ID: 1119599646

View in Genome Browser
Species Human (GRCh38)
Location 14:75966926-75966948
Sequence CAGGTGTAGGAGAGGTCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 434}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119599637_1119599646 1 Left 1119599637 14:75966902-75966924 CCTGGGATAGCAGCCAGTTGTGG 0: 1
1: 0
2: 0
3: 10
4: 173
Right 1119599646 14:75966926-75966948 CAGGTGTAGGAGAGGTCATGGGG 0: 1
1: 0
2: 5
3: 43
4: 434

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119599646 Original CRISPR CAGGTGTAGGAGAGGTCATG GGG Intronic
900418578 1:2546067-2546089 CAGATGGAGGACAGGTCAGGTGG + Intergenic
900874938 1:5335449-5335471 CAGGTTAAGGTGAGGTCATCGGG - Intergenic
900945318 1:5828024-5828046 CAGGTGCTGGAGCGGTCACGAGG + Intergenic
901949390 1:12729902-12729924 AAGGTGAAGGAGAGCTGATGGGG - Intergenic
902422272 1:16290346-16290368 GAGGTTTAGATGAGGTCATGAGG + Intronic
903086818 1:20868476-20868498 TAGGTTTAGTTGAGGTCATGAGG - Intronic
904920770 1:34006324-34006346 CAGGTGTAGGTGGGGTCTTGGGG - Intronic
905004033 1:34695985-34696007 CAGAGGAAGGACAGGTCATGAGG + Intergenic
906208200 1:43998036-43998058 CAGGTGTGGGAGTGGGCGTGAGG + Intronic
906226953 1:44130194-44130216 CAGGTGAAGGAGGTGTCAGGTGG + Exonic
906641970 1:47446327-47446349 CAGGGGCCGGAGAGGTCGTGTGG - Intergenic
907831264 1:58066284-58066306 CAGGGGTAGGGGAAATCATGAGG + Intronic
909072585 1:71014551-71014573 TAGGTTTAGATGAGGTCATGAGG + Intronic
909253570 1:73389561-73389583 TAGGTTTAGATGAGGTCATGAGG - Intergenic
910036210 1:82792094-82792116 CAGCTGTAGGAGACGTCACAGGG - Intergenic
910166113 1:84329087-84329109 TAGGTTTAGATGAGGTCATGAGG + Intronic
911118396 1:94270597-94270619 CTGGTGTAGCTGTGGTCATGAGG - Intronic
911438476 1:97894282-97894304 TAGGGGTAGATGAGGTCATGAGG - Intronic
913266284 1:117048280-117048302 TAGGTTTAGATGAGGTCATGAGG - Intergenic
913464785 1:119128987-119129009 ATGGTGCAGGAGATGTCATGTGG + Intronic
913532939 1:119745804-119745826 TAAGTTTGGGAGAGGTCATGTGG - Intergenic
915038713 1:152949677-152949699 CAGGTGCAGGAGAAGGCACGGGG + Intergenic
917435120 1:175013189-175013211 CAGGTGGAGGTGAAGTTATGAGG - Exonic
918629126 1:186694675-186694697 CAGGTGTTGAAGTGGTCCTGTGG + Intergenic
919409503 1:197226588-197226610 TAGGTTTAGATGAGGTCATGAGG + Intergenic
920086820 1:203423466-203423488 CAGTTGATGGAGAGGCCATGGGG + Intergenic
920167057 1:204043532-204043554 TAGGTTTAGATGAGGTCATGAGG - Intergenic
920794606 1:209126752-209126774 TAGGTTTAGGTGAGGTCATCAGG + Intergenic
920799560 1:209173926-209173948 CAGGTGGAGCTGAAGTCATGGGG - Intergenic
921306288 1:213800064-213800086 TAGGTTTAGAGGAGGTCATGAGG - Intergenic
922717575 1:227885292-227885314 CAGGTGCAGCAGAGGGCAGGCGG + Intergenic
923181592 1:231525655-231525677 CTGGGGTAGAAGAGATCATGGGG - Intergenic
1063107217 10:3002932-3002954 GAGGTGTTGGTGAGGACATGGGG + Intergenic
1063520778 10:6738721-6738743 CTGGGGTAGGAGAGGGTATGGGG + Intergenic
1064347876 10:14548939-14548961 TAGGTTTAGATGAGGTCATGAGG + Intronic
1065171526 10:23035258-23035280 TAGGTTTAGATGAGGTCATGAGG - Intronic
1065620490 10:27576145-27576167 CAGAGGTAGGAGAGGTGATGTGG - Intergenic
1068183524 10:53554590-53554612 CAGGTCTAGGTGAAGTCGTGAGG + Intergenic
1070323523 10:75372762-75372784 CAGGTTTGGGAGAGTTCAGGGGG + Intergenic
1070658928 10:78290967-78290989 CAGGTGTGGAAGAGATGATGGGG - Intergenic
1070773862 10:79098768-79098790 CAGGTGGAGGAGGTGGCATGCGG + Intronic
1071689894 10:87805912-87805934 AAGGAGAAGAAGAGGTCATGAGG - Intronic
1071987667 10:91068831-91068853 CATGTGTAGGTGAGACCATGTGG - Intergenic
1073452431 10:103617766-103617788 CAGGGATAGGAGAGTTCATCTGG - Intronic
1074336079 10:112577198-112577220 CAGGTTTAGATGAGGTCATGAGG - Intronic
1074671918 10:115800714-115800736 TAGGTTTAGATGAGGTCATGAGG + Intronic
1075314601 10:121442522-121442544 TAGGTTTAGATGAGGTCATGAGG + Intergenic
1076619652 10:131779044-131779066 CAAGTGGAGCAGAGGTCAGGAGG - Intergenic
1076657697 10:132035942-132035964 CAGGTGCAGGAGGAGTCCTGGGG - Intergenic
1077015988 11:399400-399422 CAGGTGGAGGAGGGGGCAGGTGG - Intronic
1077819055 11:5718037-5718059 CACATGTAAGTGAGGTCATGTGG + Intronic
1077982758 11:7317552-7317574 CAGGTTTACATGAGGTCATGAGG - Intronic
1078462147 11:11522187-11522209 CAGAATGAGGAGAGGTCATGTGG - Intronic
1078837488 11:15045068-15045090 TGGGTTTAGGTGAGGTCATGAGG - Intronic
