ID: 1119598312 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:75956938-75956960 |
| Sequence | GGACCCTACTGCAGTCCTAA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 80 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 5, 4: 73} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1119598308_1119598312 | 15 | Left | 1119598308 | 14:75956900-75956922 | CCACTTCTCAAAATGTGTTAATA | 0: 1 1: 0 2: 2 3: 30 4: 355 |
||
| Right | 1119598312 | 14:75956938-75956960 | GGACCCTACTGCAGTCCTAAAGG | 0: 1 1: 0 2: 1 3: 5 4: 73 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1119598312 | Original CRISPR | GGACCCTACTGCAGTCCTAA AGG | Intronic | ||