ID: 1119599400

View in Genome Browser
Species Human (GRCh38)
Location 14:75964971-75964993
Sequence AACTCAGCCTTGATGATCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119599400_1119599401 -6 Left 1119599400 14:75964971-75964993 CCAGAGATCATCAAGGCTGAGTT 0: 1
1: 0
2: 0
3: 15
4: 196
Right 1119599401 14:75964988-75965010 TGAGTTCCTTGCAAACATAATGG 0: 1
1: 0
2: 1
3: 11
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119599400 Original CRISPR AACTCAGCCTTGATGATCTC TGG (reversed) Intronic
903189162 1:21646912-21646934 AACTCAGCCATGATCACATCTGG + Intronic
903593628 1:24477405-24477427 AACTCAGGTCTTATGATCTCTGG + Intergenic
905493316 1:38362337-38362359 AAGTCAGCCTTGAGCAACTCAGG + Intergenic
905688939 1:39928595-39928617 AACTAATGCTTGATGATCTGAGG + Intergenic
907121893 1:52015300-52015322 AACTAATGCTTGATGATCTGAGG - Intergenic
908102435 1:60805336-60805358 AACTCATGCTTAATGATCTGAGG - Intergenic
908580687 1:65512780-65512802 AACTCAGCCTCAATGAATTCAGG - Intronic
912958797 1:114176615-114176637 AACTCAGCCTTGGCGGTTTCTGG + Intergenic
913093953 1:115498608-115498630 CACACAGCCTTGCTGTTCTCAGG + Intergenic
916965732 1:169940512-169940534 AACTAATGCTTGATGATCTGAGG - Intronic
918189636 1:182161704-182161726 ACCTCAGCTTTGAGCATCTCAGG - Intergenic
920192615 1:204203109-204203131 ATCTCAGCTTTCATGCTCTCAGG + Intronic
920421632 1:205838152-205838174 CACTGACCCTTGATGATCTGTGG + Intronic
922604396 1:226880476-226880498 AGCTCAGCCCTGAGGGTCTCTGG + Intronic
1062783779 10:242482-242504 AACTGAGCCTTGAAGATGGCTGG - Intronic
1067235585 10:44445751-44445773 AACTCATGCCTGATGATCTGAGG - Intergenic
1070552446 10:77501494-77501516 AACCCCTCCTTGATGCTCTCTGG + Intronic
1071883770 10:89927696-89927718 AACTCATACCTGATGATCTGAGG - Intergenic
1072015675 10:91344022-91344044 AACTAATCCCTGATGATCTGAGG - Intergenic
1072031960 10:91529845-91529867 AACTCAGCCTAGAGGGTCTCTGG - Intergenic
1072052989 10:91724930-91724952 AACTAAGGCTTGATTATCTGAGG + Intergenic
1073976619 10:109109124-109109146 AGTACAGCCTGGATGATCTCTGG - Intergenic
1075873311 10:125786897-125786919 TACTCAGCCTTCACGTTCTCAGG + Intronic
1085724978 11:78947302-78947324 AACTGAGCCTTGAAGCTGTCTGG - Intronic
1085798663 11:79566822-79566844 CATTCAGCCTTGATGATCACAGG - Intergenic
1088266526 11:107992878-107992900 AACTAAGGCTTGATGATCTGAGG + Intergenic
1088939216 11:114436706-114436728 AACTAATGCTTGATGATCTAAGG - Intronic
1089270992 11:117301096-117301118 AAGTCAGCCTTCATCTTCTCAGG + Intronic
1093168757 12:15835681-15835703 AACTAATGCTTGATGATCTGAGG + Intronic
1095178401 12:39119345-39119367 AATTCAGTCTTGCTGATCTCAGG - Intergenic
1096691365 12:53324128-53324150 AACTAATGCCTGATGATCTCAGG - Intronic
1097385275 12:58943653-58943675 AACTCATGCCTGATGATCTGAGG + Intergenic
1097615092 12:61874798-61874820 AGCTTAGCCTTGATCATTTCAGG - Intronic
1099413546 12:82360598-82360620 AACCGAGCCATGAAGATCTCTGG + Intronic
1100506392 12:95224871-95224893 AACTAATGCCTGATGATCTCAGG - Intronic
1101089499 12:101270585-101270607 AACTAATGCTTGATGATCTGAGG + Intergenic