1082731916 11:56808769-56808791 CACGTGTAAGTGAGATCATGTGG - Intergenic
1083922740 11:65789273-65789295 CAGGTGCAGGAGAGGGCCTCTGG + Intronic
1084600536 11:70142905-70142927 CGGGTTTAGCTGAGGTCATGAGG - Intronic
1084725872 11:70941577-70941599 TAGGTTTAGGTGAGGTCATGAGG + Intronic
1085063011 11:73465661-73465683 TAGGTTTAGATGAGGTCATGAGG - Intronic
1085949735 11:81315464-81315486 TAGGTTTAGATGAGGTCATGAGG - Intergenic
1085959933 11:81449755-81449777 TAGGTTTAGATGAGGTCATGAGG + Intergenic
1086432275 11:86747424-86747446 CAGTTGTAGGAGAGACCCTGGGG + Intergenic
1089178377 11:116564251-116564273 CAGGGGCAGGAGAGATGATGGGG - Intergenic
1089182188 11:116590639-116590661 AAGGAGTAAGAGAGGTCATGGGG - Intergenic
1089640904 11:119846629-119846651 TAGGTTTAGATGAGGTCATGAGG - Intergenic
1089803374 11:121058141-121058163 CAGAGGTAGGAGAGGCTATGGGG + Intronic
1090153215 11:124407045-124407067 CAAATGGAGAAGAGGTCATGAGG - Intergenic
1090480883 11:127067185-127067207 CAGGTGTCTGAGAGGTCACAGGG + Intergenic
1090593203 11:128293838-128293860 CAGGGGTTGGGGAGGTAATGAGG - Intergenic
1090648043 11:128781886-128781908 CAAGAGTAGGAGATGACATGAGG - Intronic
1090960610 11:131553165-131553187 AAGGGGCAGGAGAGGCCATGAGG + Intronic
1091715935 12:2776216-2776238 CAGATGTAGAACAGCTCATGTGG - Intergenic
1091856686 12:3746279-3746301 TAGGTTTAGATGAGGTCATGAGG + Intronic
1092349577 12:7745186-7745208 CAGGTTTAGATGAGGTTATGAGG + Intronic
1092497207 12:9008719-9008741 TAGGTGTAGATGAGGCCATGAGG - Intronic
1092503287 12:9068664-9068686 CAGGTTTAGGAGATGTGTTGGGG - Intronic
1092894754 12:13000855-13000877 ATGGTCTAGAAGAGGTCATGGGG - Intergenic
1094027641 12:25975815-25975837 AAGGTGGATGAGAGGTGATGGGG + Intronic
1094145764 12:27226840-27226862 CAGGAATAGGACAGGCCATGGGG + Intergenic
1094497637 12:30998440-30998462 CATGGGAAGGAGAGGACATGGGG + Intergenic
1094808913 12:34118841-34118863 CAGGTGCAAGATGGGTCATGGGG - Intergenic
1097439051 12:59587132-59587154 TAGGTTTAGATGAGGTCATGAGG + Intergenic
1097659350 12:62411910-62411932 TAGGTTTAGATGAGGTCATGAGG - Intronic
1098525511 12:71482417-71482439 CAGGTGGAGGGAAGGCCATGTGG - Intronic
1099847367 12:88044781-88044803 CAGGAAGAGGAGAGGGCATGGGG + Intronic
1099926982 12:89030461-89030483 TAGGTTTAGTTGAGGTCATGAGG + Intergenic
1100802132 12:98243053-98243075 TAGGTGTAGAGGAGGTCATGAGG - Intergenic
1100959480 12:99946515-99946537 TAGGTTTAGATGAGGTCATGAGG - Intronic
1101400701 12:104384250-104384272 TAGGTTTAGACGAGGTCATGAGG + Intergenic
1102027648 12:109722680-109722702 AAGGTCTAGGAGGGGTCCTGGGG - Intronic
1102057942 12:109910793-109910815 CAGGTGTATCCGAGGGCATGTGG + Intronic
1102454995 12:113065651-113065673 CTGGAGTAGGGGAGGTGATGCGG + Intronic
1102889760 12:116549350-116549372 CAAGTGAAGATGAGGTCATGAGG - Intergenic
1104738688 12:131156685-131156707 CACATGTAAGTGAGGTCATGTGG - Intergenic
1104797391 12:131529164-131529186 CAGGAGGAGGTGAAGTCATGGGG - Intergenic
1104883564 12:132089481-132089503 CACGTGTAAGTGAGATCATGTGG + Intronic
1105694354 13:22873076-22873098 TAGGTTTAGGCGAGGTCATGAGG + Intergenic
1105767345 13:23574939-23574961 AAGGGGAAGGAGAAGTCATGTGG + Intronic
1107483439 13:40804249-40804271 CAGGTGTAGATGAGGTCATGAGG - Intronic
1107696199 13:43002578-43002600 TAGGTTTAGATGAGGTCATGAGG + Intergenic
1108109344 13:47051344-47051366 CAAGTGTAGGTGAAGTCATGAGG - Intergenic
1108137072 13:47376413-47376435 CAGGTATAGGTGAGGGCATATGG + Intergenic
1108956286 13:56162421-56162443 CACATGTAAGAGAGGTCTTGTGG - Intergenic
1110184450 13:72656876-72656898 CAGCTGTAGGTGGGGTCATGCGG + Intergenic
1110599549 13:77356709-77356731 CAGGTTTAGGTGAGGTCATGAGG + Intergenic
1112423230 13:99272724-99272746 TAGGTTTAGGTGAGGTCATGAGG - Intronic
1112426770 13:99309437-99309459 CAGATGAAGAAGAGGTGATGGGG + Intronic
1113661274 13:112107854-112107876 CGGGTGCAGGAGAGGCCTTGGGG - Intergenic
1113810282 13:113137351-113137373 CAGGTGGGGGAGATGGCATGGGG + Intronic
1114652516 14:24294898-24294920 CTGGTGTGGTAGAGGACATGGGG + Intronic
1115200860 14:30852895-30852917 CAGGTGTAGCAGATGCCACGTGG + Intergenic
1115791401 14:36882963-36882985 TAGGAGAAGTAGAGGTCATGAGG - Intronic
1116995213 14:51316365-51316387 TAGGGGTAGATGAGGTCATGAGG + Intergenic
1117103929 14:52379847-52379869 TAGGTTTAGGTGAGGTCATGAGG - Intergenic
