ID: 1119593621

View in Genome Browser
Species Human (GRCh38)
Location 14:75913524-75913546
Sequence CATAGTGCCCAGCCTGTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 0, 2: 5, 3: 57, 4: 421}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119593618_1119593621 7 Left 1119593618 14:75913494-75913516 CCAAGTGGACTCTAAAACTCTAG 0: 1
1: 0
2: 1
3: 9
4: 94
Right 1119593621 14:75913524-75913546 CATAGTGCCCAGCCTGTAGTAGG 0: 1
1: 0
2: 5
3: 57
4: 421
1119593616_1119593621 28 Left 1119593616 14:75913473-75913495 CCTGGAATGCGAGGATCAGGTCC 0: 1
1: 0
2: 0
3: 7
4: 64
Right 1119593621 14:75913524-75913546 CATAGTGCCCAGCCTGTAGTAGG 0: 1
1: 0
2: 5
3: 57
4: 421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119593621 Original CRISPR CATAGTGCCCAGCCTGTAGT AGG Intronic
900874528 1:5331955-5331977 CACCGTGCCCGGCCTGTTGTGGG + Intergenic
902244176 1:15108546-15108568 CAGTGTGCCCAGCACGTAGTGGG + Intronic
902680594 1:18041361-18041383 CCTAGTGTACAGCCTGCAGTGGG + Intergenic
903603288 1:24557167-24557189 CACGGTGCCCAGCATGCAGTAGG + Intronic
903833023 1:26185948-26185970 CATAGTGCCCAGCCTAGAGCTGG - Intronic
903912561 1:26738465-26738487 CATAGTGCCTGGCATATAGTAGG + Intronic
904896203 1:33820271-33820293 CATAGTGCCCATGCTTTAGTGGG - Intronic
904919830 1:33998437-33998459 CAAAATGACCAGTCTGTAGTAGG + Intronic
905125108 1:35710665-35710687 CACTGTGCCCAGCCTGCATTAGG + Intergenic
905267599 1:36765415-36765437 AAGAGTGCCCAGCCAATAGTAGG - Intergenic
905633303 1:39531065-39531087 CATGGTGCGCAGCCTGTGCTAGG - Intergenic
905645322 1:39621378-39621400 CATAGTGCCTGGCCCATAGTAGG - Intergenic
905989747 1:42325970-42325992 CACAGTGCCCAGCCTGATTTTGG - Intronic
906728995 1:48064977-48064999 CACTGTGCCTAGCATGTAGTAGG - Intergenic
906931069 1:50169989-50170011 CATAGTGTCTAGCATGTGGTAGG + Intronic
907150084 1:52276915-52276937 CATGGTGCTAGGCCTGTAGTAGG + Intronic
907554343 1:55331770-55331792 CATATTGCCTAGCCCATAGTAGG - Intergenic
907803295 1:57793169-57793191 CAGAGTGCATAGCCTCTAGTAGG + Intronic
908329431 1:63056169-63056191 CAGAGTGCCCAGCCCACAGTAGG + Intergenic
908504616 1:64784093-64784115 CACTGTGCCCAGCCAGTAGAAGG - Intronic
908646814 1:66287389-66287411 CACAGTGCCCAACATTTAGTAGG + Intronic
909502824 1:76354236-76354258 CACAGGGCCCAGCCTGGAGCTGG - Intronic
910719215 1:90267130-90267152 CACAGTGCCAAGCTTGTAATAGG + Intergenic
911330668 1:96522298-96522320 GACAGTGCCTAGCCTGTAGAGGG + Intergenic
911477074 1:98386882-98386904 AAAAGTGCCCAGCCTGTAGGAGG - Intergenic
912438948 1:109683575-109683597 CATAGTGCCTGGAATGTAGTAGG + Intronic
912441470 1:109702020-109702042 CATAGTGCCTGGAATGTAGTAGG + Intronic
912727181 1:112068694-112068716 CATAGTGCCTGGCATGTAATAGG + Intergenic
914232325 1:145774956-145774978 CACTGTGCCCAGCCTGTTTTTGG - Intronic
916607356 1:166356214-166356236 CACAGTTCCCAGCTTGTGGTAGG + Intergenic
917008446 1:170443348-170443370 CACAGTGTCTAGCATGTAGTAGG - Intergenic
917073493 1:171178573-171178595 CATGGTGCCCAGCCTAGAATTGG - Intergenic
917078804 1:171235756-171235778 CACAGTGCCTGGCATGTAGTAGG - Intergenic
917144409 1:171873263-171873285 CATGGTGCCTGACCTGTAGTAGG + Intronic
918141829 1:181726252-181726274 AACAGTTCCCAGCATGTAGTAGG - Intronic
918456091 1:184716677-184716699 CATAGTGCCTGGCATATAGTAGG - Intronic
918649085 1:186937910-186937932 CACAGTGCCCAGAATATAGTAGG + Intronic
921006373 1:211097696-211097718 CATAGTGCTGAGCCTACAGTAGG + Intronic
921820707 1:219613126-219613148 CTTAGAGCGCAGCCTGTAGCCGG - Intergenic
922234836 1:223714763-223714785 CATTGTGCCCAGCATATAGTAGG - Intronic
922313603 1:224420884-224420906 CACCGTGCCCAGCCAGAAGTTGG + Intronic
922650287 1:227332043-227332065 CAAAGTGCCCAACCTATTGTTGG - Intergenic
923005951 1:230050043-230050065 CCTAGTGCAAAGCCTGTATTTGG + Intergenic
924614522 1:245601641-245601663 CACAGTGCCCAGCACATAGTAGG + Intronic
1062816125 10:501773-501795 CACAGTGCCTGGCCTGTGGTCGG - Intronic
1064080635 10:12305139-12305161 CATAGTGCCTACCCTGTCATAGG + Intergenic
1064679941 10:17800598-17800620 CATAGTGCCCAGAACATAGTAGG - Exonic
1064731854 10:18339230-18339252 CACTGTGCCCAGCCTGTTGGTGG - Intronic
1064759907 10:18607853-18607875 TAAAGTGCATAGCCTGTAGTAGG - Intronic
1064861579 10:19832213-19832235 CATAGCACCTAGCATGTAGTAGG + Intronic
1065892804 10:30135466-30135488 CAAAGTGCCCAGCCCAAAGTAGG - Intergenic
