ID: 1119599112

View in Genome Browser
Species Human (GRCh38)
Location 14:75962895-75962917
Sequence GAAGGGTCCAAGGATGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119599112_1119599118 8 Left 1119599112 14:75962895-75962917 CCAGTAGCATCCTTGGACCCTTC 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1119599118 14:75962926-75962948 CTAACTGAGCACTTCTTTAATGG 0: 1
1: 0
2: 2
3: 8
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119599112 Original CRISPR GAAGGGTCCAAGGATGCTAC TGG (reversed) Intronic
903135210 1:21304953-21304975 GCAGGGACCAAGGATGGGACCGG - Intronic
903540270 1:24092768-24092790 GGAGGGTCATAGGATGCCACGGG + Intronic
907758772 1:57337447-57337469 AAAGGCTCCAAGGAGGCTGCAGG - Intronic
907844914 1:58196291-58196313 GAAGGGTCCCAGGAGGAAACAGG + Intronic
912513157 1:110201876-110201898 GAAGGATCCAGGGATGCTCAGGG - Exonic
923278308 1:232417564-232417586 GTAGGGAGCAAGGATGCTCCTGG - Intronic
1069582254 10:69573912-69573934 GAAGGGTCCAGGAATTCTAAAGG + Intergenic
1071200481 10:83216443-83216465 GGAGGGCCCAAGGAAGTTACTGG + Intergenic
1072652150 10:97304053-97304075 GAAGAGTCCCAAGATGGTACAGG - Intergenic
1078535197 11:12167453-12167475 GCAGGGTGCAAGGATGTTAGGGG + Intronic
1084160956 11:67349862-67349884 AAAGGGTCCAAGGATGCCAGGGG - Intronic
1087164573 11:94988777-94988799 GAAGCTTCTAAGGATGCTTCTGG + Intronic
1090264055 11:125343028-125343050 GAAGGTTCCAAGGGGGCCACAGG + Intronic
1091636710 12:2202716-2202738 TAAGCGTCCAAGGATGCTTCAGG - Intronic
1092885007 12:12917187-12917209 GGATGTTCCAAGGATGCTGCTGG + Exonic
1094268690 12:28587523-28587545 GAAGGCTGGAAAGATGCTACCGG + Intergenic
1094461379 12:30699949-30699971 GAAGGATCCATGGTTGCTAAGGG + Intergenic
1098013175 12:66076069-66076091 GAATGGTCTATGGTTGCTACTGG - Intergenic
1104607612 12:130201394-130201416 CAAGGGTTCAGGGATGCTGCTGG + Intergenic
1105946258 13:25192500-25192522 GAAGAGTCAAAGGGTGCTCCCGG - Intergenic
1106716082 13:32389784-32389806 GAAAGGTTCCAGGATGTTACAGG - Intronic
1106922297 13:34576509-34576531 GAAGGGCCCAAGGAGGAAACAGG - Intergenic
1114542780 14:23474801-23474823 GAAGAGGCCAAGGATGCTGCTGG + Intronic
1119599112 14:75962895-75962917 GAAGGGTCCAAGGATGCTACTGG - Intronic
1120734587 14:88038844-88038866 TAAGGGTCCATGGAGGCTAACGG + Intergenic
1125469598 15:39990019-39990041 GAAGGGGCCTTGGATGCCACAGG + Intronic
1129516645 15:76161341-76161363 GAAGGGAGGAAGGATGCTATGGG + Intronic
1135933420 16:26758980-26759002 ATAGGGACCAAAGATGCTACTGG + Intergenic
1139706894 16:68747105-68747127 GTAGGCTCCAAGAATGCCACTGG + Intronic
1139818411 16:69697275-69697297 AAAGTGGCCAAAGATGCTACAGG - Exonic
1141879349 16:86847531-86847553 GAAGGGTCTACGCATCCTACTGG + Intergenic
1142137194 16:88456862-88456884 GAAGGGCCCATGGATCCCACAGG + Intronic
1146686514 17:34844851-34844873 GAAAGGCCCAAGGATGATAAAGG - Intergenic
1150579985 17:66464052-66464074 GAAGGATCAATGGATGCTAAGGG - Intronic
1161737594 19:6001229-6001251 GAAGGGCACAAGGAGGCTCCTGG - Intronic
1164558808 19:29274397-29274419 GCAGGGTCCAAGGATACAGCGGG - Intergenic
1165805924 19:38580515-38580537 GAAGGGTCCCAGAGTGCTAGGGG - Intronic
1165882288 19:39052742-39052764 GCCTGGTCCAAGGATGCTCCTGG + Intergenic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1167662566 19:50804493-50804515 GAAGGGTTCGAGGCTGCGACGGG - Intronic
1168241657 19:55091963-55091985 GAAGGGTCCTAGGCTCCTGCTGG + Intronic
1168522305 19:57062115-57062137 GAAGGTTCTTAGGATGCTATAGG + Intergenic
925522854 2:4767039-4767061 GAAGGATCCAAGCAAGGTACAGG + Intergenic
926093189 2:10063715-10063737 GCAGGGTCCACGGCTGCCACGGG + Intronic
926717866 2:15939314-15939336 GAAGGGGCCAATGCTGCTGCTGG + Intergenic
937123079 2:119454185-119454207 GAAGTGCCCAAGGATGCTCTAGG + Intronic
