ID: 1119597237

View in Genome Browser
Species Human (GRCh38)
Location 14:75946590-75946612
Sequence CTGAACACACAGAAGATGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 1, 2: 2, 3: 28, 4: 311}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119597237_1119597239 -4 Left 1119597237 14:75946590-75946612 CCAAGCATCTTCTGTGTGTTCAG 0: 1
1: 1
2: 2
3: 28
4: 311
Right 1119597239 14:75946609-75946631 TCAGCACTATTCTAGGCACTAGG 0: 2
1: 2
2: 27
3: 159
4: 713
1119597237_1119597240 8 Left 1119597237 14:75946590-75946612 CCAAGCATCTTCTGTGTGTTCAG 0: 1
1: 1
2: 2
3: 28
4: 311
Right 1119597240 14:75946621-75946643 TAGGCACTAGGCACAAGCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119597237 Original CRISPR CTGAACACACAGAAGATGCT TGG (reversed) Intronic
900300128 1:1973018-1973040 CTGAACACCCAGAAGGAGCTCGG - Exonic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
900672730 1:3865878-3865900 CTCATCACACAGCAGCTGCTGGG - Exonic
901656115 1:10770646-10770668 CCGAGCCCACAGAAGATGCTGGG + Intronic
902048761 1:13545265-13545287 ATGAACTCACAGAAGGTGCTGGG - Intergenic
902383691 1:16064644-16064666 CTGAGAAGACAGGAGATGCTTGG - Intronic
902653914 1:17854444-17854466 CTGGACACACAGAGGAGGCGGGG + Intergenic
903201020 1:21738938-21738960 CTGAAAACACTGAAGATACTGGG + Intronic
903293094 1:22326931-22326953 CTGAACAGACAGAAGTGGGTTGG - Intergenic
903828130 1:26159611-26159633 CTGACTACACACTAGATGCTGGG + Intronic
904426254 1:30425234-30425256 CTGAACAGACAGGACTTGCTGGG - Intergenic
904841836 1:33377251-33377273 CAGAGCACACAGGATATGCTTGG - Intronic
905301973 1:36991732-36991754 CTGAACCCTCAGCAGATGCCAGG - Intronic
906520853 1:46466247-46466269 CTGGACACACAGAAGGCGCTGGG + Intergenic
906824853 1:48968473-48968495 CTAAACAGACTGAAGATGATTGG + Intronic
907083898 1:51651081-51651103 GGGAACACACAGAAGACTCTGGG + Intronic
907909775 1:58815599-58815621 CTGATCACTCAGAACATGGTAGG + Intergenic
908448916 1:64230502-64230524 ATGTACACACAGAGGATGTTGGG - Intronic
908655676 1:66385677-66385699 CTGAACAGACAGGACTTGCTGGG + Intergenic
909774538 1:79467375-79467397 CTGAACAGACAGACCGTGCTAGG - Intergenic
913243829 1:116853965-116853987 CTGATCACTCAGAAGTTGGTGGG - Intergenic
913427939 1:118755672-118755694 CTGAAAACTAAGAAAATGCTTGG + Intergenic
915977772 1:160401672-160401694 CCAAACACACAGCAGATGCATGG - Intronic
916538451 1:165728102-165728124 CAGAACATTCAGAAGATTCTCGG - Exonic
916896903 1:169172974-169172996 ATGAACACACAGTAAATGTTTGG + Intronic
917282298 1:173389863-173389885 CTCAACAAATAGAAGAAGCTAGG - Intergenic
918099032 1:181357549-181357571 CTGAACTCACAGAGGCTGCCTGG - Intergenic
921551523 1:216541888-216541910 GTGATCACACAGAAGATTCCTGG + Intronic
922699271 1:227749114-227749136 ATCCAAACACAGAAGATGCTCGG - Intronic
922770221 1:228177732-228177754 TTAAAGACACAGAAGAGGCTGGG - Exonic
1063045526 10:2388382-2388404 CAGCACACACAGAGGATCCTTGG - Intergenic
1063045954 10:2392730-2392752 CAGCACACACAGAGGATGCTTGG - Intergenic
1063200118 10:3779718-3779740 CTGAAGACACTGATGAGGCTTGG - Intronic
1063281277 10:4632025-4632047 CTGAAGAAACAGATGATTCTAGG + Intergenic