1067184143 10:44012869-44012891 CATGGTGCCCAGCCTCTGCTTGG + Intergenic
1068785241 10:60965499-60965521 CATGGTGCCTGGCATGTAGTAGG + Intronic
1068863542 10:61870782-61870804 CACAGTGCTCAGCACGTAGTAGG - Intergenic
1069226148 10:65947465-65947487 CCTAGTGTCCAGCATGTAGCAGG - Intronic
1069498829 10:68931228-68931250 CCTAGTGCCCAACATGTTGTAGG + Intronic
1070243690 10:74709701-74709723 CACTGTGCCCAGCCTGTGGCTGG - Intergenic
1070965582 10:80528418-80528440 CTTAGGGCCCAGTCTGTGGTGGG + Exonic
1071420633 10:85493773-85493795 CATAGTGCCTAGCGTCTTGTAGG - Intergenic
1071940039 10:90580030-90580052 CAGAGTGCCCAACCTGTAGGTGG - Intergenic
1072241857 10:93504079-93504101 CATAGTGCCTAGTATATAGTAGG + Intronic
1074182003 10:111073889-111073911 CATTGTGCCTAGCATGTGGTTGG + Intergenic
1075995187 10:126871375-126871397 CACAGTGCCTGGCCTGAAGTGGG - Intergenic
1078000484 11:7490752-7490774 CACAGGGCCCATCCAGTAGTGGG - Intronic
1078234571 11:9472215-9472237 CATTGTTCCCAGCCTGTTTTTGG + Intronic
1078380696 11:10837515-10837537 CACTGTGCCCAGCCTGAAATGGG + Intronic
1079285054 11:19121444-19121466 AATAGTGCCCAGCACGTAGTAGG + Intronic
1079454654 11:20625979-20626001 CATAGTGCCCAGCTCATAGGAGG + Intronic
1079653268 11:22957809-22957831 AATAGTGCCTAGCTTTTAGTGGG - Intergenic
1080440722 11:32292089-32292111 CATAGTGCACAGCCCATAATAGG + Intergenic
1081046009 11:38273752-38273774 CACAGCGCCCGGCCAGTAGTTGG + Intergenic
1081535753 11:43995134-43995156 CACCGTGCCCAGCATGCAGTAGG - Intergenic
1081717800 11:45263201-45263223 CATAGGACCTGGCCTGTAGTGGG - Intronic
1081828570 11:46084541-46084563 CACAGTGCTGAGCATGTAGTGGG - Intronic
1082045509 11:47722877-47722899 CACAGTGCCCAGCCTGAAAATGG + Intronic
1082074241 11:47963959-47963981 CATAGTGCCCAGCATCTGCTTGG + Intergenic
1083147900 11:60772503-60772525 CATAGTGCCTGGCATGCAGTAGG + Intronic
1083622284 11:64055180-64055202 CATGGAGCCCAGCCTGCAGGAGG + Intronic
1083671438 11:64302096-64302118 GACAGTGCCCAGCACGTAGTAGG - Intronic
1085584581 11:77689873-77689895 CACTGTGCCCAGCCTGGAGAAGG - Intronic
1086102375 11:83114495-83114517 CATATTGCCCAGGCTGTTCTTGG - Intergenic
1086415990 11:86589300-86589322 CTTAGTGCCTGGCTTGTAGTAGG + Intronic
1086428468 11:86711872-86711894 CATGGGGCTCAGCCTGTAGAAGG - Intergenic
1089203541 11:116740181-116740203 CATAGTGTCTGGCATGTAGTAGG - Intergenic
1089274020 11:117321328-117321350 AATAGTGCTTAGCGTGTAGTAGG - Intronic
1089715970 11:120359528-120359550 CAAAGTGCCCAGCCTATTGGTGG + Intronic
1089909907 11:122087350-122087372 CAAAGTGCCCAGCACGTAGTAGG + Intergenic
1090248304 11:125233510-125233532 CAGAGTGCCCAGCCTGTGCTGGG - Intronic
1090332918 11:125945250-125945272 AACAGTGCCCAGCATGCAGTAGG - Intergenic
1090341567 11:126026276-126026298 CATAGTGCCTGGCATATAGTAGG - Intronic
1091298804 11:134491896-134491918 AACAGTGACCAGCATGTAGTGGG + Intergenic
1092263086 12:6962814-6962836 CGCAGTGCCCAGCCTGTGCTGGG - Intergenic
1092967906 12:13662652-13662674 AATAGTGCCCAGCCCTTAGTAGG + Intronic
1093673807 12:21909785-21909807 CATAGTGCCCAGCATTTCCTGGG - Intronic
1093939372 12:25036210-25036232 CATAGTGCCTAGCATATAGTAGG + Intronic
1095177809 12:39113341-39113363 CACTGTGCCCAGCCTGTACTTGG + Intergenic
1096746905 12:53734919-53734941 CACCGTGCCCAGCCAGGAGTAGG + Intergenic
1097080523 12:56427409-56427431 CACTGTGCCCAGCCTGTCCTAGG + Intronic
1097497517 12:60359201-60359223 CTTAGAGCACAGCCTATAGTGGG + Intergenic
1098233098 12:68392753-68392775 CAGAGTACCCAGCATATAGTAGG + Intergenic
1098445883 12:70565087-70565109 AACAGTGCCTAGCCTATAGTAGG + Intronic
1098794447 12:74870735-74870757 CATAGTGTCCAGCATGTAGTAGG - Intergenic
1098985790 12:77010483-77010505 CATAGTGCCTAGCATATAATAGG + Intergenic
1099434217 12:82624103-82624125 CACCGCGCCCGGCCTGTAGTGGG + Intergenic
1100328934 12:93568023-93568045 CATAGTTCTTAGCATGTAGTAGG - Intergenic
1100392350 12:94154873-94154895 CATAGTACCCAGTATGTAGTTGG + Intronic
1100633874 12:96415544-96415566 CATTGTGCCCAGCCTAAAGTGGG + Intergenic
1100878803 12:98993455-98993477 CACTGTGCCCAGCCTGTAGTTGG + Intronic
1101637802 12:106560600-106560622 CCCAGTGCCTAGTCTGTAGTCGG + Intronic
1102886980 12:116529725-116529747 CACAGTGCCCAGCCTGAAGCAGG + Intergenic
1103313385 12:120031047-120031069 CTTGGTGCCTTGCCTGTAGTTGG - Intronic
1103455577 12:121062777-121062799 CCCAGTGCCCAGCACGTAGTAGG - Intergenic