1117436805 14:55722957-55722979 GAGGTGTAGAAGAGGTTCTGGGG + Intergenic
1117567722 14:57012524-57012546 CAAGTGTTGAAGAGGACATGGGG - Intergenic
1118459823 14:65977527-65977549 CAGGTAGAGCTGAGGTCATGAGG + Intronic
1118886829 14:69874352-69874374 AAGGATTAGGTGAGGTCATGAGG - Intronic
1118890442 14:69903938-69903960 CTGGAGGAGGAGAGGTCACGTGG + Intronic
1119599646 14:75966926-75966948 CAGGTGTAGGAGAGGTCATGGGG + Intronic
1120772578 14:88397259-88397281 CAAGTGTTGGGGAGGACATGGGG - Intronic
1121431554 14:93891720-93891742 CAGGTGAAGGAGAGGAGAGGGGG - Intergenic
1122059910 14:99130126-99130148 CAGGGGAAGGAGAGGGCGTGGGG - Intergenic
1122661844 14:103301309-103301331 TCGGTGTATGAGTGGTCATGGGG + Intergenic
1125078037 15:35643094-35643116 CAGGTGCTGGAGAGGTTGTGAGG + Intergenic
1125141409 15:36412232-36412254 TAGGTTTAGATGAGGTCATGAGG + Intergenic
1125461892 15:39915376-39915398 TAGGTTTAGATGAGGTCATGAGG - Intronic
1126624904 15:50677275-50677297 CAGGGGTAGATGAGGTCATGAGG - Intronic
1127811449 15:62568768-62568790 CAGCTGCAGGAGAGCTCAGGAGG - Intronic
1128877132 15:71211538-71211560 TAGGTTTAGATGAGGTCATGAGG - Intronic
1129018443 15:72490724-72490746 CAGGGATAGGAGTGGTTATGTGG + Intronic
1129451049 15:75651581-75651603 CAGGAGTTGGATAGGCCATGTGG - Intronic
1130378261 15:83349815-83349837 TAGGTTTAGATGAGGTCATGAGG - Intergenic
1130387918 15:83428385-83428407 TAGGTTTAGGTGAGTTCATGAGG + Intergenic
1130775590 15:86978623-86978645 CAGGTGAAGGAGTGAACATGTGG + Intronic
1132058163 15:98668208-98668230 CAGGTTTAGATGAGGTCCTGAGG - Intronic
1132152427 15:99472288-99472310 CAGGTTTAGGCAAGGTCTTGAGG - Intergenic
1132194422 15:99900920-99900942 CACGTGTAAGTGAGATCATGTGG - Intergenic
1132202094 15:99962117-99962139 CAGCTGTGTGAGGGGTCATGTGG + Intergenic
1132331718 15:101016528-101016550 TAGGTTTAGATGAGGTCATGAGG - Intronic
1132548346 16:543901-543923 CATGTGGGGGAGCGGTCATGGGG - Intronic
1133592479 16:7259158-7259180 ATGGTGGAGGAGAGGTCATGTGG - Intronic
1133813116 16:9176740-9176762 GAGGTTTAGCTGAGGTCATGGGG - Intergenic
1135060926 16:19270764-19270786 CAGGTTGAAGTGAGGTCATGAGG + Intergenic
1135807074 16:25552486-25552508 TAGGTGTAGATGAGGTCGTGAGG + Intergenic
1137347440 16:47677619-47677641 CAGGTTTAGATGAGGTCATGAGG - Intronic
1138506638 16:57481442-57481464 CAGGTGTAGCAGAGCTGTTGGGG - Intronic
1139140117 16:64251939-64251961 CTGGAGAATGAGAGGTCATGTGG - Intergenic
1139646815 16:68337663-68337685 CAGGTGTATCAGAGGTGCTGAGG - Intronic
1140137950 16:72224581-72224603 CAGGTGTGACAAAGGTCATGTGG - Intergenic
1140923960 16:79565312-79565334 CAGCTGCAGCAGAGATCATGTGG + Intergenic
1141188238 16:81804191-81804213 CATGTGTTGGCGAGGACATGGGG - Intronic
1141328111 16:83081778-83081800 TAGGTTTAGATGAGGTCATGAGG - Intronic
1143395215 17:6589189-6589211 TAGGTTTAGATGAGGTCATGAGG + Intronic
1144010828 17:11147032-11147054 TAGGTTTAGAAGAGGTCATGAGG - Intergenic
1144057470 17:11555781-11555803 CGGGAGAAGGAGAGGTCATAGGG - Exonic
1144408447 17:14975426-14975448 AAGGTGTAGTTGAGTTCATGGGG - Intergenic
1144956503 17:19021387-19021409 CAGGTGGAGCTGAAGTCATGGGG + Exonic
1145266702 17:21383134-21383156 CGGGGGCAGGAGAGGTCAAGGGG + Intronic
1147699373 17:42383025-42383047 CAGAGGAAGGAGAGGTTATGAGG - Intronic
1147721033 17:42539474-42539496 CAGGTGCAAAGGAGGTCATGCGG - Intronic
1148214148 17:45825323-45825345 CAGGTGTAGGGGTGGTGCTGGGG - Intronic
1148990408 17:51661182-51661204 CAGGTATAGGAGATGTCACAGGG - Intronic
1151307743 17:73274221-73274243 TAGGTTTAGGTGAGGTCCTGAGG - Intergenic
1152035482 17:77869693-77869715 GAGGTGGAGGAGAGGTTAAGGGG - Intergenic
1152117784 17:78399253-78399275 CAGGTGAAGGCGAGGCCACGTGG + Intronic
1154071593 18:11157377-11157399 CAGGAGTAAGAAAGGGCATGAGG + Intergenic
1154284788 18:13043047-13043069 CAGGTGCTGGCGAGGACATGCGG - Intronic
1155959913 18:31985537-31985559 TAGGTTTGGAAGAGGTCATGAGG + Intergenic
1156733431 18:40223723-40223745 CAGGAGTCAGAGAGGTCTTGAGG + Intergenic
1157409815 18:47454278-47454300 TAGGGTTAGAAGAGGTCATGAGG + Intergenic
1157413123 18:47480353-47480375 TAGGTGGAGGGGAGGTGATGGGG + Intergenic
1157550991 18:48581900-48581922 CAGGGGAAGGGGAGGTCATATGG + Intronic
1157641944 18:49224548-49224570 TAGGATTAGGTGAGGTCATGAGG + Intronic
1157685949 18:49642634-49642656 CACATATAAGAGAGGTCATGCGG + Intergenic
1157869973 18:51221040-51221062 TAGATTTAGAAGAGGTCATGAGG - Intergenic