1101409914 12:104458865-104458887 AACGCAGGCTTGATGAATTCGGG - Intronic
1102024274 12:109704614-109704636 AACTCAGCCTTCCTGGTCCCTGG - Intergenic
1103124914 12:118413432-118413454 GACTCAGCCTTGCTGAGCTTTGG + Intronic
1105014057 12:132775289-132775311 AACTCAGACTTGACGTTCTGTGG + Exonic
1105907783 13:24830992-24831014 AACTGAACCTTGTTTATCTCTGG + Intronic
1107589848 13:41891692-41891714 AACTCAGCTTTATTGATTTCTGG - Intronic
1108346847 13:49554725-49554747 AACTCATGCTTGATGATCTGAGG + Intronic
1109317429 13:60766819-60766841 ATCTCATGCTTGATGATCTAAGG - Intergenic
1112638479 13:101244892-101244914 AACTCAACCTTGATGGTAGCTGG + Intronic
1112786440 13:102956811-102956833 AACTCAGCCTTGAAAATGTTTGG - Intergenic
1113512509 13:110867429-110867451 CTCTCAGCCTTGATGATCAAAGG + Intergenic
1118551685 14:66957928-66957950 AACTAATCCCTGATGATCTGAGG + Intronic
1119599400 14:75964971-75964993 AACTCAGCCTTGATGATCTCTGG - Intronic
1120432784 14:84440210-84440232 AACACAGCATTGAAGGTCTCAGG - Intergenic
1121013561 14:90535268-90535290 CACTCAGCCAAGAGGATCTCAGG - Exonic
1121302027 14:92879575-92879597 AACACAGCCTTCATCCTCTCTGG + Intergenic
1126446838 15:48756390-48756412 AACTCAGCCCTGATGACCACAGG + Exonic
1127901082 15:63341477-63341499 AACTAATGCTTGATGATCTGAGG + Intronic
1130047339 15:80455709-80455731 TCCTCAGCCTTCATGATCTTCGG - Intronic
1133154276 16:3861545-3861567 AACTCATCCCTGCTGATCTGTGG + Intronic
1133428634 16:5716047-5716069 AAATCACCATTGATGATGTCTGG + Intergenic
1133895680 16:9926513-9926535 AACTCAGGTATGAAGATCTCTGG + Intronic
1133959829 16:10483877-10483899 AAATGAGCCTTTATGATCACAGG + Intergenic
1134092094 16:11396920-11396942 AACTCTGCCTTGAGGAACACGGG - Intronic
1135995445 16:27244458-27244480 CACTCAGCCTGGAAGATGTCTGG + Intronic
1139281160 16:65771867-65771889 ATCACAGCCTTGATGATGTGTGG + Intergenic
1139972688 16:70786063-70786085 AAGCCAGCCTTGCTGGTCTCAGG + Intronic
1140508609 16:75491080-75491102 AACTCTGCCTTCCTGACCTCAGG - Intronic
1140867745 16:79078731-79078753 GACTCAACCATGATGATTTCTGG + Intronic
1145183819 17:20776590-20776612 GACCCAGCCTTAATGATCTTTGG - Intergenic
1149350042 17:55777183-55777205 GGCACAGCCTTGATGATCTCAGG + Exonic
1149646099 17:58242736-58242758 AACTCAGGCTTCAGGATCTAAGG - Intronic
1150837915 17:68581162-68581184 AATTCTGCCTCGATAATCTCTGG + Intronic
1151173675 17:72269368-72269390 AACTCAGCCCAGATGCTCCCAGG - Intergenic
1151836726 17:76586701-76586723 AACTCATGCCTGATGATCTGAGG - Intronic
1152527864 17:80899840-80899862 AACTCAGCCTTGTTTTTCTATGG - Intronic
1155695973 18:28687042-28687064 AACTAAGGCCTGATGATCTGAGG + Intergenic
1156663832 18:39381427-39381449 CACTGAGCCTTGTTGTTCTCTGG + Intergenic
1157135892 18:45054732-45054754 TACTCAGCTTAGATTATCTCTGG + Intronic
1157474057 18:48010140-48010162 AACTAATGCTTGATGATCTGAGG + Intergenic
1159062554 18:63531238-63531260 AACTCAAGCTTAGTGATCTCAGG - Intergenic
1159294984 18:66473410-66473432 AACTCAGCCTTCATCATGACTGG + Intergenic
1161586784 19:5109990-5110012 ACCTCAGCCTCGCTGGTCTCTGG + Intronic
1166009932 19:39934718-39934740 ACCTCAGCCTTCATGGTCCCAGG - Intergenic