1104002707 12:124870354-124870376 CATAGTGCCCAGCACAGAGTAGG - Intronic
1104644153 12:130485234-130485256 CATAGTGCCCTGCATATAGTAGG - Intronic
1104737582 12:131146703-131146725 CGTGGTTCCCAGCCTGTGGTGGG + Intergenic
1106720728 13:32432272-32432294 CACGGTGCCCAGCTTGTATTTGG + Intergenic
1107343433 13:39434200-39434222 TATAGTACCCAACATGTAGTAGG - Intronic
1108111580 13:47079647-47079669 CATAGTGCCTGGCATGTAGTAGG + Intergenic
1109957817 13:69591149-69591171 CATAGTGCCCAGCCTGGGCTGGG + Intergenic
1110155518 13:72312165-72312187 CATAGTGCCTGGCATATAGTGGG - Intergenic
1110326100 13:74217438-74217460 CACCGCGCCCAGCCTGTAGTGGG - Intergenic
1110543830 13:76734786-76734808 CACTGTGCCCAGCCTGAAGTAGG + Intergenic
1110730969 13:78877777-78877799 CTGACTGCTCAGCCTGTAGTGGG - Intergenic
1112055100 13:95683636-95683658 CACAGTGCCCAGCCGGAACTGGG - Intronic
1112203453 13:97301216-97301238 CACAGTGCACAGCCTGTAGCAGG - Intronic
1112632647 13:101179585-101179607 CATATTACCCAGCTTGTAGTGGG - Intronic
1114718474 14:24854029-24854051 CACAGTGACTAGCATGTAGTAGG + Intronic
1114851188 14:26384105-26384127 CACCGCGCCCGGCCTGTAGTTGG + Intergenic
1116437293 14:44909752-44909774 CACCGTGCCCAGCCAGTAATGGG + Intergenic
1118030225 14:61812099-61812121 AATAGTTCCCAGCACGTAGTAGG - Intergenic
1118302378 14:64627068-64627090 TATTGTGCCCAGCATATAGTAGG - Intergenic
1118679649 14:68226958-68226980 CATAGTGCCTATCATTTAGTAGG - Intronic
1118717069 14:68567875-68567897 CATAGTGCCTGGCCTGTGGCAGG + Intronic
1119062763 14:71492912-71492934 CATTGTGCCCAGCCAGTAAATGG + Intronic
1119593621 14:75913524-75913546 CATAGTGCCCAGCCTGTAGTAGG + Intronic
1119855191 14:77894631-77894653 CACAGTGCCTGGCATGTAGTAGG + Intronic
1120490684 14:85175126-85175148 CAGATTGCCCACCCTGAAGTGGG - Intergenic
1120873240 14:89356724-89356746 CATGGTGCCTGGCATGTAGTAGG - Intronic
1124633320 15:31349618-31349640 CTTAGTGCCTAGCATGCAGTGGG + Intronic
1125788289 15:42342159-42342181 CATGGTGCCCGGCATGCAGTAGG + Intronic
1125847026 15:42865530-42865552 GACTGTGCCCAGCCTGTTGTTGG - Intronic
1126739291 15:51761436-51761458 CACAGTGCCCAGCCTCTATTTGG - Intronic
1127305116 15:57697833-57697855 CATCGCGCCCAGCCTGTTTTTGG - Intronic
1127431835 15:58918041-58918063 CATTGCGCCCAGCTGGTAGTTGG + Intronic
1128402009 15:67292970-67292992 GACAGTGCCTAGCCTGGAGTAGG + Intronic
1128843558 15:70870776-70870798 CACCGTGCCCAGCCAGCAGTAGG + Intronic
1129824167 15:78623892-78623914 CACAGTGCCTGGCATGTAGTAGG - Intergenic
1130615901 15:85407526-85407548 CATCGTGCCCGGCCTGTGCTGGG + Intronic
1130811916 15:87388439-87388461 CATAGTGCTCAACATGTAGTAGG - Intergenic
1130905352 15:88236382-88236404 CACAGTGCCCAGCCTGTTTTGGG - Intronic
1130965418 15:88694114-88694136 AACAGTGCCTAGCATGTAGTGGG - Intergenic
1131150819 15:90046271-90046293 CTCAGTGCCCAGCCCATAGTAGG + Intronic
1131197248 15:90365519-90365541 CACAGTGCCCAGCACGCAGTAGG + Intronic
1131866221 15:96713468-96713490 CATAGTGCCCAGCACTGAGTAGG - Intergenic
1132659667 16:1055742-1055764 CATAGGCCCCAGCCTGTTGCAGG + Intergenic
1133114901 16:3572574-3572596 CACTGTGCCAGGCCTGTAGTGGG + Intronic
1133358826 16:5157396-5157418 CATCGTGCCCAGCCTGGATGAGG - Intergenic
1133890632 16:9875841-9875863 CCCAGTGCCCAGGCTGGAGTAGG + Intronic
1133890763 16:9876657-9876679 CTCAGTGCCAGGCCTGTAGTAGG - Intronic
1134027939 16:10968662-10968684 CCTAGTGGCCGGCATGTAGTAGG + Intronic
1134095441 16:11415584-11415606 CCTTGTGCCCTGCATGTAGTAGG - Intronic
1134674466 16:16079721-16079743 AATAGTGCCCAGTATATAGTAGG + Intronic
1134756305 16:16670517-16670539 CACAGTGCCCAGCACATAGTAGG + Intergenic
1134989765 16:18688647-18688669 CACAGTGCCCAGCACATAGTAGG - Intergenic
1135129246 16:19838658-19838680 CAAAGTGCCTGGCGTGTAGTTGG - Intronic
1135146507 16:19967303-19967325 CACCGTGCCCAGCCTGTGTTTGG + Intergenic
1135410933 16:22233903-22233925 CACCATGCCCAGCCTGTTGTTGG + Intronic
1135756759 16:25105202-25105224 CATAGTGCCTAGGCTCTGGTGGG - Intergenic
1135867732 16:26119747-26119769 CATAGTGCCTGGCATGAAGTAGG - Intronic
1136046026 16:27615640-27615662 CACTGTGCCCGGCCTGTAGTGGG + Intronic
1137612758 16:49829899-49829921 CACAGTGCCTGGCATGTAGTTGG - Intronic
1137844349 16:51672692-51672714 CACAGTGCTCAACCTATAGTAGG + Intergenic
1137883890 16:52081234-52081256 CTTCGTGCCCAGCCTCTAATGGG + Intergenic
1137886642 16:52111540-52111562 CACTGTGCCCAGCCAGAAGTAGG - Intergenic