937260486 2:120583243-120583265 GCAGCCTCCAAGGAAGCTACTGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
940352105 2:152702213-152702235 GAAGGATGCAAGGATCCTCCAGG + Intronic
940897173 2:159091902-159091924 GAAGGGTCCAAAAATGATACTGG + Intronic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
944370784 2:198981025-198981047 AAGGGGTTCGAGGATGCTACTGG + Intergenic
1171485353 20:25481799-25481821 GGAGGATCCAGGGATGCCACAGG - Intronic
1172039626 20:32034841-32034863 GCAGGGTCTCTGGATGCTACAGG - Intergenic
1174109388 20:48187622-48187644 GAAGGGTCCAGGGATTCAAAGGG + Intergenic
1181158512 22:20941292-20941314 GAAAGGTCCAAGGAGGCAAGTGG - Intronic
1181386586 22:22550487-22550509 GAAGGATCCCAGGATCCTAGTGG - Intronic
1184220089 22:43094486-43094508 GAAGGGGGCAAGGCTGCTAGAGG - Intergenic
1185205608 22:49536104-49536126 GAAGGCTACAAGGAGGCTAAGGG + Intronic
949924620 3:9031405-9031427 GAAGGGCCCATGGATGCATCAGG - Intronic
951330112 3:21356682-21356704 GAAGGGGCCAAGGCTGCTGTAGG + Intergenic
959921109 3:111869363-111869385 AAAGACTCAAAGGATGCTACAGG - Intronic
960455549 3:117866879-117866901 GATGGGTCAAAGGATGGGACTGG - Intergenic
961766033 3:129211830-129211852 GAAGGATCCGAGGAGGCAACTGG - Intergenic
968919632 4:3515781-3515803 GAGGGGACCAAGGACACTACCGG - Intronic
969500094 4:7547380-7547402 AAAGGCTCCAAGTATGCGACCGG - Intronic
969676582 4:8617737-8617759 GTGGGGTCCAAGGATGCTGAAGG - Intronic
970204583 4:13643292-13643314 GAAGGAACCAAGGACGCTTCCGG - Intergenic
974386034 4:61202304-61202326 AAAGGGGCCAGGGATGCTCCAGG - Intronic
978431583 4:108638769-108638791 GAAGGGACCAAGGATGTCAGAGG - Intergenic
980851748 4:138390612-138390634 GAAGGGGCCAGGGATGCCAGTGG + Intergenic
984588561 4:181590529-181590551 GAAGGCTCCCAGTATGCTAAAGG - Intergenic
985700793 5:1371212-1371234 GGAGGGTCCAAGGAGGGCACAGG - Intergenic
985802293 5:2012608-2012630 GAAGGGTCTGAAGATGCTGCCGG + Intergenic
987261679 5:16210773-16210795 TAAGGGTCCAAGGATTCTCTTGG + Intergenic
989179754 5:38564610-38564632 GAAGTGTCTAGGGATGCTCCCGG - Intronic
999231623 5:150065342-150065364 GGAGGGTCCAGGGAGGCTGCTGG - Intronic
1001512934 5:172336464-172336486 GAAGGCACTAAAGATGCTACAGG + Exonic
1007757023 6:44106318-44106340 GTAGAGTCCAGGGATGCTGCTGG - Intergenic
1008033860 6:46725818-46725840 GAAGGGGCCAAGGGGGCCACGGG + Intronic
1026621395 7:71952790-71952812 GAAGGATGCAGGGATCCTACAGG - Intronic
1029262804 7:99314821-99314843 GACAGGCCCAAGGATGCTGCAGG - Intergenic
1031014411 7:116557689-116557711 GAAGGTTCCAGAGATGCTAAGGG - Intronic
1031464800 7:122095165-122095187 GAAGGGTCCACGGAGGAGACAGG + Intronic
1034422180 7:150995915-150995937 GAAGGGTGCAGGGATGGGACAGG - Intronic
1034422191 7:150995947-150995969 GAAGGGTGCAGGGATGGGACGGG - Intronic
1036940575 8:13048221-13048243 GAAGGGGGCAAGGATGGAACTGG + Intergenic
1037766553 8:21775768-21775790 GAAAGGTCCAAGGAGCCTGCAGG - Intronic
1040510111 8:48085699-48085721 GAGGGTTACAAGGATGCTGCTGG - Intergenic
1045758636 8:105575365-105575387 GAAGGCTCCGAGGATGATGCAGG + Intronic
1046686166 8:117229155-117229177 GAAGCATCCCAGAATGCTACAGG + Intergenic
1049118979 8:140717042-140717064 GTAAGGTCTAAGGATGCTGCCGG + Intronic
1054823438 9:69547204-69547226 GGACAGTCCAAGGATGGTACTGG + Intronic
1056064786 9:82923030-82923052 GAAGGATCCAATGATCCTATTGG + Intergenic
1057455169 9:95202203-95202225 GAAGGCTCCAGGGGTGCTGCTGG + Intronic
1059904612 9:118968860-118968882 GATGTGACCAAGGATGCTAATGG + Intergenic
1060206160 9:121684090-121684112 GGAGGGTGCAGGGAGGCTACAGG - Intronic
1186431629 X:9510154-9510176 GTAGAGGCCAAGGATGCTGCTGG + Intronic
1186817091 X:13248765-13248787 GAAGAGGCCAATGATGCTTCAGG - Intergenic
1187129742 X:16490891-16490913 GAAGGGTCAAAGAATGCTAAAGG - Intergenic