279 4:44152632-44152654 TTCCATGAGTAGTCATTCAAAGG + Intergenic
974675198 4:65079573-65079595 CTCCCTCAGCGGCCAATCTAAGG - Intergenic
974996787 4:69170689-69170711 CTCCCTCTGCTGTCATTCTGTGG + Intronic
975008278 4:69318090-69318112 CTCCCTCTGCTGTCATTCTGTGG - Intronic
981187887 4:141826356-141826378 ATCAAACAGCAGTTATTCTATGG - Intergenic
983915331 4:173285930-173285952 GGCCACCAGAAGTCATTCTAGGG + Intronic
984039318 4:174710220-174710242 CTCAATAAGCAGTACTTCTAAGG + Intronic
984472211 4:180190657-180190679 CTCCATCAGGAGTCTTTCTGTGG - Intergenic
986309743 5:6543299-6543321 CTCCATCAGCAGGCCTACTGAGG - Intergenic
986661017 5:10060313-10060335 CTCCATCAACAAGCGTTCTATGG + Intergenic
986693633 5:10333532-10333554 CTCCATCTCCAGTCGTTCTGGGG - Intergenic
987932767 5:24423939-24423961 CTCCATAATCTGTCATTCTTGGG - Intergenic
988908492 5:35815263-35815285 CTCCATCTGCAGTCAAGCTCTGG + Intergenic
990827582 5:59919345-59919367 CTCCAACTACAGTCATTCTTAGG + Intronic
992957309 5:81923026-81923048 CTCCATGAGCATTCATCCTGTGG - Intergenic
994285921 5:97967137-97967159 CTTCATCAACATTCATCCTAGGG - Intergenic
995279116 5:110312944-110312966 CTCAATCAGGATTCATCCTAGGG + Intronic
996354608 5:122581797-122581819 CTACCACAGCAGTCATTCTGAGG - Intergenic
996771583 5:127092270-127092292 CTCCAACTACAGTCATTCTGAGG - Intergenic
999878072 5:155830437-155830459 CTCCAAATGCAGTCATTTTATGG + Intergenic
1005677251 6:28167504-28167526 CTCCATCAGCATTGTTTCTAAGG + Intergenic
1008900444 6:56608600-56608622 CTTCTTCAACAGTCATTCTTTGG + Intronic
1008932719 6:56956032-56956054 CTGCTGCAGCAGTCATTCTGCGG + Intronic
1012530895 6:100235014-100235036 CTCCATCATCAGTCACTTCATGG + Intergenic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1016751550 6:147635782-147635804 CTCCATACGTATTCATTCTAAGG - Intronic
1017237210 6:152129236-152129258 CGCCAACAGCAGTCACTCTTTGG - Intronic
1017604357 6:156117782-156117804 ATCCATCAGCAGTGTTCCTATGG + Intergenic
1018965801 6:168488045-168488067 ATACATCTGCAGTCGTTCTAGGG + Intronic
1019216832 6:170449161-170449183 ATCCACCAGCACTCATTCTCAGG - Intergenic
1020200065 7:6072686-6072708 CTCCACCAGGAGACATGCTATGG - Intergenic
1022923859 7:35041013-35041035 CTCATTCAGCTGTCACTCTATGG - Intergenic
1030051131 7:105538580-105538602 CCCCACCAGCAGTCCTTCCATGG + Intronic
1030210142 7:106987873-106987895 CTTCCTCAGCTGTCATTCTCTGG + Intergenic
1031561746 7:123247402-123247424 CTCCATCAGCAGCCTTTCTCTGG + Intergenic
1032568413 7:132972694-132972716 CTCAATCAGCTGTCATCCTATGG + Intronic
1034918394 7:155059587-155059609 CTCTATCTGCAGTCTTTCAAGGG - Intergenic
1035298730 7:157883060-157883082 CTCCAACAACAGTCATTTTGAGG - Intronic
1037771806 8:21805613-21805635 CTACATGAGCAGTCAAACTAGGG + Intronic
1038461362 8:27720092-27720114 CTCCAACTGCAGTTATTTTATGG - Intergenic
1043126623 8:76404386-76404408 GTCCAACAGCAGGCATTCCATGG - Intergenic
1043730803 8:83678020-83678042 CTCTATCAACAGGCATTCCACGG + Intergenic
1044006572 8:86944036-86944058 CTCCCTCAGCATTTATTCAAGGG - Intronic
1045691513 8:104764393-104764415 CCCCATCACCTGTCAGTCTAAGG + Intronic
1047522063 8:125602596-125602618 AACCATCAGCAGTAATTCAATGG + Intergenic
1048653809 8:136512521-136512543 CTCCAACAGTAGTCATTCCCAGG + Intergenic
1049380659 8:142314166-142314188 CACCGTCCGCAGTCATTCTTTGG + Intronic
1052445071 9:28550585-28550607 CTACATCAACAGACACTCTATGG + Intronic
1056821718 9:89846924-89846946 CTCCATCAGGAGTCCCTCAAGGG + Intergenic
1060156841 9:121326134-121326156 CTCCACCAGCAGTCATGCCCAGG + Intronic
1191248028 X:58243408-58243430 CTCCAACATCAGACAATCTAAGG + Intergenic
1191789765 X:64957317-64957339 CTGCATCTGCTGTAATTCTAAGG + Intronic
1193699895 X:84747724-84747746 CTCCCTCAGAAGTCTATCTAAGG - Intergenic
1194976033 X:100396810-100396832 TTCTACCAGCAGTCATTCTAGGG - Intronic
1195216734 X:102711409-102711431 CTGTTTCAGCAGTCATTCTCAGG - Intergenic
1200376005 X:155781030-155781052 CTCCATCTGGAATGATTCTATGG + Exonic
1201325028 Y:12747402-12747424 GGCCACCAGAAGTCATTCTAGGG + Intronic