1139644389 16:68317537-68317559 CACTGTGCCCAGCCTGTTTTTGG - Intronic
1139888883 16:70233808-70233830 AACAGTGCCTAGTCTGTAGTAGG - Intergenic
1141146924 16:81537575-81537597 CACCGTGCCCAGCCTCTATTTGG - Intronic
1142120515 16:88384335-88384357 CTCAGTGCCCAGCCTGTCCTAGG + Intergenic
1146091188 17:29880129-29880151 CAGAGTGCCAAACATGTAGTAGG - Intronic
1146381960 17:32337170-32337192 CATTGTGCCCAGCCTACAGGTGG - Intronic
1146400101 17:32495096-32495118 CATGGTGCCGAGGCTGTGGTTGG - Intronic
1146470667 17:33121756-33121778 CACAGTGCCTGGCATGTAGTAGG - Intronic
1147583755 17:41640845-41640867 CATCCTGCCCTGCCTGTGGTAGG + Intergenic
1147742290 17:42676186-42676208 GATAGCGCCCAGCCTGCAGCGGG + Intronic
1149019904 17:51950910-51950932 GATAGTGCACAGCATTTAGTAGG + Intronic
1149402509 17:56312708-56312730 CATAGTGCCTAGCACATAGTGGG - Intronic
1150232148 17:63560979-63561001 CACTGCACCCAGCCTGTAGTGGG - Intronic
1150494837 17:65599369-65599391 CACAGTGCCCAGCACATAGTAGG - Intronic
1150866476 17:68855922-68855944 CACTGTGCCCAGCCTAGAGTTGG - Intergenic
1151370513 17:73644086-73644108 CATGGTGACCAGCCTGGAGAGGG + Exonic
1152003711 17:77663720-77663742 CACCGTGCCCAGCCTTTATTTGG - Intergenic
1153093483 18:1374508-1374530 CATAGTCCACAGCCTTTAGAGGG + Intergenic
1154040155 18:10846991-10847013 GATAGTGCCCAGCCCAGAGTGGG - Intronic
1155261626 18:24049303-24049325 CATAGTGCCTGGCATGTAGTAGG - Intronic
1156058668 18:33045403-33045425 CAAAGTGCTGAGCATGTAGTGGG + Intronic
1157408651 18:47445386-47445408 CATAGTGCCTTGCATATAGTAGG + Intergenic
1157521718 18:48349906-48349928 CACAGTGCCTGGCCTGTAATGGG + Intronic
1157530964 18:48419993-48420015 CATAGTGCCCGGCATTTAGTAGG + Intergenic
1158923052 18:62215567-62215589 CATAGTGCCTGGCATGAAGTAGG - Intronic
1163072955 19:14860828-14860850 CACAGCGCCCAGCCAGTAGATGG - Intergenic
1163257577 19:16166609-16166631 TATGGTGCCCAACATGTAGTAGG - Intronic
1163600296 19:18245121-18245143 CACTGTGCCTAGCCTGTTGTTGG + Intronic
1164221743 19:23201169-23201191 CACTGGGCCCAGCCTGTAATAGG - Intergenic
1164556937 19:29260387-29260409 CCCAGTGCCCAGCATATAGTTGG - Intergenic
1164566544 19:29329853-29329875 CACAATGCCCAGCATGTAGCCGG - Intergenic
1164898023 19:31894512-31894534 CTTAGGGCCCAGCCTGCAATAGG - Intergenic
1164945672 19:32291179-32291201 CATAGTGCCCAACACTTAGTAGG + Intergenic
1164949276 19:32322781-32322803 CACAGTTCCCAGCCCGTAGCTGG + Intergenic
1165136298 19:33671850-33671872 AATAGTGCCAGGCATGTAGTAGG + Intronic
1166395248 19:42434889-42434911 CACCGTGCCCAGCCTGTCATAGG - Intronic
1167169626 19:47822460-47822482 CCCAGTGCCCAGCGTGTGGTTGG + Intronic
1167412740 19:49354709-49354731 CACCGTGCCCAGCCTCTATTAGG - Intronic
925230527 2:2229676-2229698 CACAGTGCCTTGCCTATAGTGGG - Intronic
925788199 2:7453424-7453446 CACAGTGCCTGGCCTGTAGCAGG - Intergenic
926292089 2:11539337-11539359 CATTGTGCCCAGCCAATAGCTGG + Intronic
926658053 2:15431093-15431115 CACTGTGCCCAGCCGGTAGAGGG + Intronic
927310190 2:21621901-21621923 CACAGTGCCCAGCCTGTTTCTGG + Intergenic
928832146 2:35500134-35500156 CACCGCGCCCAGCCTGTAGGTGG - Intergenic
929506863 2:42535096-42535118 CACCGCGCCCAGCCTGTACTGGG - Intronic
929634552 2:43504589-43504611 CACCATGCCCAGCCTATAGTAGG - Intronic
930073872 2:47391070-47391092 CATAGCACCCAGCCTTCAGTGGG - Intergenic
930086110 2:47498417-47498439 CACCGTGCCCAGCCTGGAGGGGG - Intronic
930146733 2:48014880-48014902 CACAGTGTCCAGCATATAGTTGG + Intergenic
930357577 2:50341423-50341445 AAAAGTGCCCAGACTATAGTAGG - Intronic
930637018 2:53817419-53817441 CATCGTGCCCAGCCTCCACTTGG + Intronic
930843013 2:55868803-55868825 CATAGAGCTGAGCATGTAGTAGG + Intronic
930894292 2:56427405-56427427 CATAGTGCCTAGCCCATAGAAGG - Intergenic
931666191 2:64610948-64610970 CACTGTGCCCAGCCTATTGTTGG - Intergenic
932217382 2:69975688-69975710 CACAGTGCCCAGCACGCAGTAGG + Intergenic
932559689 2:72856167-72856189 CACAGTGACCAGCATGTAGTAGG + Intergenic
933723940 2:85415625-85415647 CATAGCGCCCAGCAGGTAATAGG + Intronic
934549347 2:95245555-95245577 CACCGTGCCCAGCCTGGAGCTGG + Intronic
934662676 2:96151455-96151477 CACAGTGCCCAGCCCTGAGTGGG + Intergenic
934772271 2:96914598-96914620 CACAGTGCCCAGCCCTTGGTGGG - Intronic
935229356 2:101082406-101082428 CAGGGTGCCCAGCCTGCAGGAGG - Intronic
936038886 2:109134096-109134118 CAAAGTGCCCAGCATGCAGCAGG - Intronic