1157989589 18:52478697-52478719 CAGGAGCAGGAGAGATCATCAGG + Intronic
1158567041 18:58562916-58562938 CGGGTTTAGATGAGGTCATGAGG - Intronic
1158886844 18:61836422-61836444 TAGGTTTAGATGAGGTCATGAGG + Intronic
1159713051 18:71787163-71787185 GATGTGTAGCAGAGGTCAAGTGG + Intronic
1160308652 18:77767358-77767380 CAGGTATAGGAGTAGTTATGAGG - Intergenic
1160754495 19:750600-750622 CAGGGCTAAGAGAGGTCAGGTGG + Intergenic
1163242744 19:16074494-16074516 GAGGTTTGGGTGAGGTCATGAGG - Intronic
1165019152 19:32908833-32908855 CAGGCAAAGGTGAGGTCATGAGG + Intronic
1165075136 19:33276240-33276262 CAGGGGGTGGAGAGGCCATGAGG - Intergenic
1202647180 1_KI270706v1_random:153102-153124 CAGGTGGAGGAGTGGTCAGGAGG - Intergenic
925186114 2:1847540-1847562 CAGGTGAAGGAGAAGGCCTGGGG + Intronic
925685178 2:6463888-6463910 CAGAAGTATGAGAGGTCAAGTGG - Intergenic
925780940 2:7381199-7381221 CAGAAGTAAGAGAGGTCTTGGGG + Intergenic
925853999 2:8111859-8111881 CAGGTGTAGATGAAATCATGAGG - Intergenic
925935665 2:8756752-8756774 TAGGTTTAGATGAGGTCATGAGG - Intronic
926584834 2:14674527-14674549 CAGGTGAAGATGAGGTCATTAGG + Intergenic
926719319 2:15947619-15947641 CAGGTGCAGGAGAGACCCTGGGG + Intergenic
927256244 2:21043452-21043474 CGGGTGTAGGAGAGTGCACGGGG + Intronic
928624423 2:33125168-33125190 CAAGTGTAGGAGAGGCATTGGGG + Intronic
929080011 2:38113173-38113195 CATGGGTAGGAAAGGGCATGGGG - Intergenic
929996420 2:46828907-46828929 TAGGTTTAGATGAGGTCATGAGG + Intronic
933291641 2:80444639-80444661 AAGGTTTAGATGAGGTCATGAGG + Intronic
933406385 2:81865391-81865413 TAGGTTTAGATGAGGTCATGAGG - Intergenic
934165218 2:89288195-89288217 CAGGTGAAGGGGAGGACCTGGGG + Intergenic
934202055 2:89894267-89894289 CAGGTGAAGGGGAGGACCTGGGG - Intergenic
934790874 2:97059062-97059084 CAGGGGAGGGAGAGGTCCTGGGG - Intergenic
935121474 2:100186848-100186870 CAGATGTAGGAAAGGTCAGAGGG - Intergenic
935144441 2:100385471-100385493 TAGGTTTAGATGAGGTCATGAGG + Intergenic
935281595 2:101522512-101522534 TAGGTTTAGATGAGGTCATGAGG - Intergenic
936010242 2:108920891-108920913 CCGGGGCAGGAGAGGACATGAGG + Intronic
936237431 2:110755177-110755199 CAGCTGTTGGAGATGTGATGAGG - Intronic
938006551 2:127791572-127791594 TAGGTTTAGCTGAGGTCATGAGG - Intronic
938079361 2:128361372-128361394 TAGGCTTAGGGGAGGTCATGAGG + Intergenic
938316607 2:130333660-130333682 CAGGAGAAGGAGAGGACACGTGG + Intergenic
939610680 2:144306541-144306563 TAAGTTTAGGTGAGGTCATGAGG - Intronic
939867237 2:147486348-147486370 CGGGTGGAAGAGAGGGCATGCGG - Intergenic
940254615 2:151715496-151715518 TAAGTTTAGGTGAGGTCATGAGG + Intronic
940628717 2:156210086-156210108 CAGATGTCGGTGAGGTCCTGAGG - Intergenic
941568308 2:167137189-167137211 CAGGTGTAGGAACAGTCAAGGGG + Intronic
941728827 2:168893054-168893076 CAGGAGCAAGAGAGGTCAGGAGG + Intronic
942831769 2:180244881-180244903 CAGATTTAGGAGTGGGCATGTGG + Intergenic
944884516 2:204048976-204048998 CAGAAGTAGGAGGGGTCATCTGG + Intergenic
944944701 2:204670241-204670263 CAGCTGCAACAGAGGTCATGTGG - Intronic
945557885 2:211301651-211301673 CAGCTGTAGGAGAGGTTGGGAGG + Intergenic
945935980 2:215903142-215903164 AAGGGGGAGGAGAGGTCATGAGG - Intergenic
946580038 2:221118477-221118499 TAGGTGTAGAAAAGGTCATATGG - Intergenic
948050337 2:234975126-234975148 CAGTTGTTGGAGAGCTCCTGGGG + Intronic
948873716 2:240816818-240816840 AAGGAGCAGGAGAGGTCAGGAGG + Intronic
948882133 2:240864557-240864579 CAGCTGTGGGAGAGGCTATGAGG - Intergenic
1169029436 20:2396378-2396400 CTGGGGCAGGAGAGGTCAAGAGG - Intronic
1169284808 20:4299041-4299063 CAGGTGTAGTTGAGCTCATGGGG + Intergenic
1169531987 20:6495276-6495298 AAAGTGTAGGAGAGGACATTTGG + Intergenic
1170109722 20:12791716-12791738 CAGGAGTAGAAGAGATAATGAGG + Intergenic
1170601397 20:17844053-17844075 CAGGAGTAGGAGGAGCCATGAGG - Intergenic
1170828560 20:19819366-19819388 TAGGTTTAGATGAGGTCATGAGG - Intergenic
1172610085 20:36244270-36244292 CTGGTGGAGGAGAGATGATGGGG - Intronic
1173059604 20:39648682-39648704 CACTTGTAAGTGAGGTCATGTGG - Intergenic
1173171736 20:40731271-40731293 CAGGAGAAGGTGAGGTCAGGAGG + Intergenic
1173485870 20:43440649-43440671 TAGGTGTAGCAGAGACCATGTGG + Intergenic
1173571034 20:44076247-44076269 CAGGTTGAGAAGAGGTCACGAGG + Intergenic
1173941779 20:46917078-46917100 CATGTGCAGGAGTGGTCAGGTGG + Intronic