1064027474 10:11860176-11860198 CTGACTACAGAGAAGGTGCTTGG + Intronic
1065006665 10:21386823-21386845 CTGAACACACAGGCCTTGCTGGG + Intergenic
1065150833 10:22821559-22821581 CTGGACACACAGAAAGTGCTTGG + Intergenic
1065229828 10:23586696-23586718 CCTAACACTCAGGAGATGCTTGG + Intergenic
1065600084 10:27359216-27359238 CTGAACACACAGGAGGCACTGGG + Intergenic
1065877300 10:30008386-30008408 CGGGACACACACAAGCTGCTTGG + Intergenic
1066581927 10:36890678-36890700 CTGAACACACAGGAGGAACTCGG - Intergenic
1070689418 10:78513559-78513581 CTGACCACACAAAGGATCCTGGG - Intergenic
1072756347 10:98023751-98023773 CAGGACACACAGAAGATTCATGG + Intronic
1073494836 10:103881419-103881441 CTGTACACAGAGAAGATGCAGGG + Intergenic
1074393789 10:113080004-113080026 CAGTACACACATAAGATGCAGGG - Intronic
1074948075 10:118300524-118300546 CTGAACACATATTATATGCTAGG + Exonic
1075800183 10:125148955-125148977 ATGGACACTCTGAAGATGCTAGG + Intronic
1078611847 11:12827343-12827365 TTGAAAACTCAGAAAATGCTGGG - Intronic
1082134754 11:48534316-48534338 CTGAAAACACAGAAGTAACTGGG - Intergenic
1083622142 11:64054506-64054528 CTGAGCAGAGAGAAGATGCAAGG - Intronic
1084515626 11:69636844-69636866 GTGAACACACAGAAGGGGCTTGG + Intergenic
1084678217 11:70649245-70649267 CTGAACACAAAGGAGATGCATGG + Intronic
1084858592 11:72004044-72004066 CTCAACACACCCAAGAAGCTAGG - Exonic
1085351616 11:75801436-75801458 CAGAACACACAGGAGAGGGTTGG - Exonic
1085670526 11:78460081-78460103 CTGAAGACACAGAAGAAGGGTGG + Intronic
1085819213 11:79774079-79774101 CTAGGCACAGAGAAGATGCTTGG + Intergenic
1087639133 11:100736436-100736458 CTGGGCACACAGAAAATGCCTGG + Intronic
1089748361 11:120632769-120632791 CTGAGCACACAGAAGCCTCTGGG - Intronic
1090358363 11:126155828-126155850 CAGAACACACGGAAGAGGATAGG + Intergenic
1091107870 11:132939722-132939744 CTGACCACACTGAACATCCTGGG + Intronic
1091701821 12:2668438-2668460 CCTAATACACAGAGGATGCTGGG - Intronic
1091869045 12:3872168-3872190 CTGAACAAACAGACCTTGCTGGG + Intronic
1094312848 12:29104437-29104459 CTGAAAACACAAAAGAACCTTGG - Intergenic
1094343485 12:29439972-29439994 GTGAACACACGGAGGGTGCTGGG - Intronic
1095089263 12:38088557-38088579 CAGAACACACAGGCGAGGCTGGG - Intergenic
1095675645 12:44914670-44914692 CTTAACACAGAGTAGCTGCTCGG + Intronic
1096264062 12:50110105-50110127 CTGAGGACACAGATGTTGCTAGG - Exonic
1099519944 12:83648378-83648400 TTGAACATACAGTTGATGCTTGG - Intergenic
1099612281 12:84889086-84889108 CTGAACAGACAGGACTTGCTGGG + Intronic
1100322188 12:93506221-93506243 TTGAAGACTCAGAAGAGGCTGGG - Exonic
1100704557 12:97186242-97186264 CTGAACAGGCAGAACTTGCTTGG - Intergenic
1100871909 12:98918366-98918388 ATGAATACACAGAAGATACAAGG + Intronic
1101731372 12:107429120-107429142 CTTAACGCACAGAAAGTGCTGGG + Intronic
1102950534 12:117027952-117027974 CTGCACAGACAGAAGCGGCTGGG + Intronic
1102987870 12:117293240-117293262 GGGAACACACGGAAGGTGCTAGG + Intronic
1103478206 12:121233686-121233708 CACAACACACAGGAGCTGCTGGG - Exonic
1104900814 12:132188748-132188770 CAGAACACAGAGCAGTTGCTGGG - Intergenic