936401076 2:112164873-112164895 CACAGTGCACAGCCTGCAGCAGG + Intronic
937390056 2:121478310-121478332 CACTGTGCCCAGCCTGTAGGTGG - Intronic
937864615 2:126739773-126739795 CACATGGCCAAGCCTGTAGTCGG + Intergenic
938981250 2:136529312-136529334 CATAATGCCCAGCACATAGTAGG + Intergenic
939463470 2:142527593-142527615 CATGGTGCCCAGCCTGGATATGG - Intergenic
940042419 2:149374490-149374512 GATAGAGCCCAGCAAGTAGTAGG + Intronic
940343470 2:152604882-152604904 CACCGTGCCCAGCCTGTATTGGG + Intronic
940450805 2:153834216-153834238 CATGGTGTCCAGCCTGTGGTAGG - Intergenic
940712094 2:157174884-157174906 CATAGTTCCTAGCATGTAGTAGG + Intergenic
940929234 2:159407181-159407203 CACTGTGCCCAGCCAGTTGTGGG - Intronic
941123392 2:161558117-161558139 CACAGTGCCCAGCATATAATAGG + Intronic
942102575 2:172600461-172600483 CATAATGGCCAGTATGTAGTAGG + Intronic
945215422 2:207428882-207428904 CATAGTTCCTAGCTTGTGGTAGG + Intergenic
945284846 2:208071774-208071796 CACTGTACCCAGCCTGCAGTGGG + Intergenic
946824574 2:223663946-223663968 CACTGTGCCCAGCCTGTATTTGG - Intergenic
948647741 2:239418503-239418525 CATGCTGCCCAGCAAGTAGTGGG + Intergenic
1171100088 20:22374773-22374795 CACAATGCCAAGCCTGTACTGGG - Intergenic
1172457659 20:35090660-35090682 CACTGTGCCCAGCCTCTGGTGGG + Intronic
1172476655 20:35243468-35243490 CACAGTGCCTAGCCTGTAGTAGG + Intronic
1172669480 20:36625047-36625069 CAGAGTGTCCAGCATGTGGTGGG - Intronic
1172678162 20:36690006-36690028 CACCGCGCCCAGCCTGTAATTGG + Intronic
1172808781 20:37632408-37632430 AACAGTGCCCAGCACGTAGTAGG + Intergenic
1172998505 20:39088900-39088922 CATGATGCCCAGCCCGTACTAGG - Intergenic
1173351319 20:42248153-42248175 CATAGTACAGAGCCTGTAATAGG + Intronic
1173579468 20:44137086-44137108 CATTGTGCCCAGCACATAGTAGG + Intronic
1173757842 20:45533905-45533927 CACCGTGCCCAGCCTGTGCTTGG + Intergenic
1174399289 20:50267372-50267394 CAGAGTGCCCAGCATGTGGTAGG - Intergenic
1174481868 20:50837032-50837054 CATAGTCCCTGGCTTGTAGTAGG - Intronic
1174538360 20:51270330-51270352 CTCAGTGCCCAGCATGTAGGAGG + Intergenic
1175220794 20:57415276-57415298 CATAGGGCACAGCCTGGGGTGGG + Intergenic
1175372272 20:58499952-58499974 GGAAGTGCCCAGTCTGTAGTAGG - Intronic
1175482822 20:59323449-59323471 AATGGTGCCCAGCCCGTAGCAGG - Intronic
1175709063 20:61204830-61204852 CAAACTGCCTAGCATGTAGTTGG + Intergenic
1176711743 21:10155897-10155919 CACCATGCCCAGGCTGTAGTGGG - Intergenic
1178319082 21:31591277-31591299 CACTGTGCCCAGCCTGTTTTGGG - Intergenic
1179666047 21:42913298-42913320 CATAGTGCCTAGCATATAGTAGG - Intronic
1179887163 21:44319091-44319113 CAGAGTGCCCTGCCTGGAGCTGG + Intronic
1180260623 21:46666594-46666616 CACAGTGCCCAGCCTGTGTCAGG + Intergenic
1180800177 22:18628085-18628107 AAAAGTGCCCAGCATGCAGTAGG - Intergenic
1180851410 22:19023649-19023671 AAAAGTGCCCAGCATGCAGTAGG - Intergenic
1180986130 22:19904764-19904786 CACAGTGCCCCTCCTGCAGTGGG - Intronic
1181221539 22:21367181-21367203 AAAAGTGCCCAGCATGCAGTAGG + Intergenic
1181901985 22:26163670-26163692 CTGATTGTCCAGCCTGTAGTAGG - Intergenic
1182571212 22:31239763-31239785 CAAAGTGCCTAGAATGTAGTGGG + Intronic
1182909231 22:33966942-33966964 CACAATGCCCAGCATATAGTTGG - Intergenic
1183085974 22:35487363-35487385 AAAAGTGCACAGCCTCTAGTGGG - Intergenic
1183108824 22:35633318-35633340 CATAGTGGCCAGCACATAGTAGG + Intronic
1183372276 22:37440183-37440205 AATAGTGCCCAGCACATAGTTGG + Intergenic
1183432073 22:37771995-37772017 CACAGTGCCCAGGATATAGTAGG - Intronic
1184461752 22:44641666-44641688 CACAGTGCCCAGCATATAGCAGG - Intergenic
949430793 3:3973319-3973341 AATAGTGCCCAATATGTAGTAGG - Intronic
949952469 3:9240582-9240604 CGTAGTGCCCACCATCTAGTTGG - Intronic
950039793 3:9912912-9912934 CTTTGTGCCCACCCTGTAGCAGG + Intronic
950089271 3:10284002-10284024 GAGAGTGCCCAGCCCATAGTGGG + Intronic
950306676 3:11920342-11920364 CACCGCGCCCAGCCTGTAATGGG + Intergenic
950745465 3:15084567-15084589 CATAGTACCTAGTCTGTAGTGGG + Intronic
951919919 3:27843128-27843150 CATTGTGCCTAGCATGGAGTAGG + Intergenic
952339107 3:32430497-32430519 CCTAGTGCCCAGCACATAGTAGG - Intronic
952588022 3:34916478-34916500 CATAGAGCCAAGGGTGTAGTAGG - Intergenic
952843202 3:37665741-37665763 CACCGTGCCCAGCCTGATGTGGG + Intronic
953849512 3:46455194-46455216 CATAGAGCCCAGCCTGCTCTTGG - Intronic
955361011 3:58274961-58274983 CACAGTGCCCAGCGTGTTGCAGG - Intronic