1174949523 20:55028971-55028993 CAGTGGTGGGAGTGGTCATGTGG + Intergenic
1175264123 20:57692358-57692380 CAGGTGTGGGAAGAGTCATGGGG + Intronic
1176064434 20:63187387-63187409 CAGGAGCAGGCGAGGGCATGGGG - Intergenic
1176346200 21:5750277-5750299 TAGGTGCAAGACAGGTCATGAGG - Intergenic
1176353014 21:5870861-5870883 TAGGTGCAAGACAGGTCATGAGG - Intergenic
1176498627 21:7574178-7574200 TAGGTGCAAGACAGGTCATGAGG + Intergenic
1176540521 21:8148347-8148369 TAGGTGCAAGACAGGTCATGAGG - Intergenic
1176559472 21:8331392-8331414 TAGGTGCAAGACAGGTCATGAGG - Intergenic
1176604689 21:8819672-8819694 CAGGTGGAGGAGTGGTCGGGAGG + Intergenic
1176720910 21:10391861-10391883 GAGGTTTAGATGAGGTCATGAGG - Intergenic
1176869704 21:14075040-14075062 CTGTTGTAGCAGAGGGCATGGGG + Intergenic
1177207015 21:18021976-18021998 TAGGTTTAGGGGAGGTCATGAGG + Intronic
1178389663 21:32187918-32187940 TAGGTTTAGATGAGGTCATGAGG + Intergenic
1178418454 21:32423654-32423676 CAGGTGTCGGAGAGAACATAAGG - Intronic
1179437646 21:41373420-41373442 CAGGGGTGGGAGCGGTCATTAGG + Intronic
1179724681 21:43335511-43335533 CTGGGGTAGGAGAGGGCAGGAGG + Intergenic
1179878645 21:44284367-44284389 CAGGTGCTGGGGACGTCATGGGG - Intergenic
1179955532 21:44736198-44736220 CAAGTGCAGGTGAGGTCATTGGG - Intergenic
1180302098 22:11044651-11044673 GAGGTTTAGATGAGGTCATGAGG - Intergenic
1180346979 22:11711277-11711299 CAGGTGGAGGAGTGGTCGGGAGG + Intergenic
1180354725 22:11829367-11829389 CAGGTGGAGGAGTGGTCGGGAGG + Intergenic
1180383527 22:12162965-12162987 CAGGTGGAGGAGTGGTCGGGAGG - Intergenic
1180588335 22:16913979-16914001 CAGGAGGAGGAGAATTCATGGGG - Intergenic
1181494430 22:23280058-23280080 TAGGTGTAGATGAGGTCATGCGG - Intronic
1181532675 22:23525861-23525883 CAGGTTAAGGTGAGGTCATTGGG - Intergenic
1182119750 22:27779084-27779106 GAGGTGTAGGAGGGGTGATGAGG - Intronic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1183030290 22:35098850-35098872 AAGGTGCGGGAGGGGTCATGTGG - Intergenic
1183587126 22:38759321-38759343 CAGGAGTAGGAGAGGCCTTGGGG - Intronic
1183747167 22:39698590-39698612 GAGGTGAAGGGGAGGTGATGGGG - Intergenic
1183747237 22:39698818-39698840 AAGGTGAAGGGGAGGTGATGGGG - Intergenic
1183948740 22:41340961-41340983 CAGGAGTAGGAGAGGATGTGTGG + Intronic
1184743294 22:46441694-46441716 TAGGTTTAGATGAGGTCATGGGG - Intronic
1184885452 22:47342306-47342328 CAGGTGGGGGAGAGGTCATGTGG + Intergenic
1185408571 22:50671464-50671486 AAGGTCTGGGAGAGCTCATGTGG - Intergenic
1203245463 22_KI270733v1_random:64765-64787 TAGGTGCAAGACAGGTCATGAGG - Intergenic
949185814 3:1190249-1190271 TAGGTTTAGATGAGGTCATGAGG - Intronic
949705857 3:6815919-6815941 CATGTTTAGGAGAGGTCAGAAGG + Intronic
950494951 3:13328229-13328251 CAGCTGAGGGAGTGGTCATGAGG - Intronic
950884871 3:16354358-16354380 CAGATGGAGGAGAGATCTTGTGG - Intronic
952378911 3:32789364-32789386 CAGGTGTAGGAGTGGATAAGAGG + Intergenic
953288099 3:41632933-41632955 CAGGTGGAGGAAAGTGCATGAGG + Intronic
954154088 3:48675174-48675196 CATGTGCAGGAGATGTCAAGTGG - Intronic
955396313 3:58560169-58560191 CAGGGTTAGTTGAGGTCATGAGG + Intergenic
955658313 3:61268794-61268816 TAGGTGTAGATGAGGTCATGAGG + Intergenic
956901178 3:73717517-73717539 CAGGAGTAGGATTGGTGATGTGG - Intergenic
957588858 3:82169605-82169627 CAAGTGTAAGTGAGATCATGTGG - Intergenic
957790743 3:84937654-84937676 CATGACTAGGGGAGGTCATGAGG + Intergenic
958582301 3:96042716-96042738 TAGGTTTAGATGAGGTCATGAGG - Intergenic
958964464 3:100543491-100543513 CAAGTGTTGGTGAGGGCATGAGG - Intronic
959860282 3:111208210-111208232 CAGGTGTACGAGAAGTGAGGGGG - Intronic
960128302 3:114024934-114024956 CAGGAATAGGATTGGTCATGGGG - Intronic
960352337 3:116608396-116608418 TAGGTTTAGAAGAAGTCATGAGG + Intronic
960529115 3:118743373-118743395 CAGTAATAGGAGAGGTAATGAGG - Intergenic
961389946 3:126546472-126546494 CAGGTTGAGATGAGGTCATGAGG + Intronic
961448005 3:126990092-126990114 CAGGTGTAGGACCAGGCATGTGG - Intronic
961469927 3:127105245-127105267 AAGGTGGAGGAGAGTTCAAGGGG + Intergenic
961640408 3:128361256-128361278 CAGGTGTTGAAGAGGCCAGGTGG + Intronic
962346279 3:134620961-134620983 AAGCTGGAGGAGAGGTCCTGAGG + Intronic
962528717 3:136258770-136258792 AAGGTGAAGGAGAGGCCCTGTGG + Intronic
963178289 3:142324735-142324757 CAGGTGCTGGAGAGGATATGGGG - Intronic
963994002 3:151685401-151685423 CAGGTGTAGGGCAAGGCATGGGG - Intergenic