1106021926 13:25923872-25923894 ACAACCACACAGAAGATGCTAGG - Intronic
1106962429 13:35014704-35014726 CTGCAAACACAGAAGCTTCTTGG + Intronic
1109344456 13:61098562-61098584 CTGAACAGACAGGACTTGCTGGG + Intergenic
1109513413 13:63408668-63408690 TTTAACACAAAGCAGATGCTCGG + Intergenic
1109638676 13:65157708-65157730 CTGAACACACAGTAAGTGTTAGG + Intergenic
1109877523 13:68425955-68425977 CTGAACACACAAGAGATACAGGG - Intergenic
1110653132 13:77965633-77965655 CTGAAGAAACATAAGATGTTTGG - Intergenic
1112992591 13:105532199-105532221 CTTACCACACTGAGGATGCTGGG - Intergenic
1113333208 13:109352215-109352237 GTGAACCCAGGGAAGATGCTGGG - Intergenic
1114281416 14:21195688-21195710 CTAAACACACTGAACAGGCTCGG + Intergenic
1115882897 14:37939999-37940021 CTGAACACATAGTATATGCCAGG - Intronic
1117099597 14:52332991-52333013 TTGAAAACACAGAAGAGGCCGGG - Intergenic
1117745824 14:58868527-58868549 AAGAAGAGACAGAAGATGCTGGG - Intergenic
1117985129 14:61379606-61379628 CTTAACACACTGAAGATACCAGG - Intronic
1118266186 14:64296679-64296701 GTGAACACAGAGCAGAAGCTTGG - Intronic
1119597237 14:75946590-75946612 CTGAACACACAGAAGATGCTTGG - Intronic
1122572623 14:102717403-102717425 CTGAGCACACAGAGTGTGCTTGG - Intronic
1123476269 15:20594180-20594202 CAGAAGAGTCAGAAGATGCTGGG - Intergenic
1123479706 15:20619831-20619853 CTGAACACACAGGCCTTGCTGGG + Intergenic
1123638300 15:22380533-22380555 CTGAACACACAGGCCTTGCTGGG - Intergenic
1123641743 15:22406184-22406206 CAGAAGAGTCAGAAGATGCTGGG + Intergenic
1125046607 15:35248459-35248481 CTGAACACACAGGCCTTGCTGGG + Intronic
1126065642 15:44824434-44824456 CAGAGCACACAGAGGCTGCTGGG - Intergenic
1126094193 15:45076133-45076155 CAGAGCACACAGAGGCTGCTGGG + Exonic
1126313097 15:47338959-47338981 CTGAACAGACAGACTTTGCTGGG + Intronic
1126332666 15:47550244-47550266 ATGGACCCAGAGAAGATGCTTGG - Intronic
1129343807 15:74903952-74903974 CTGAAGAAACAGAAGTTGTTTGG + Intronic
1130295416 15:82644329-82644351 CAGAACACACATAATAGGCTGGG + Intronic
1131358789 15:91770681-91770703 TTGAAGACACAAAAGATGCAAGG - Intergenic
1131746673 15:95456051-95456073 CTGAATTCACATAGGATGCTGGG + Intergenic
1132385720 15:101398577-101398599 CTGAAAGCACAGAGGAGGCTCGG + Intronic
1134538836 16:15048031-15048053 CTGAACATACAGAAGGCCCTGGG + Exonic
1135245997 16:20857646-20857668 CTGATCCCACAGAACCTGCTGGG + Exonic
1135956271 16:26958959-26958981 CTGACCACACAGATGAAGCCAGG - Intergenic
1136627001 16:31467387-31467409 CTGGACACACAGATCTTGCTTGG + Intergenic
1137378198 16:47973061-47973083 CTGAATACCTAGAGGATGCTGGG - Intergenic
1137834554 16:51578608-51578630 CTGAACACATACTATATGCTAGG - Intergenic
1137912895 16:52396042-52396064 CTGATCACAGAGTAGAAGCTTGG + Intergenic
1139149645 16:64366149-64366171 CTGAACACCCATAATATGCTTGG - Intergenic
1140932409 16:79640045-79640067 CTGAACACACAGAAAGTGGTAGG + Intergenic
1141860310 16:86711812-86711834 CTGAACACACAGTATTTGCTTGG + Intergenic
1141910017 16:87052601-87052623 CTGAACACCCAGTGGATGCTTGG + Intergenic
1143622698 17:8089966-8089988 CTGAACACACAGTAGGGGTTCGG - Intergenic
1144370367 17:14584594-14584616 CTGAGCAGACAGACCATGCTGGG - Intergenic