955372051 3:58360545-58360567 CACTGTGCCCAGCCTGGAGCTGG - Intronic
956000175 3:64721578-64721600 CACAGTGCCAAGAATGTAGTAGG + Intergenic
956957400 3:74356599-74356621 CCTAGTGCCTAGCATATAGTAGG + Intronic
957417567 3:79926343-79926365 CACAGTGCCTAGCATTTAGTTGG + Intergenic
958937272 3:100270191-100270213 CACAGTGAGTAGCCTGTAGTAGG + Intronic
959810980 3:110618986-110619008 AATAGTGGCTGGCCTGTAGTTGG - Intergenic
960116665 3:113901524-113901546 CATAGTGCTTAGCATGTGGTTGG + Intronic
961355821 3:126339380-126339402 TAGAGAGCCCAGGCTGTAGTGGG - Intergenic
961366611 3:126403582-126403604 CATATTGGCCAGGCTGTAGTTGG + Intronic
962221707 3:133569919-133569941 CATAGGGCCCGGCATATAGTAGG + Intergenic
962351895 3:134662500-134662522 CATAGGGCCCAGCATAGAGTGGG - Intronic
963631936 3:147744225-147744247 CACAGTGCCCAGCACATAGTAGG - Intergenic
963920320 3:150899108-150899130 CATAGTGCCTGGTATGTAGTAGG + Intronic
965444044 3:168752246-168752268 CACAGCGCCCAGCCTCTAGATGG + Intergenic
965638957 3:170812920-170812942 CACAGGGCCCAACATGTAGTAGG + Intronic
965984452 3:174735283-174735305 CACATTGCCCAGCATGTATTAGG - Intronic
966160395 3:176961553-176961575 AATAGTGCCCAGCATTCAGTAGG - Intergenic
966437895 3:179908978-179909000 CATAATGCCCAGCACATAGTAGG + Intronic
967007535 3:185398672-185398694 CATGGTGCCTAGCATGTAGCAGG + Intronic
967713490 3:192736712-192736734 CATTGTGCCCAGCATATAGCAGG + Intronic
968585338 4:1413755-1413777 CACAGTGCCCACCCTGTCGGAGG - Intergenic
968592997 4:1468923-1468945 CACAGTGCCCAGCCCTTAGTGGG - Intergenic
969435778 4:7188581-7188603 CCCAGTGCCCAGCCTGGAGCTGG + Intergenic
969461905 4:7333477-7333499 CACAGGGCCCAGCCTGCAGGAGG + Intronic
971050626 4:22857972-22857994 CAATATGCCCAGCATGTAGTAGG + Intergenic
971577194 4:28290655-28290677 CTTACTGCCCAGCCTGTGGAAGG - Intergenic
971753688 4:30681593-30681615 GGTAGTGCCTAGCATGTAGTAGG - Intergenic
972354056 4:38264019-38264041 CACGGTGCCCAGCCTGTACCTGG + Intergenic
972598091 4:40547890-40547912 CATAGGGCCTGGCCTGTAGGAGG - Intronic
972692991 4:41417810-41417832 CACTGTGCCCAGCCTCTAGAGGG + Intronic
972808567 4:42557752-42557774 CATGGTGCCCAGCCTGTTTTGGG - Intronic
973280437 4:48354750-48354772 CAGTGTGCCCAGCCTGTTATGGG + Intronic
973295257 4:48511985-48512007 CACAGTGCCTAGCAAGTAGTGGG + Intronic
973740799 4:53917464-53917486 AATGGTGCCCAGCATGTAGTAGG + Intronic
973740809 4:53917535-53917557 AATGGTGCCTAGCATGTAGTAGG + Intronic
973880080 4:55262397-55262419 TCTATTGCCCAGGCTGTAGTGGG + Intergenic
976222965 4:82772862-82772884 CATAGTGCCTGGCATCTAGTAGG + Intronic
976284774 4:83360834-83360856 CATGGTGCCTGGCCTGTATTAGG - Intergenic
978740769 4:112135593-112135615 CAAAGTGCCCAGTATGTAGTTGG - Intergenic
979003148 4:115253392-115253414 CACTGTGCCCAGCCTGTTGATGG - Intergenic
979493740 4:121360958-121360980 CATAGTGCCTAGCATGTGTTAGG + Intronic
980057778 4:128095451-128095473 CTTATTGCCCAGGCTGGAGTGGG - Intronic
980176677 4:129354449-129354471 GATAGTGCCCAGCAAATAGTAGG - Intergenic
981998496 4:151001144-151001166 GATAGTGCTCAGTCTGTTGTGGG - Intronic
982054624 4:151535721-151535743 AATAGTGCCTGGCCTGTAGAAGG + Intronic
983677592 4:170314053-170314075 AATGGTGGCCAGCATGTAGTAGG - Intergenic
983884334 4:172963524-172963546 CATAGTGTCTAGCATATAGTAGG + Intronic
986965945 5:13271251-13271273 AATAGTGCCTAGCATGTAGTAGG + Intergenic
988512976 5:31881405-31881427 CTTATTGCCCAGGCTGGAGTTGG + Intronic
990298925 5:54431409-54431431 CACTGTGCCCAGCCTGGACTGGG - Intergenic
991038184 5:62149391-62149413 CATGGTTCTCAGCTTGTAGTAGG + Intergenic
991091787 5:62700648-62700670 CACAGTGTCCAGCGTGGAGTAGG + Intergenic
995049132 5:107682544-107682566 CATTGTGCACAGCATGTAGTAGG + Intergenic
996942260 5:129022311-129022333 CACAGTGTCCAGCATATAGTTGG + Intronic
997251375 5:132391259-132391281 CACAGTGCCCAGCCCATGGTAGG - Intronic
997739121 5:136238359-136238381 AATAGTGTCCAGCTTGTAGCTGG + Intronic
998142631 5:139708912-139708934 AATAGTGCCTAGCACGTAGTAGG + Intergenic
998339105 5:141400337-141400359 CAAAGTCCCCTGACTGTAGTTGG - Exonic
1000239951 5:159400038-159400060 AATACTGCCCAGCCTAGAGTTGG - Intergenic
1000508684 5:162154378-162154400 CATAGTGCCTGGCATATAGTTGG + Exonic
1000897091 5:166868450-166868472 CCTAGTGCCTAGCATGTATTTGG - Intergenic
1000901031 5:166912147-166912169 CACTGTGCCCAGCCTGAATTAGG - Intergenic
1001154512 5:169261604-169261626 CATAGTGCCAGGTCTGGAGTAGG - Intronic