965568658 3:170149217-170149239 CAGGTGTAGGAGAAGTGGAGAGG + Exonic
965634735 3:170769552-170769574 CAGGTCTAGGGGAGGGCAGGAGG + Intronic
965908457 3:173740522-173740544 CAGGGGTATGGGAGGGCATGAGG - Intronic
967834195 3:193947138-193947160 CAGGTGTAGGAGAGAAGAGGAGG - Intergenic
968990504 4:3908243-3908265 CAGGTGTGGGACATGGCATGTGG + Intergenic
969120986 4:4911019-4911041 TAGGTTTAGATGAGGTCATGAGG - Intergenic
969192774 4:5535698-5535720 TAGGTTTAGATGAGGTCATGAGG - Intergenic
969410075 4:7022244-7022266 CAGGGGCTGGAGAGGCCATGGGG + Intronic
969681035 4:8643633-8643655 CAGGTATAGATGAGGTCGTGAGG + Intergenic
970227065 4:13870343-13870365 CAGGTTTAGATGAGGTCATGAGG - Intergenic
970568149 4:17352545-17352567 CAGGTTTAGATGACGTCATGAGG + Intergenic
970786701 4:19805668-19805690 CAGGGTTAGGTGAGCTCATGAGG - Intergenic
971228690 4:24779412-24779434 TAGGTTTAGATGAGGTCATGAGG + Intergenic
972308473 4:37855273-37855295 CACATGTAGGTGAGATCATGCGG + Intronic
972429065 4:38963304-38963326 CAGGTGTATGAGAGTTCATTGGG - Intergenic
973373436 4:49271265-49271287 CAGGTGGAGGAGTGGTCGGGAGG - Intergenic
973387576 4:49523943-49523965 CAGGTGGAGGAGTGGTCGGGAGG + Intergenic
976330566 4:83826439-83826461 TAGGTTTAGATGAGGTCATGAGG - Intergenic
976723297 4:88191455-88191477 CAGGTGTTGGCGAGATGATGTGG + Intronic
976883385 4:89957819-89957841 TAGGTTTAGATGAGGTCATGAGG - Intergenic
977991044 4:103442797-103442819 TAGGTGTAGATGAGGTCATGAGG - Intergenic
978847693 4:113293109-113293131 CAGGTTTTGGAGACGTCATGAGG + Intronic
979970374 4:127127492-127127514 TAGGTTTAGATGAGGTCATGGGG + Intergenic
980876863 4:138670416-138670438 CAGGGGAAGGAGTGGTCCTGGGG - Intergenic
981190083 4:141852217-141852239 TAGGTTTAGATGAGGTCATGAGG - Intergenic
981337063 4:143580415-143580437 CAGTGGTAGGGGTGGTCATGGGG - Intronic
981871427 4:149491488-149491510 CACATGTAGGTGAGATCATGTGG + Intergenic
982070177 4:151687656-151687678 GAGGTCTAGAAGAGGTCACGAGG + Intronic
983307338 4:166007865-166007887 CAGGTGTAGGAAAGGCCTTCTGG + Intronic
983557744 4:169073601-169073623 CAGGTCTAGGACAGGTTCTGAGG - Intergenic
985295449 4:188432695-188432717 CAGGTGGAGAAGAGCTCATAGGG + Intergenic
985784831 5:1887996-1888018 CAGGGTTAGGGGAGGGCATGGGG + Intergenic
986482727 5:8204953-8204975 TAGGTTTAGATGAGGTCATGAGG + Intergenic
986757271 5:10849854-10849876 TAGGTTTAGATGAGGTCATGAGG - Intergenic
986856152 5:11871008-11871030 TAGGTTTAGGTAAGGTCATGAGG + Intronic
986980987 5:13447895-13447917 TAGGTTTAGATGAGGTCATGAGG + Intergenic
987256967 5:16165000-16165022 GAAGCGTAGGAGATGTCATGAGG - Intronic
988187360 5:27884533-27884555 CAGGTGTTGGAGAGGATGTGGGG - Intergenic
988895915 5:35674703-35674725 CAGGTTTAGATGAGGTCATGAGG - Intronic
989070734 5:37508223-37508245 TAGGTTTAGGTGAGGTCATGAGG + Intronic
989398859 5:40987560-40987582 TAGGTATAGATGAGGTCATGAGG - Intergenic
989664844 5:43842039-43842061 TAGGTTTAGGTGAGGTCTTGAGG - Intergenic
990283803 5:54279525-54279547 TAGGTTTAGATGAGGTCATGAGG - Intronic
991540853 5:67726585-67726607 AAGGAGAAAGAGAGGTCATGAGG + Intergenic
992107333 5:73460765-73460787 CAGGTGGAGGTGAGGTCATCAGG - Intergenic
993351610 5:86856917-86856939 TAGGTTTAGATGAGGTCATGAGG - Intergenic
993358720 5:86946701-86946723 CAGGTTTAGGTGAGGTGATGAGG - Intergenic
994077079 5:95665454-95665476 CACGTGTGGGTGAGATCATGTGG + Intronic
994254386 5:97576139-97576161 TAGGTTTAGATGAGGTCATGAGG + Intergenic
995356009 5:111238352-111238374 TAGGTTTAGGTGAGGTGATGAGG + Intronic
995536152 5:113138386-113138408 TAGGTTTAGATGAGGTCATGAGG + Intronic
996428936 5:123348776-123348798 CAGGTTTAGATGAGGTCATGAGG + Intronic
996439286 5:123471687-123471709 TAGGTTTAGGTGAGGCCATGAGG - Intergenic
997360499 5:133291756-133291778 CAGGTGTAGGGGAGGTGGGGAGG + Intronic
997489465 5:134261395-134261417 CAAGTGTTGGTGAGGACATGGGG - Intergenic
997587874 5:135054490-135054512 GAGATGTAGGAGAGGTCTTTGGG + Intronic
997854477 5:137361027-137361049 TAGGTTTAGATGAGGTCATGAGG + Intronic
998051275 5:139038087-139038109 TAGATTTAGGTGAGGTCATGAGG - Intronic
998787948 5:145732821-145732843 CAGGGGTAGGAGTGGAAATGGGG + Intronic
999178720 5:149653378-149653400 CAGGTGGAGGAGAGTAAATGAGG - Intergenic
999580404 5:153032049-153032071 CAGGTTTAGATGATGTCATGAGG + Intergenic
999633196 5:153592955-153592977 CAGATTTAGAAGAGGTCACGAGG - Intronic