1144453378 17:15399487-15399509 CAGAGAAAACAGAAGATGCTTGG + Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1147245308 17:39116370-39116392 CTGAACACCCACCAGATGCCAGG - Intronic
1149610714 17:57955946-57955968 CTGAGGACACAGGAGATGGTGGG + Intergenic
1149688226 17:58551225-58551247 ATGAACAAACAGTAAATGCTAGG - Intergenic
1151164627 17:72193071-72193093 CTGCACACACACAAGATGATTGG - Intergenic
1152213595 17:79018773-79018795 CTAAAAACACACAAGATGATGGG - Intergenic
1152430194 17:80244511-80244533 CTGGTCACACAGGAGAGGCTGGG + Intronic
1153920590 18:9785695-9785717 CTGAACACACAGGCCTTGCTGGG + Intronic
1155822644 18:30397692-30397714 CAGAGCTCACAAAAGATGCTGGG + Intergenic
1157598766 18:48879743-48879765 CTCAACACATAGAAGATACTGGG + Intergenic
1159540728 18:69771966-69771988 CTGAAAACATAGAACATTCTAGG + Intronic
1160479549 18:79226265-79226287 TGGAACACAAGGAAGATGCTGGG - Intronic
1161280796 19:3444484-3444506 CTGAACAGACAGAGGATGCTTGG + Intronic
1163360888 19:16845622-16845644 CTACACAGACAGAAGAGGCTAGG - Intronic
1163396396 19:17065430-17065452 CTGAACAGACAGGACTTGCTGGG + Intronic
1163524147 19:17810193-17810215 CTGAAAACACAAAAGTGGCTAGG + Intronic
1164353537 19:27386403-27386425 CTCATCACAAAGAAGATTCTAGG - Intergenic
1165293295 19:34906089-34906111 CTGAAGACAGAGAAGATGCAGGG + Intergenic
1166547425 19:43641559-43641581 CTGAGGACAGAGAGGATGCTGGG - Intergenic
1167012221 19:46816186-46816208 CTGAGCACACAGGAGGTGGTCGG + Intergenic
925715233 2:6779024-6779046 CTGAACACACAGAAGTGCATGGG + Intergenic
925800792 2:7598464-7598486 CTGAAAACACCAAAGATCCTGGG + Intergenic
925982512 2:9188835-9188857 CTGGAAACAGTGAAGATGCTCGG - Intergenic
926158440 2:10471220-10471242 CTCGGCACACAGCAGATGCTTGG + Intergenic
926715575 2:15921382-15921404 GTGAACACATAGGAAATGCTTGG + Intergenic
929583454 2:43099214-43099236 TCCAACACACAGGAGATGCTGGG - Intergenic
931908939 2:66873270-66873292 CTGCACACATAAATGATGCTAGG + Intergenic
932006170 2:67929294-67929316 CTGATCTCACAGAAGAGACTGGG - Intergenic
932343914 2:70983486-70983508 CAGAAAACTCAGAAGATACTGGG + Intronic
932590419 2:73062962-73062984 CTGGGCACACAGTAGATCCTCGG - Intronic
935265756 2:101392481-101392503 CTGAACAGACAGACCTTGCTGGG + Intergenic
936631658 2:114209751-114209773 CTGAACAAACAGTAGGTGCATGG - Intergenic
936805770 2:116330625-116330647 CTTAATTCACAGAAGATGCAGGG + Intergenic
937011051 2:118563115-118563137 ATGAACACATAGAAGCTGCTGGG - Intergenic
937300977 2:120841611-120841633 CTGGGCACACAGAAGACCCTCGG - Intronic
937977492 2:127590453-127590475 AAGAACGCACAGAAGATGCATGG - Intronic
938080484 2:128367442-128367464 CAGCACACCCAGAAGATGCAGGG - Intergenic
938651619 2:133389306-133389328 CTGAACACAGAGGAGTGGCTTGG - Intronic
938892557 2:135720280-135720302 GTGAACACAGTGAAGATGCCTGG - Intronic
939576479 2:143901239-143901261 CTGAACACACAGGCCTTGCTGGG - Intergenic
939735018 2:145833283-145833305 CTTAACATAAAGAAGATGATCGG - Intergenic
940152281 2:150615707-150615729 ATGAACACCTAGAAGATGCAAGG + Intergenic
941038943 2:160598876-160598898 ATGCACACACAGTAGATGTTGGG + Intergenic
