ID: 1119598312

View in Genome Browser
Species Human (GRCh38)
Location 14:75956938-75956960
Sequence GGACCCTACTGCAGTCCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119598308_1119598312 15 Left 1119598308 14:75956900-75956922 CCACTTCTCAAAATGTGTTAATA 0: 1
1: 0
2: 2
3: 30
4: 355
Right 1119598312 14:75956938-75956960 GGACCCTACTGCAGTCCTAAAGG 0: 1
1: 0
2: 1
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119598312 Original CRISPR GGACCCTACTGCAGTCCTAA AGG Intronic