1000089189 5:157915471-157915493 CAGGAGTTGGAGAGGAAATGGGG - Intergenic
1000105404 5:158054402-158054424 CTGGTCTAGGAGAGGTCAGGAGG - Intergenic
1000354916 5:160385167-160385189 TAGGGTTAGGTGAGGTCATGAGG - Intergenic
1000954905 5:167531699-167531721 CACGTGTAAGTGAGATCATGTGG + Intronic
1002410223 5:179068909-179068931 CATGCGCAGGAGAGGCCATGTGG - Intronic
1003596161 6:7475994-7476016 CAGGTGAAGGAGAGATATTGGGG + Intergenic
1003903179 6:10674210-10674232 TAGGATTAGGTGAGGTCATGAGG - Intronic
1003973599 6:11322444-11322466 CAGAGGCAGGAGAGGTCAAGGGG + Intronic
1003977435 6:11357260-11357282 CAGGGGTTGGAGTGGTCATTTGG - Intronic
1004782806 6:18930725-18930747 TAGGGTTAGAAGAGGTCATGAGG - Intergenic
1006238145 6:32653904-32653926 CACATGTAAGTGAGGTCATGTGG - Intergenic
1007817966 6:44538181-44538203 CAGGTGTACGATATGTGATGTGG + Intergenic
1009521125 6:64683006-64683028 CATGTATAGGAGAGAGCATGAGG + Intronic
1009585135 6:65591121-65591143 CAAATGTTGGAGAGGCCATGTGG - Intronic
1010385091 6:75270435-75270457 CAGATTTAGGTGAGGTCATGAGG + Intronic
1011558534 6:88592539-88592561 CAGGAGTAAGCCAGGTCATGGGG + Intergenic
1011746920 6:90415196-90415218 CAGGTAAAGGGGAGGGCATGTGG - Intergenic
1011749220 6:90438614-90438636 GAGGTGTTGGAGAGGGGATGAGG + Intergenic
1012623607 6:101378992-101379014 TAGGTTTAGATGAGGTCATGAGG - Intergenic
1014479710 6:121920853-121920875 CTGGGGTAGGAAAGGCCATGTGG - Intergenic
1014766563 6:125413286-125413308 AAGGTTTAGATGAGGTCATGAGG - Intergenic
1014979709 6:127931686-127931708 CAGGTGTTGGAGAGGATGTGGGG + Intergenic
1016732659 6:147443205-147443227 TAGGTTTAGATGAGGTCATGAGG + Intergenic
1016860225 6:148710482-148710504 TAGGTTTAGATGAGGTCATGAGG - Intergenic
1017452200 6:154564697-154564719 TAGGGTTAGGAGAGGTCATGAGG - Intergenic
1017661826 6:156682516-156682538 CAGGTGAAGGCCAGGGCATGGGG - Intergenic
1019064335 6:169283530-169283552 CAGGTGAATGGGAGGGCATGAGG + Intergenic
1019711769 7:2521195-2521217 CAGGGCTTGGTGAGGTCATGAGG + Intronic
1019776103 7:2912970-2912992 CAGGGGGAGGAGGGGTGATGGGG + Intronic
1019799297 7:3076502-3076524 CAGGTGTAGGAGATAAGATGAGG - Intergenic
1020967110 7:14884892-14884914 CAGGCTTAGGAGAAATCATGAGG - Intronic
1021380643 7:19961910-19961932 TAGGTTTAGATGAGGTCATGAGG + Intergenic
1021414733 7:20369528-20369550 TAGGTTTAGATGAGGTCATGAGG - Intronic
1022188098 7:27988627-27988649 CCGATGTTGGAGAGATCATGGGG - Intronic
1022474756 7:30702500-30702522 TAGGGTTAGGTGAGGTCATGAGG - Intronic
1023192360 7:37596398-37596420 TAGGTTTAGGTGAGGTCAGGAGG - Intergenic
1023283750 7:38596893-38596915 CATGTGTTTGAGAGGTCATTTGG - Intronic
1026144114 7:67730982-67731004 TAGGTTTAGATGAGGTCATGAGG - Intergenic
1026654257 7:72243134-72243156 TAGGTTTAGATGAGGTCATGAGG + Intronic
1028665035 7:93332361-93332383 CAGCTTTAGCTGAGGTCATGAGG - Intronic
1029328841 7:99834270-99834292 TAGGTGCAAGAAAGGTCATGGGG - Intronic
1029788965 7:102822519-102822541 CAGATTTAGAAGAGGTCATAAGG - Intronic
1030828963 7:114197494-114197516 TAGGTTTAGATGAGGTCATGAGG - Intronic
1031083683 7:117281894-117281916 GTGGTGGAGGAGAGGACATGGGG + Intronic
1031184657 7:118461198-118461220 TAGGTTTAGATGAGGTCATGAGG + Intergenic
1031495465 7:122442154-122442176 CAAATGAAGGACAGGTCATGGGG + Intronic
1032285249 7:130534728-130534750 CAGGTGTAGTAAAGGTAGTGTGG + Intronic
1032526994 7:132585828-132585850 TAGGTTTAGATGAGGTCATGAGG - Intronic
1033479108 7:141721420-141721442 AGTGTGTAGGTGAGGTCATGAGG - Intronic
1034817908 7:154189560-154189582 GTGATGTGGGAGAGGTCATGGGG + Intronic
1034967766 7:155402021-155402043 CAGGTGTGGGACAGGAAATGAGG + Intergenic
1035625229 8:1066453-1066475 CAGGTCTGGGTGAGGACATGAGG + Intergenic
1035654191 8:1293236-1293258 CAGGAGAGGGAGAGGGCATGTGG - Intergenic
1035683289 8:1504618-1504640 CACGTGTAAGTGAGGTCACGCGG + Intronic
1036703457 8:11029423-11029445 TAGGTTTAGATGAGGTCATGAGG + Intronic
1036717641 8:11141356-11141378 TAGGTTTAGATGAGGTCATGAGG + Intronic
1037034857 8:14153812-14153834 TAGGTTTAGATGAGGTCATGAGG + Intronic
1037557584 8:20040708-20040730 CAGGTGTATGAGATGTCAGTTGG + Intergenic
1039982153 8:42416871-42416893 CAGGTGTTGGTGAGGGCGTGTGG - Exonic
1040666806 8:49643307-49643329 TAGGTTTAGATGAGGTCATGAGG - Intergenic
1041443649 8:57926698-57926720 TAGGTGTAGATGAGGTCATGAGG - Intergenic