942557089 2:177183082-177183104 CTGAACATCAAGAAGAAGCTTGG - Intergenic
942718453 2:178921862-178921884 CTGAACAGACAGAAGAAGAAAGG - Intronic
945135053 2:206618174-206618196 ATGAACACAAAGAAGCTGCCTGG + Exonic
945786248 2:214241485-214241507 ATGACAACACAAAAGATGCTGGG - Intronic
946045355 2:216816480-216816502 CTTAACACACAGCAGGTGCATGG + Intergenic
948082421 2:235217203-235217225 CTTCACACACAGAAAATGCAGGG - Intergenic
948732440 2:239975597-239975619 CCCAGCACACAGAAGGTGCTCGG + Intronic
1170117916 20:12880848-12880870 CAGAACTCACAGAAAATACTTGG + Intergenic
1170944635 20:20880156-20880178 CTGGACTCACAGAAGCTCCTTGG + Intergenic
1171480850 20:25454685-25454707 GTGCACACACAGAAGAGGCCCGG - Intronic
1171727948 20:28643283-28643305 CAGAATACACAGAAGATACAAGG - Intergenic
1172831224 20:37836700-37836722 CTGAACACTCAGCACTTGCTAGG + Intronic
1172926561 20:38542294-38542316 CTGAACTCACAGAAGATGCTGGG - Intronic
1173397999 20:42698730-42698752 CTGAACACTCATTATATGCTTGG + Intronic
1174097446 20:48100557-48100579 GTGGACATTCAGAAGATGCTGGG - Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1176314526 21:5229818-5229840 CAGAATACACAGAAGATCCCAGG - Intergenic
1177752255 21:25298743-25298765 CAGAACACACAGAAGAAGTAGGG + Intergenic
1178285424 21:31321644-31321666 TTTAAAACACAGAAGAGGCTGGG - Intronic
1178529302 21:33361845-33361867 CTGAACATGCAGAGGCTGCTGGG + Intergenic
1178744249 21:35232386-35232408 TTGAACACATAGCAGGTGCTAGG + Intronic
1179367760 21:40773932-40773954 TTGAAGACACAGTAGAAGCTGGG + Intronic
1181728245 22:24826531-24826553 CTGGCCACACAGCAGGTGCTCGG - Intronic
1182694499 22:32187535-32187557 CTGAACACAGAGAGGCTGCTTGG - Intergenic
1182716800 22:32363572-32363594 CTGAACACAGAGAGGCTGCTTGG + Intronic
1183477314 22:38042736-38042758 CTGACCACACAGAAGAGGGCTGG + Intergenic
1183759408 22:39802405-39802427 CTGAACACACAGGCCTTGCTGGG - Intronic
1184150689 22:42636647-42636669 CTGAGCACAGAGTAGGTGCTGGG + Intronic
1184575174 22:45358095-45358117 GTGACCACACAAGAGATGCTGGG + Intronic
1184803658 22:46777596-46777618 GGGAACACACAGAAGAGTCTGGG + Intronic
951053585 3:18122190-18122212 ATGAAGACATAGAAGATACTGGG + Intronic
951110330 3:18795872-18795894 CTAAACAGAAAGAAAATGCTGGG - Intergenic
951843854 3:27064233-27064255 CTGAACAAAATGAATATGCTTGG + Intergenic
953263277 3:41360800-41360822 CAGAACAGCCAGCAGATGCTGGG + Intronic
953946439 3:47152543-47152565 TTGAAGAAGCAGAAGATGCTAGG - Intronic
954415606 3:50391826-50391848 CTGGCCACAGAGGAGATGCTTGG - Intronic
955908293 3:63830924-63830946 CTGGGCACAAAGAAGATACTTGG + Intronic
956199176 3:66688830-66688852 CTGAATACAAACAACATGCTTGG - Intergenic
957303923 3:78431605-78431627 CTGAACAGACAGGACTTGCTAGG - Intergenic
959794399 3:110406341-110406363 TTGAACATACTGAAGTTGCTGGG - Intergenic
960693179 3:120368939-120368961 CTGAACACATACCATATGCTAGG + Intergenic
961486499 3:127221065-127221087 CTTAACACAGAGCAGATGCAGGG - Intergenic
962964824 3:140343909-140343931 CTGAGCACACAGCAGCTCCTCGG - Intronic
963192112 3:142484255-142484277 CTGAACAGACAGACCTTGCTGGG + Intronic
963823563 3:149926503-149926525 CTAAAAACACAGAAGAGGCTGGG - Intronic