1167998631 19:53426726-53426748 AACTAATGCCTGATGATCTCAGG + Intronic
1168008755 19:53512837-53512859 AACTAATGCCTGATGATCTCAGG + Intergenic
1168191458 19:54741390-54741412 ATCCCACCCTTGCTGATCTCAGG - Intronic
925842774 2:8008014-8008036 AACTCAGCCTCCATGAGCTCTGG - Intergenic
926824479 2:16890407-16890429 ATCTAATCCCTGATGATCTCAGG + Intergenic
927010044 2:18893946-18893968 AACTGAACCTTAATGATATCTGG - Intergenic
929058196 2:37896969-37896991 ATCTAATCCTTGATGATCTGAGG - Intergenic
932442292 2:71745239-71745261 ACCTCAGCCTTGGTGATAACAGG + Intergenic
933479135 2:82833042-82833064 TACTCAGACTGCATGATCTCTGG - Intergenic
939219999 2:139289738-139289760 CTCTCAGCCTTGATTTTCTCAGG + Intergenic
941352191 2:164450590-164450612 CACTCAGACTTGATGGTTTCAGG + Intergenic
942254425 2:174081219-174081241 AACCCAGCCTTAATGATCTTTGG + Exonic
946402057 2:219473325-219473347 ACCTCAGCTTTGCTGCTCTCTGG + Intronic
947585974 2:231357226-231357248 CACTCAGCCTTGGTGGTCACGGG + Intronic
948250477 2:236524609-236524631 AGTTCAGCCTTGAAGACCTCAGG - Intergenic
1169832219 20:9838015-9838037 AACTGAGCAGTGATGATCCCTGG + Intronic
1170505738 20:17024150-17024172 AACTAATGCTTGATGATCTGAGG + Intergenic
1172719837 20:36991283-36991305 AGCTCAGGCTTGATTATTTCTGG - Intergenic
1173051966 20:39571922-39571944 AACTAATGCTTGATGATCTCAGG - Intergenic
1174123223 20:48283090-48283112 AACACAGCTTTGCTGGTCTCCGG - Intergenic
1174137150 20:48387498-48387520 AACCCAGCAGTGATGATCTGTGG + Intergenic
1174314402 20:49686782-49686804 ACCTCAGCCTTGTGGGTCTCTGG - Intronic
1177256555 21:18670554-18670576 AACTCAGCAGTGATGAAGTCAGG - Intergenic
1177453543 21:21303898-21303920 AACTCAGCATTGATCATTTTTGG + Intronic
1177589278 21:23141504-23141526 AAATCAGCCCTTATAATCTCAGG + Intergenic
1178306704 21:31496903-31496925 AACTAATGCTTGATGATCTGAGG - Intronic
1179343826 21:40537684-40537706 ATCTCTGCCTTCATCATCTCAGG - Intronic
1180713696 22:17857367-17857389 AACTAAGGCCTGATGATCTGAGG + Intronic
1182648208 22:31827804-31827826 ATCTTAGCCATGATGCTCTCTGG - Intronic
1184064294 22:42108057-42108079 AACCCAGCCTTAATGATCTTTGG + Intergenic
950417241 3:12875675-12875697 AACTGATCATTGATCATCTCTGG - Intergenic
951011189 3:17681988-17682010 AACTAATGCTTGATGATCTGAGG + Intronic
951505079 3:23435940-23435962 AACTAACGCTTGATGATCTGAGG - Intronic
952111020 3:30124139-30124161 AACTCATGCCTGATGATCTGAGG + Intergenic
952162992 3:30714448-30714470 AACTCATGCCTGATGATCTGAGG + Intergenic
953853631 3:46484611-46484633 AACTGAGCCCTTATGATCTGGGG + Intronic
957949270 3:87104181-87104203 AACACAGAGTTGATGATCTGTGG - Intergenic
960978308 3:123198162-123198184 AACACAGCCTTGGTGACCTATGG - Intronic
961391597 3:126555606-126555628 AGCTCATCCCTGATGATCTGAGG + Intronic
964737448 3:159931210-159931232 AACTCATGCCTGATGATCTTCGG - Intergenic
965576959 3:170227258-170227280 AACTCAGTTTGAATGATCTCTGG - Intronic
966158682 3:176945795-176945817 AACTAATGCCTGATGATCTCAGG + Intergenic
966549581 3:181189702-181189724 ACCTAATCCTTGATTATCTCTGG + Intergenic
967589398 3:191255107-191255129 AACTAATGCTTGATGATCTGAGG - Intronic