1001957735 5:175859754-175859776 CATGGGGACCAGCTTGTAGTAGG + Intronic
1002205267 5:177558632-177558654 CACTGCGCCCAGCCTGTACTGGG - Intergenic
1002836496 6:869273-869295 CAGAGTGCCCAGCGTGGAGCAGG + Intergenic
1003269826 6:4598223-4598245 CACCATGCCCAGCCTGTTGTTGG + Intergenic
1003790137 6:9537038-9537060 CATAGTATCCAGCCTGTTGTTGG - Intergenic
1004789093 6:19004568-19004590 CATAGTGCCCAGCCAGTTAAAGG - Intergenic
1005013645 6:21358297-21358319 CACTGTGCCCGGCCTGCAGTTGG - Intergenic
1005880601 6:30056415-30056437 CATAATGCCTAGCATGTAGGAGG + Intergenic
1006943165 6:37766131-37766153 CATTGGGCCCAGCCAGTTGTTGG - Intergenic
1007374520 6:41447226-41447248 AACAGTGCCCAGCCCATAGTAGG + Intergenic
1007708970 6:43809564-43809586 CATAGGGCCTGGCATGTAGTGGG + Intergenic
1008702200 6:54114766-54114788 AATAGTGCCTAGCATTTAGTAGG + Intronic
1008726670 6:54429894-54429916 AACAGTTCCTAGCCTGTAGTTGG + Intergenic
1008946917 6:57108125-57108147 CACAGTGCCCGGCCTGTATTTGG + Intronic
1009564932 6:65301433-65301455 CTTAGAGCGCAGCCTGTAGCCGG + Intronic
1010243245 6:73637275-73637297 GATAGTGCCTAGCATGGAGTAGG - Intronic
1011787582 6:90864275-90864297 GACAGTGCCAAGCTTGTAGTAGG + Intergenic
1012055461 6:94402385-94402407 AACAGTGCCTAGCATGTAGTAGG - Intergenic
1012291466 6:97460545-97460567 CACAGTGCCTGGCATGTAGTAGG + Intergenic
1013792024 6:113848154-113848176 CACCGAGCCCGGCCTGTAGTTGG + Intergenic
1013792230 6:113850738-113850760 CACTGCCCCCAGCCTGTAGTAGG - Intergenic
1013821488 6:114158209-114158231 CATAGTGCATAGCATGTAGAAGG + Intronic
1014226559 6:118854639-118854661 CATTGTGCCCAGCCTCATGTAGG + Intronic
1014637668 6:123868154-123868176 CACTGTGCCCAGCCTGTACTGGG + Intronic
1015595419 6:134861562-134861584 CACCACGCCCAGCCTGTAGTAGG - Intergenic
1015764295 6:136699563-136699585 CAGTGAGCCCAGGCTGTAGTGGG - Intronic
1016279966 6:142404937-142404959 AATAGTGCCTGGCATGTAGTAGG - Intronic
1017028206 6:150198887-150198909 CACAGTGCCCTGCCTGCAGTAGG + Intronic
1017035413 6:150262813-150262835 CACCGTGTCCAGCCTGTAGAAGG - Intergenic
1017111868 6:150940197-150940219 CAGAGTGCCCAGCACATAGTAGG + Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017426007 6:154322226-154322248 CACCTTGCCCAGCCTGTAGGTGG - Intronic
1017562092 6:155639123-155639145 CAGAGTGTCCAGCCTGCAGATGG - Intergenic
1018884893 6:167926876-167926898 CACAGTCCCCAGCATATAGTAGG + Intronic
1019960649 7:4456625-4456647 CACTGTGCCCGGCCTGAAGTGGG + Intergenic
1021478459 7:21089294-21089316 CACAGTGCCCAGCATGTGGTTGG + Intergenic
1023613364 7:41993633-41993655 AACAATGCCCAGCCTATAGTAGG + Intronic
1023970634 7:44988258-44988280 CACCGCGCCCAGCCTGTTGTAGG - Intergenic
1024035114 7:45501377-45501399 CACCGTGCCCAGCCTGTACTGGG - Intergenic
1024504123 7:50146857-50146879 CACAGTGCCCAGCATGCAGCAGG - Intronic
1025092711 7:56076931-56076953 CACAGTGCCCAGCCTCCAGCAGG - Intronic
1026332007 7:69360280-69360302 CACCGTGCCCAGCCTGGATTTGG + Intergenic
1026401972 7:70023131-70023153 CACTGTGCCCAGCCTCTAATTGG + Intronic
1026513843 7:71049742-71049764 CACAGGGCCCAGCCTGGAGCTGG - Intergenic
1027219272 7:76203630-76203652 CATTGTGCCCAGCATGGAGCTGG - Intronic
1029136714 7:98378020-98378042 CACAGTTCTCAGCCTGTAGCTGG - Intronic
1029450147 7:100636975-100636997 CATGGTGCCCAGCCTGTTCAGGG - Intronic
1029636274 7:101786439-101786461 CACCGTGCCCAGCCTGAACTTGG - Intergenic
1031596958 7:123659634-123659656 CACAGTGCTTAGCATGTAGTAGG - Intronic
1032439896 7:131934611-131934633 CATAGTGCCTAGCATATTGTAGG - Intergenic
1033103457 7:138497681-138497703 CACCGCGCCCAGCCTGTTGTTGG + Intronic
1034057061 7:148046232-148046254 CATTGTGCCCAGCCAGTACCTGG + Intronic
1034627200 7:152502870-152502892 CACTGTGCCCGGCCTGTACTTGG - Intergenic
1034843524 7:154421854-154421876 CCCAGTGCCCAGCATGTTGTAGG + Intronic
1035723256 8:1808783-1808805 CAAAGTGCCCAACCAGTAGACGG - Intergenic
1035810892 8:2490145-2490167 CACCGTGCCCAGCCTGAAATAGG + Intergenic
1035862391 8:3043539-3043561 CATGGTGCCCAGCATAGAGTAGG + Intronic
1036069402 8:5423904-5423926 CATAGTGCCCAGGCTGTTCTGGG + Intergenic
1036512831 8:9416717-9416739 CAGAGTTCCCAGCCTACAGTAGG + Intergenic
1036947168 8:13105386-13105408 CATAGTGCCTGGCCCGCAGTAGG - Intronic
1037537024 8:19834091-19834113 CATAGTCCCCACCCTGTAGTAGG - Intronic
1038291367 8:26252628-26252650 CACTGTGCCTGGCCTGTAGTGGG - Intergenic