964577321 3:158187276-158187298 CTTAGCACATAGAAGATCCTTGG + Intronic
964738702 3:159943244-159943266 CAGAAGCCAGAGAAGATGCTGGG + Intergenic
965883388 3:173414006-173414028 CTGTGCACACAGAAGATCCTGGG + Intronic
967163586 3:186760499-186760521 CTGAACAGACAGGACTTGCTGGG - Intergenic
969313017 4:6365166-6365188 CTCAACACAGAGAAGACTCTCGG + Intronic
969588527 4:8108372-8108394 CTGAACACACAGACAATGGCCGG + Intronic
971340918 4:25768021-25768043 CTGAACTCACAGACAAGGCTGGG + Intronic
973602872 4:52559381-52559403 ATGAACACACAGAAGCTTCCAGG - Intergenic
973752087 4:54031447-54031469 TTGAACACCAAGTAGATGCTAGG + Intronic
976206328 4:82626509-82626531 CGGAGCCCACAGAAGCTGCTGGG + Intergenic
977847628 4:101784510-101784532 TTATACACATAGAAGATGCTCGG + Intronic
979261633 4:118654082-118654104 CTGGACAAACAGAATGTGCTGGG + Intergenic
979263866 4:118679143-118679165 GTCAACAGACAGAAGGTGCTTGG + Intergenic
981853548 4:149259625-149259647 CTAAAAACAGACAAGATGCTAGG - Intergenic
982320010 4:154067757-154067779 CTGAAGTCACAGCAGATACTGGG + Intergenic
982618476 4:157673738-157673760 TTGAAGACACAGAAGATACAAGG + Intergenic
983061838 4:163169399-163169421 CTAAAGACAGAGAAGATACTTGG + Intergenic
983882498 4:172949221-172949243 CTGGAACCACACAAGATGCTAGG + Intronic
984755946 4:183325654-183325676 CTGAACACATAGTAGATACAAGG - Intergenic
984946897 4:184975850-184975872 CACAAGACACAGAGGATGCTGGG - Intergenic
984983596 4:185305900-185305922 ATGAACACACACATGATGTTAGG - Intronic
985324070 4:188747761-188747783 CTGGACACACAAAAGATGGGAGG - Intergenic
985432588 4:189895589-189895611 CAGAATACACAGAAGATCCCAGG + Intergenic
985779006 5:1860101-1860123 CTCCACACCCAGAAGATGCCTGG - Intergenic
986013883 5:3740757-3740779 CTGAGGACACAGAAGAGGTTGGG - Intergenic
986089766 5:4492862-4492884 TTGAACATACACAAGATTCTTGG - Intergenic
987673756 5:21047857-21047879 CTGAACACACTGAAGATCCTAGG + Intergenic
987791659 5:22576101-22576123 CTGAGAACACAGAAGATTCCTGG - Intronic
988262404 5:28905469-28905491 CTGAAAATACAGAAAATGCACGG + Intergenic
989112939 5:37925115-37925137 CTGAACACACAGGATGTGATTGG - Intergenic
989499079 5:42144801-42144823 CTGAACACAGTGAAGCTGGTAGG + Intergenic
989611318 5:43295324-43295346 TTGAACACACATAGCATGCTAGG + Intronic
989818096 5:45761273-45761295 TTGAAGACACAGGAGATACTTGG + Intergenic
995261982 5:110114844-110114866 CTAAACACAAAGAGGATTCTGGG - Intergenic
995599493 5:113780158-113780180 CTGAACACACAGAGGGTTCCTGG + Intergenic
996336505 5:122389315-122389337 AACAACACACAGATGATGCTGGG - Intronic
997018331 5:129964335-129964357 CTGATGAAACAGAAGATGCTAGG - Intronic
997901244 5:137767128-137767150 CTGTAGTCAGAGAAGATGCTTGG - Intergenic
998382316 5:141734719-141734741 CTGACCACACAGCAGCTGGTAGG - Intergenic
1000383156 5:160647217-160647239 CGGAACCCACAGAAGCTTCTGGG + Intronic
1001388961 5:171363157-171363179 CTGCACACACACAAAATGATGGG + Intergenic
1001858437 5:175032809-175032831 CTGAACAGACAGGCAATGCTGGG - Intergenic
1002429767 5:179196327-179196349 CTGAAGGCGCAGAAGATCCTTGG + Intronic
1003617430 6:7668357-7668379 CTGAAATCACAGAAGGTGTTTGG + Intergenic