969139504 4:5056184-5056206 AACTAACGCCTGATGATCTCAGG + Intronic
970403365 4:15739052-15739074 AACTCAGCCTTACTCTTCTCAGG + Intergenic
970940587 4:21628469-21628491 AAATGAGCCGTGATGATCCCAGG + Intronic
971521945 4:27564667-27564689 AGCTCAGCCATGAAGATCTATGG - Intergenic
973659474 4:53088247-53088269 AAGGCAGCCCTGATGATCTCTGG - Intronic
973772995 4:54223667-54223689 AGATCAGCCTGGATGATCTCAGG - Intronic
974354487 4:60794725-60794747 AACTAATGCCTGATGATCTCAGG + Intergenic
975202796 4:71610915-71610937 TACTCAGCCTTTAAGGTCTCAGG - Intergenic
975406584 4:73997722-73997744 AACTCAGCGTTTATGATGTTTGG + Intronic
975918914 4:79359279-79359301 AACACAGACTGGATGATCTTAGG - Intergenic
979201556 4:117985329-117985351 AACTAATGCCTGATGATCTCAGG + Intergenic
980974606 4:139598766-139598788 AACTAATCCTTGATGATCTGAGG + Intronic
981583610 4:146275344-146275366 AGTTCAGACTAGATGATCTCTGG - Intronic
982567627 4:157006214-157006236 AACTCTGACTTGCTTATCTCTGG + Intergenic
986079071 5:4370458-4370480 AACCCAGCATTGATGATTTAAGG - Intergenic
988542376 5:32122243-32122265 AACTAATGCTTGATGATCTGAGG + Intergenic
989119750 5:37992397-37992419 AACTTAGCCTTCATGAGATCAGG + Intergenic
990344643 5:54859677-54859699 AAATCTGCCTTAATGAGCTCAGG + Intergenic
990465968 5:56071721-56071743 AAATCAGCCCTGAGGATCCCAGG - Intergenic
990661648 5:58022153-58022175 AACAGAGCCAAGATGATCTCTGG - Intergenic
991042615 5:62191562-62191584 AACTTAGCCTTCATAATCACGGG + Intergenic
991254210 5:64596728-64596750 AAAGCAGCCTTGAGGATCTGCGG - Intronic
991425026 5:66482053-66482075 TACTCAGCCATGTTGGTCTCAGG - Intergenic
993938896 5:94034967-94034989 AACTAACGCTTGATGATCTAAGG + Intronic
996900045 5:128534678-128534700 AAATCAGCTTTGAAAATCTCAGG - Intronic
997098159 5:130937360-130937382 AACTGATGCCTGATGATCTCAGG + Intergenic
997144227 5:131414604-131414626 AACTCAACCTCCATGATCTGAGG + Intergenic
997435745 5:133873743-133873765 CACTCAGCTTTCAAGATCTCTGG - Intergenic
997932760 5:138085737-138085759 AACTCAGCCTTCCAGGTCTCTGG - Intronic
1002353312 5:178601327-178601349 AACTCAGAGTAGCTGATCTCAGG - Intergenic
1002540067 5:179900787-179900809 AACTCAGCCTTCTTGCTCTTAGG + Intronic
1002540549 5:179903735-179903757 AACTCAGCCTTCTTGCTCTTAGG + Intronic
1004018420 6:11753880-11753902 AATTCAGCCCTGATGATAACAGG - Intronic
1004065802 6:12242661-12242683 ATCTCAGCCTTGCTGCTCCCTGG + Intergenic
1007182549 6:39940650-39940672 ACCTAATGCTTGATGATCTCAGG - Intergenic
1008008711 6:46440490-46440512 AACACATCCTTAATGATCACTGG + Intronic
1009466778 6:63980736-63980758 AACTCTGCCTAGATGGGCTCAGG + Intronic
1010040981 6:71383509-71383531 AACTAATGCTTGATGATCTGAGG - Intergenic
1011246177 6:85323528-85323550 ACATCAGACTTGATGATCTTTGG + Intergenic
1012753228 6:103190023-103190045 AACTAATGCTTGATGATCTGAGG + Intergenic
1013433439 6:110077232-110077254 CACTGAGCCATGATGATGTCAGG + Intergenic
1014314899 6:119851681-119851703 AAATCAGCCATGATCTTCTCAGG + Intergenic
1015230710 6:130912110-130912132 GACTAACGCTTGATGATCTCAGG + Intronic
1015846546 6:137525968-137525990 AACTCAGCCCCCATGATCCCAGG - Intergenic
