ID: 1119593168

View in Genome Browser
Species Human (GRCh38)
Location 14:75909275-75909297
Sequence CCCTGAGACGATTTTAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 58}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119593168_1119593178 26 Left 1119593168 14:75909275-75909297 CCTGCCCTAAAATCGTCTCAGGG 0: 1
1: 0
2: 0
3: 6
4: 58
Right 1119593178 14:75909324-75909346 CCCTATACCCTGAAGCCCCCTGG 0: 1
1: 0
2: 1
3: 8
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119593168 Original CRISPR CCCTGAGACGATTTTAGGGC AGG (reversed) Intronic