1004365888 6:15012353-15012375 CCTGACACACAGTAGATGCTCGG + Intergenic
1004860180 6:19796136-19796158 CTAGCCAGACAGAAGATGCTTGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1006589755 6:35145844-35145866 CGGAAGACAAAGAAGATTCTGGG + Intronic
1007520352 6:42447198-42447220 CTGAAGAAACAGATGATTCTTGG - Intronic
1008893288 6:56521371-56521393 CTGAACACAAACAAGAGGGTTGG - Intronic
1009849538 6:69178252-69178274 CTGAACACAAAGAAGAAGCAGGG - Intronic
1010289994 6:74124469-74124491 CTGAACATAATGAAGATGCCAGG + Intergenic
1011892642 6:92185973-92185995 GAGAGTACACAGAAGATGCTTGG + Intergenic
1012419328 6:99045831-99045853 CTAAACACCCAGAAGGTGATGGG + Intergenic
1013311451 6:108898357-108898379 GTGTCCACACAGAAGATGCCTGG - Intronic
1013718982 6:113000167-113000189 TTGAGCACACAGTAGATGTTAGG + Intergenic
1016544949 6:145211105-145211127 CAGAACAAAGAGAAAATGCTAGG - Intergenic
1016774411 6:147889386-147889408 CTGAACACACAAAAGACAGTTGG + Intergenic
1017007978 6:150041713-150041735 ATAAACACACAGAAGAAACTGGG + Intergenic
1017237427 6:152131551-152131573 CTGAACACAAAGAGGATGAAAGG - Intronic
1017698313 6:157041738-157041760 CAGAAAACAGAGAAGGTGCTGGG - Intronic
1018862474 6:167721006-167721028 CTGAACTCACAGCGGGTGCTGGG - Intergenic
1019298787 7:292690-292712 CAGAACATGCAAAAGATGCTTGG + Intergenic
1020596746 7:10215820-10215842 CTGAAGACTCAGAAGATTTTTGG - Intergenic
1021335685 7:19399122-19399144 CTGAACACTGAAAAGATTCTAGG + Intergenic
1021795314 7:24248758-24248780 CTGAAGACACAGCATCTGCTAGG - Intergenic
1022513818 7:30962960-30962982 CTCCACTCACAGAAGCTGCTGGG - Intronic
1022905153 7:34848617-34848639 CTGAAGACACAGTAGATGAGGGG - Exonic
1022925129 7:35049218-35049240 CTGAACAGCCAGAGAATGCTTGG + Intergenic
1023005753 7:35865282-35865304 GTGAGCACACAGAAGAAACTAGG - Intronic
1023364176 7:39446528-39446550 CATAACACACAGAAGATACCTGG + Intronic
1023991846 7:45133270-45133292 CTGGGCACACAGGAGCTGCTGGG - Intergenic
1025843842 7:65177763-65177785 CTGAACACATACTATATGCTAGG - Intergenic
1025982575 7:66418808-66418830 TTTAACACACAGAGGATCCTGGG + Intronic
1028827583 7:95291101-95291123 CTGAACACACAGCAGTAGCAAGG - Exonic
1028876353 7:95827663-95827685 TTCACCACATAGAAGATGCTTGG + Intronic
1029408706 7:100394309-100394331 CTGACCTCACAGAATAAGCTTGG - Intronic
1029415971 7:100443388-100443410 ATGAGCACACAGGAGATGTTGGG + Intergenic
1029893429 7:103956075-103956097 TGGAACACACATGAGATGCTGGG - Intronic
1030101110 7:105946108-105946130 GAGGACACACAGAAGATACTTGG + Intronic
1030226682 7:107159663-107159685 CTGAAATCACAGAAAATGCTTGG - Exonic
1030771430 7:113480012-113480034 CTGTACACACAGAAAAAGTTAGG + Intergenic
1030998167 7:116383761-116383783 CTGAACACAGAAATGATGCCTGG - Intronic
1031240534 7:119232616-119232638 CTGAAAACACAGAAAGTACTGGG - Intergenic
1032754719 7:134878271-134878293 CTAAACACACAGGACAGGCTGGG + Intronic
1034228775 7:149502511-149502533 CTGACCCCAGAGAAGATGCCAGG - Intergenic
1034290052 7:149923604-149923626 CAGAACCCACAGAAAATGCAAGG + Intergenic
1034661016 7:152769242-152769264 CAGAACCCACAGAAAATGCGAGG - Intronic