1018028268 6:159822352-159822374 AACACAGCCTTGAAGAGCTAGGG - Intergenic
1018097001 6:160397184-160397206 AACTAATGCCTGATGATCTCAGG - Intronic
1021090136 7:16473426-16473448 AACTAATGCTTGATGATCTGAGG + Intronic
1021277361 7:18669655-18669677 AACTCATACTTTAGGATCTCTGG - Intronic
1022613966 7:31909544-31909566 ATCTCAGAATTGATAATCTCTGG - Intronic
1024850911 7:53716017-53716039 AAGGGAGCCTGGATGATCTCAGG - Intergenic
1026915211 7:74115943-74115965 CACTCACCGTTGATCATCTCAGG - Exonic
1029294874 7:99532379-99532401 AACTCAGCCTTTAGGAACACCGG + Exonic
1031684759 7:124719707-124719729 AATTCTGCCTTGATCAACTCAGG - Intergenic
1032097872 7:128948443-128948465 CTCTGAGCCTTGATGGTCTCTGG - Intronic
1033055083 7:138044754-138044776 AATTCTGCCCTGATGATCTTAGG + Intronic
1033275139 7:139966357-139966379 AACTCAGCCCAGATTGTCTCAGG + Intronic
1035476642 7:159148838-159148860 GCCTCAGCCTTGCTGATCTCTGG + Intergenic
1035618679 8:1021964-1021986 AACTTGGCCATGATGGTCTCAGG - Intergenic
1036270904 8:7301929-7301951 AATTCATCCTGGATGTTCTCAGG + Intergenic
1036350445 8:8008415-8008437 AATTCATCCTGGATGTTCTCAGG - Intergenic
1037158092 8:15730975-15730997 TACTCTACATTGATGATCTCTGG + Intronic
1037963183 8:23115120-23115142 CACTCAGCCTTCAGGTTCTCAGG + Intronic
1038142423 8:24860959-24860981 TACTCTGCATTGATGATTTCAGG - Intergenic
1038995646 8:32920075-32920097 AAATCAGCCCTGATGCTCTGTGG - Intergenic
1039585795 8:38706011-38706033 TCCTCAGCCTTGCTGACCTCAGG + Intergenic
1043794597 8:84520759-84520781 AACTAATGCTTGATGATCTGAGG + Intronic
1044300646 8:90579340-90579362 CACTTAGCCATGGTGATCTCAGG - Intergenic
1044519034 8:93176499-93176521 AACTAATGCCTGATGATCTCAGG + Intergenic
1045290695 8:100830224-100830246 AACTAATGCTTGATGATCTGAGG + Intergenic
1048435738 8:134415610-134415632 AACTCAGCCCACATGGTCTCCGG + Intergenic
1048494152 8:134921380-134921402 AACTTAGCCTTTATAATCTTGGG + Intergenic
1048774706 8:137932936-137932958 AAATTAACCTTGATGACCTCAGG - Intergenic
1048898604 8:139016718-139016740 AACACAACCTTGAGGATCACTGG + Intergenic
1051584091 9:18708538-18708560 AAATAAGCTTTGGTGATCTCTGG + Intronic
1052309131 9:27045254-27045276 ATCTAACCCCTGATGATCTCAGG + Intronic
1057182909 9:93039522-93039544 CACTGAGCCTTTATGACCTCAGG - Intergenic
1058869541 9:109190453-109190475 GACTCAGCCTGGATGAGCTATGG - Intronic
1059750322 9:117241517-117241539 AACTCATGCCTGATGATCTGAGG - Intronic
1060779650 9:126401997-126402019 AACTCAGCCTCCCTGATCTGTGG - Intronic
1187612318 X:20955732-20955754 ATGCCAGCCTTGAAGATCTCTGG + Intergenic
1189115175 X:38334984-38335006 AACTAATGCTTGATGATCTGAGG + Intronic
1189778332 X:44490274-44490296 AAGTGATCCTTGATGACCTCAGG - Intergenic
1192038186 X:67588480-67588502 AAAACAGGCTTGATGATCCCAGG - Intronic
1193037278 X:76965765-76965787 AACTAATACTTGATGATCTGAGG - Intergenic
1197985851 X:132265975-132265997 AACTAATGCCTGATGATCTCAGG + Intergenic
1199213833 X:145244936-145244958 AACTAATGCTTGATGATCTGAGG - Intergenic
1199448895 X:147957797-147957819 AACTCTCTCTTGATGTTCTCTGG - Intergenic
1199885185 X:152013898-152013920 CACTAAGCCTTGATGAATTCTGG - Intergenic