1042487225 8:69359988-69360010 CAGGTGTGGGCAAAGTCATGTGG + Intergenic
1042541863 8:69915483-69915505 TAGGTCTAGATGAGGTCATGAGG + Intergenic
1042867109 8:73365803-73365825 CAGGTGCAAAAGAGGTCTTGGGG + Intergenic
1042984962 8:74573462-74573484 TAGGTTTAGATGAGGTCATGAGG - Intergenic
1043659459 8:82718240-82718262 CAGATGTAAGTGAGATCATGTGG - Intergenic
1043852309 8:85228967-85228989 CAGGTGGATGAGAGTCCATGGGG - Exonic
1044175670 8:89118837-89118859 CAAGTGTTGGAGAGGATATGGGG + Intergenic
1044297440 8:90545244-90545266 TAGGTTTAGATGAGGTCATGAGG - Intergenic
1045035268 8:98171806-98171828 TAGGTGTAGATGAGGTCATGAGG - Intergenic
1045326731 8:101122856-101122878 TAGGAGTAGGTGAGGTCATGAGG - Intergenic
1045840206 8:106571417-106571439 TAGGTTTAGTTGAGGTCATGAGG - Intronic
1045876739 8:106990590-106990612 TAGGTTTAGGGGAGGTCATGAGG + Intergenic
1045949923 8:107840069-107840091 CAGGTTTAGGTGAGGTCATGAGG + Intergenic
1046276964 8:111974303-111974325 CAGGTATAAGTGAGATCATGCGG - Intergenic
1046354129 8:113056727-113056749 CAGGTCTAGGTGAGACCATGGGG - Intronic
1047222393 8:122928841-122928863 CAGGTGTGGGAAAGGAAATGAGG + Intronic
1047612051 8:126530541-126530563 TAGGGTTAGGTGAGGTCATGAGG - Intergenic
1047616346 8:126565466-126565488 GAGGTGTCAGAGAGGTTATGGGG - Intergenic
1047765852 8:127989435-127989457 CAGGTCGGGGAGAGGTTATGGGG - Intergenic
1047862820 8:128987668-128987690 TAGGTGTAGATGAAGTCATGGGG + Intergenic
1048305671 8:133282759-133282781 CAGTTGCAACAGAGGTCATGTGG + Intronic
1048610515 8:136017143-136017165 AAGCTGTAGGAGAGGACTTGTGG + Intergenic
1050633145 9:7581662-7581684 AAGGTTTATGTGAGGTCATGAGG + Intergenic
1051617201 9:19017571-19017593 CAGGTATAGGAGAGGCCAGAAGG - Intronic
1052259749 9:26500452-26500474 CACGTGTAAGTGAGCTCATGTGG - Intergenic
1052287156 9:26799270-26799292 GAGGTTTAGGTGAGGTCATGAGG + Intergenic
1053136039 9:35650710-35650732 CTGGTGGGGGAGGGGTCATGTGG - Intronic
1054705194 9:68454511-68454533 CCGCAGTAGGAGAGTTCATGAGG + Intronic
1054777386 9:69135057-69135079 CAGGTTTAGATGAGGTCATGAGG - Intronic
1055569980 9:77606851-77606873 TAGGTTTAGATGAGGTCATGAGG + Intronic
1055652233 9:78417689-78417711 CAGGTTTAGAAGAGGTCATGAGG - Intergenic
1055656102 9:78451940-78451962 CAGGTGCAGGAAATGTCAGGAGG - Intergenic
1056239964 9:84635276-84635298 CAGATGGAGGAGAGGAGATGGGG + Intergenic
1056314985 9:85379607-85379629 CAGTTGCAGTTGAGGTCATGTGG + Intergenic
1058611332 9:106779448-106779470 AAATAGTAGGAGAGGTCATGGGG - Intergenic
1058794537 9:108485132-108485154 CAGGTAGAGGAGAGGTGATAAGG + Intergenic
1059496681 9:114715680-114715702 CTGGTGTTGAAGAGGACATGGGG + Intergenic
1059926931 9:119218953-119218975 TAGGTTTAGATGAGGTCATGTGG + Intronic
1060090757 9:120740765-120740787 CCAGTGTTGGAGAGATCATGGGG + Intergenic
1060813096 9:126620901-126620923 TAGGTGGAGGAGAGGTCTGGGGG + Intronic
1060894892 9:127211267-127211289 CAGGTGGAGGAGAGGAGAGGGGG + Intronic
1060898724 9:127238587-127238609 GACCTGTAGGAGAGGACATGGGG - Intronic
1061647981 9:132021751-132021773 CAGGTTTAGATAAGGTCATGAGG + Intronic
1062403096 9:136380989-136381011 CAGATGCAGGGGAGGCCATGAGG + Intronic
1203461800 Un_GL000220v1:47837-47859 TAGGTGCAAGACAGGTCATGAGG - Intergenic
1185540066 X:896183-896205 GAGGTTTAGATGAGGTCATGAGG + Intergenic
1186966071 X:14787300-14787322 CATGTGTAAGTGAGATCATGTGG - Intergenic
1187512063 X:19928837-19928859 CACGTGTAGGTGAGATTATGTGG - Intronic
1187673478 X:21691937-21691959 TAGGTTTAGATGAGGTCATGAGG - Intergenic
1188419076 X:29974398-29974420 CAAGTGTTGGTGAAGTCATGAGG + Intergenic
1189180194 X:38996859-38996881 TAGGTTTAGATGAGGTCATGAGG - Intergenic
1191214031 X:57917109-57917131 CAGGTGAAGGAGAGGTCTTTAGG + Intergenic
1194598906 X:95895792-95895814 CAGGTGTTGGAAAGGATATGGGG - Intergenic
1194817199 X:98457492-98457514 CAGGTGTAAGTGAGATCATGTGG + Intergenic
1195260264 X:103124967-103124989 CATCTGTAGGAGAGGTCACTGGG - Intergenic
1195331831 X:103809069-103809091 TAGGTTTAGATGAGGTCATGAGG + Intergenic
1197594906 X:128453000-128453022 TAGGATTAGGGGAGGTCATGGGG - Intergenic
1197921515 X:131599268-131599290 TAGGTTTAGATGAGGTCATGTGG + Intergenic
1199180323 X:144846872-144846894 TAGGTTTAGGTGAGGTCATAAGG + Intergenic
1199540057 X:148948747-148948769 CAGGTGTAGGAGGGCCCAGGTGG - Intronic
1201251887 Y:12067125-12067147 CAGGTTTAGATGAGATCATGAGG - Intergenic