1035702945 8:1651253-1651275 CAGAACACACAGAATCTGGTGGG - Intronic
1037671346 8:21017725-21017747 ATGAAAAGAAAGAAGATGCTAGG - Intergenic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1039195689 8:35028970-35028992 TTCATAACACAGAAGATGCTGGG + Intergenic
1040326313 8:46343380-46343402 GCGAAGACACAGAAAATGCTGGG + Intergenic
1040339043 8:46430706-46430728 GTGAGCACGCAGAAAATGCTGGG + Intergenic
1042096068 8:65217309-65217331 CTGAGGACACAGAAGCTTCTTGG + Intergenic
1042835003 8:73071779-73071801 CTACACACACAGAGGATGCTGGG - Exonic
1043966448 8:86482853-86482875 CTGAACATACAGAAGGCCCTGGG + Intronic
1044086204 8:87945125-87945147 CTGGAAACACAGAAGAAACTTGG + Intergenic
1046830527 8:118740980-118741002 CTGAACACACAGGAGGTGAGAGG - Intergenic
1049206691 8:141366849-141366871 CTGGGCACCCAGCAGATGCTCGG + Intronic
1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG + Intergenic
1051200511 9:14616154-14616176 ATTAAAACACAGAAAATGCTTGG + Exonic
1051508425 9:17850289-17850311 CTGAACCCATGGAAAATGCTGGG + Intergenic
1051752281 9:20355401-20355423 CTTAAAACACAGAAGATAGTCGG - Intronic
1051861203 9:21627148-21627170 CTGAAAACACAGAATTTGCATGG + Intergenic
1053721775 9:40953804-40953826 CAGAATACACAGAAGATCCCAGG + Intergenic
1054344185 9:63898185-63898207 CAGAATACACAGAAGATCCCAGG - Intergenic
1055016761 9:71626701-71626723 CAGAGCACACAGAATATTCTAGG - Intergenic
1055264644 9:74480985-74481007 AGGAACACACAGAAGACCCTGGG + Intergenic
1055305873 9:74928433-74928455 CTGAACAGACAGACCTTGCTGGG - Intergenic
1056409829 9:86313989-86314011 CTGAATACTTAGAATATGCTAGG + Intronic
1056594891 9:87999334-87999356 CTGAATACACAGAATAACCTGGG - Intergenic
1056807506 9:89740356-89740378 CTTAACTCACAGAAGATGTTTGG - Intergenic
1057336516 9:94159897-94159919 CTGAGCACACAGAAAATGGGAGG + Intergenic
1057515636 9:95718079-95718101 CTGACCACACATAAGATGGAGGG + Intergenic
1059425727 9:114219886-114219908 GTGAACACACAGCAGATTTTAGG + Intronic
1059699090 9:116757808-116757830 CTGAAGGCTCAGAAGATGATTGG - Intronic
1060581958 9:124756928-124756950 CTGACCAGACTGGAGATGCTAGG + Intronic
1060887110 9:127162155-127162177 CTGAGCACACAGGAGCTGCTTGG - Intronic
1060920815 9:127419088-127419110 CTGACCACCCACAAGATGATCGG + Intergenic
1061383342 9:130272856-130272878 ATGAATAAAAAGAAGATGCTCGG - Intergenic
1203421031 Un_KI270448v1:6061-6083 CAGAATACACAGAAGATCCCAGG + Intergenic
1203421601 Un_KI270521v1:5576-5598 CAGAATACACAGAAGATCCCAGG + Intergenic
1186299807 X:8187920-8187942 CTGAACACACAGAAGAAATGGGG + Intergenic
1187677536 X:21732685-21732707 CAGGATAAACAGAAGATGCTAGG + Intronic
1188434624 X:30146981-30147003 CTGAACACTCACCAGCTGCTGGG - Intergenic
1189999884 X:46675788-46675810 CTGAACACACAGGCCTTGCTGGG + Intronic
1190567915 X:51749977-51749999 CTAAACCCACAGAAGCTACTTGG - Intergenic
1190768416 X:53494973-53494995 CTGAACTCATAGAATATGTTGGG - Intergenic
1192170667 X:68852595-68852617 CTGAACAAACAAAAGCAGCTGGG - Intergenic
1197318075 X:124992710-124992732 CTGGACAGACAGACCATGCTGGG + Intergenic
1200325077 X:155229514-155229536 CTGAAAACAGAGAACATGATAGG - Intronic