1038611553 8:29064064-29064086 TACAGTGACCAGCCTGAAGTGGG - Intronic
1038964195 8:32552880-32552902 CACAGTGCCTGGCATGTAGTAGG - Intronic
1039222548 8:35350430-35350452 AAAAGTGCCTAGCATGTAGTAGG + Intronic
1039521373 8:38175231-38175253 CATAGTGCCCAGCTAATTGTAGG + Intronic
1039917098 8:41868145-41868167 CATTGTACCCAGCCTGAAGCAGG + Intronic
1040349302 8:46547559-46547581 CATAGTACCTAGTATGTAGTAGG + Intergenic
1040967018 8:53093024-53093046 CACAGTGCCCGGCCTGTGGATGG + Intergenic
1042491118 8:69398987-69399009 CACAGTGGCCAGCTTTTAGTAGG - Intergenic
1042713874 8:71750161-71750183 CATAGTAATCAGCCTATAGTTGG + Intergenic
1042945325 8:74148390-74148412 CATAGTGCCTGGCATGTAGTAGG + Intergenic
1043772208 8:84218810-84218832 GATAGTGCCCAGCGTGTGGTTGG + Intronic
1044120860 8:88393164-88393186 AATAATGCCCAGCCTTTAGAAGG - Intergenic
1044448521 8:92306372-92306394 CACAGTGCCTAGCACGTAGTAGG - Intergenic
1044599800 8:93992162-93992184 CAAAGTGCCCAGCACATAGTAGG + Intergenic
1044921225 8:97171551-97171573 CATGGTGCCTGGTCTGTAGTGGG - Intergenic
1046434749 8:114173118-114173140 CACCGTGCCCAGCCTGTAATTGG - Intergenic
1047094579 8:121610121-121610143 CACAGTGCCCAGCCTATAACAGG + Intergenic
1047317972 8:123752101-123752123 CATAGTGCCCAGAACATAGTAGG - Intergenic
1047320034 8:123770237-123770259 CACAGTGCCCAGCCAGTATGAGG + Intronic
1048454388 8:134564880-134564902 CACAGTGCCCAGCATGTTGCAGG - Intronic
1048708700 8:137183864-137183886 CATGGTGCCCAGCATGGTGTGGG - Intergenic
1050633955 9:7590303-7590325 CACAGTGGCCAGCATATAGTAGG - Intergenic
1051719244 9:20018676-20018698 CATAGTGCCTGGTGTGTAGTGGG - Intergenic
1052104663 9:24498142-24498164 TCTAGTGCCTAGCATGTAGTAGG + Intergenic
1053648734 9:40141588-40141610 CACCGTGCCCAGGCTGTAGCGGG - Intergenic
1053757010 9:41322254-41322276 CACCGTGCCCAGGCTGTAGCGGG + Intergenic
1054535847 9:66234582-66234604 CACCGTGCCCAGGCTGTAGCGGG + Intergenic
1055487492 9:76771406-76771428 AAGAGTGCCCAGCATATAGTAGG - Intronic
1055624881 9:78166009-78166031 CACCGTGCCCAGCCTGGATTAGG + Intergenic
1056160597 9:83887991-83888013 CACTGTGCCCAGCCGGTAGTAGG - Intronic
1057835678 9:98443103-98443125 CATAGTGCTCAGCATATAGTAGG + Intronic
1058090056 9:100795657-100795679 CACTGTGCCTAGCCTATAGTTGG + Intergenic
1058721636 9:107769588-107769610 CACAGTGCCCAGCATCCAGTAGG - Intergenic
1058768749 9:108209500-108209522 CACAGGGCCCAGTCTGTAGTAGG + Intergenic
1060998577 9:127889058-127889080 CACCGTGCCCAGCCTGTTCTAGG - Intronic
1061117502 9:128623795-128623817 CATAGTGCCCAGCCGGTCCAAGG - Intronic
1061222527 9:129260445-129260467 CATAGTGCCCAGCATGAGATTGG + Intergenic
1061786570 9:133032214-133032236 CACCGTGCCCAGCCTGGAATGGG + Intronic
1062298236 9:135847057-135847079 CACCGTGCCCGGCCTATAGTAGG - Intronic
1202796498 9_KI270719v1_random:124886-124908 CACCATGCCCAGGCTGTAGTGGG - Intergenic
1187887409 X:23902460-23902482 CATGATGCCCAGCCCATAGTTGG + Intronic
1188309135 X:28596090-28596112 CATTGTGCACAGCATATAGTAGG + Intronic
1188607284 X:32046980-32047002 CATAGTGCCTAGTCAGTAATTGG + Intronic
1189282920 X:39831869-39831891 CATTGTGCCCTGCCTGTAGTAGG - Intergenic
1190877808 X:54471987-54472009 CACTGTGCCCAGCCAGAAGTTGG - Intronic
1191012554 X:55775792-55775814 CATAGTGCCTAGCAAGTAGTAGG + Intergenic
1192098240 X:68235959-68235981 CATAGTGCCTGGCCTGATGTAGG - Intronic
1192205006 X:69089761-69089783 CACAGTGCCCAGCCTGTCTGTGG - Intergenic
1193071666 X:77312643-77312665 CACTGTGCCCAGCCTGATGTAGG - Intergenic
1195674895 X:107500503-107500525 CACGGCGCCCAGCCTGAAGTAGG - Intergenic
1195905904 X:109844159-109844181 GATAGTGCCCAGCACATAGTAGG - Intergenic
1195928301 X:110048443-110048465 CATAGTGCCTGGCAAGTAGTAGG + Intronic
1195986519 X:110636632-110636654 CATAGTGCCTGGCATATAGTAGG - Intergenic
1196201531 X:112891256-112891278 CATAGTGCTGAGCATTTAGTTGG - Intergenic
1196617937 X:117788838-117788860 CATAGTGCCTGGCATTTAGTAGG + Intergenic
1196764604 X:119231539-119231561 AATAGTGCCTGGCATGTAGTAGG - Intergenic
1198085235 X:133276530-133276552 CATGGTGCCTAGCATATAGTTGG + Intergenic
1198205163 X:134459013-134459035 CACAGTGCCCAGCACATAGTTGG - Intergenic
1198394179 X:136206413-136206435 CATGGTGCCCACCTTGTAGCTGG - Exonic
1198673991 X:139112308-139112330 CACAGTGCCCAACATATAGTAGG + Intronic
1199969002 X:152844793-152844815 CATAGTGCCCAGCACAAAGTGGG - Intronic