ID: 1119601490

View in Genome Browser
Species Human (GRCh38)
Location 14:75979915-75979937
Sequence CTGTGTGTGTGGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 934
Summary {0: 1, 1: 0, 2: 11, 3: 88, 4: 834}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119601490_1119601500 8 Left 1119601490 14:75979915-75979937 CCCTCTTCCTTCCACACACACAG 0: 1
1: 0
2: 11
3: 88
4: 834
Right 1119601500 14:75979946-75979968 GGTCTCGTGGGTCACGTGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 87
1119601490_1119601505 28 Left 1119601490 14:75979915-75979937 CCCTCTTCCTTCCACACACACAG 0: 1
1: 0
2: 11
3: 88
4: 834
Right 1119601505 14:75979966-75979988 TGGGGTAGACCAAAGGGCCCAGG 0: 1
1: 0
2: 9
3: 15
4: 149
1119601490_1119601498 4 Left 1119601490 14:75979915-75979937 CCCTCTTCCTTCCACACACACAG 0: 1
1: 0
2: 11
3: 88
4: 834
Right 1119601498 14:75979942-75979964 CGTGGGTCTCGTGGGTCACGTGG 0: 1
1: 0
2: 0
3: 10
4: 67
1119601490_1119601501 9 Left 1119601490 14:75979915-75979937 CCCTCTTCCTTCCACACACACAG 0: 1
1: 0
2: 11
3: 88
4: 834
Right 1119601501 14:75979947-75979969 GTCTCGTGGGTCACGTGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 44
1119601490_1119601496 -5 Left 1119601490 14:75979915-75979937 CCCTCTTCCTTCCACACACACAG 0: 1
1: 0
2: 11
3: 88
4: 834
Right 1119601496 14:75979933-75979955 CACAGCTCACGTGGGTCTCGTGG 0: 1
1: 0
2: 1
3: 4
4: 70
1119601490_1119601497 -4 Left 1119601490 14:75979915-75979937 CCCTCTTCCTTCCACACACACAG 0: 1
1: 0
2: 11
3: 88
4: 834
Right 1119601497 14:75979934-75979956 ACAGCTCACGTGGGTCTCGTGGG 0: 1
1: 0
2: 1
3: 3
4: 40
1119601490_1119601504 22 Left 1119601490 14:75979915-75979937 CCCTCTTCCTTCCACACACACAG 0: 1
1: 0
2: 11
3: 88
4: 834
Right 1119601504 14:75979960-75979982 CGTGGGTGGGGTAGACCAAAGGG 0: 1
1: 0
2: 0
3: 6
4: 95
1119601490_1119601499 5 Left 1119601490 14:75979915-75979937 CCCTCTTCCTTCCACACACACAG 0: 1
1: 0
2: 11
3: 88
4: 834
Right 1119601499 14:75979943-75979965 GTGGGTCTCGTGGGTCACGTGGG 0: 1
1: 0
2: 0
3: 5
4: 86
1119601490_1119601503 21 Left 1119601490 14:75979915-75979937 CCCTCTTCCTTCCACACACACAG 0: 1
1: 0
2: 11
3: 88
4: 834
Right 1119601503 14:75979959-75979981 ACGTGGGTGGGGTAGACCAAAGG 0: 1
1: 0
2: 0
3: 5
4: 93
1119601490_1119601502 10 Left 1119601490 14:75979915-75979937 CCCTCTTCCTTCCACACACACAG 0: 1
1: 0
2: 11
3: 88
4: 834
Right 1119601502 14:75979948-75979970 TCTCGTGGGTCACGTGGGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119601490 Original CRISPR CTGTGTGTGTGGAAGGAAGA GGG (reversed) Intronic
900230608 1:1555144-1555166 CTGTGTGTGTGGCAGGGGCATGG - Intronic
900509540 1:3051982-3052004 GTGGGTGAGTGGATGGAAGATGG - Intergenic
900977679 1:6027264-6027286 GTGTGTGTGTGGACGGCTGAAGG + Intronic
901948215 1:12720801-12720823 CTGTGTCTGTAGGAAGAAGACGG + Intronic
902175852 1:14650149-14650171 GTGGGTATGTGGAAGGAAGTAGG + Intronic
902370748 1:16005419-16005441 CTGTGTTCCTGGAAGGCAGATGG + Intronic
902669145 1:17960519-17960541 CTGTGTGTGCAGAAGGAATGTGG - Intergenic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903151020 1:21408812-21408834 GTGTGTGTGTGAAAGAGAGAGGG - Intergenic
903183342 1:21616126-21616148 GTGTGTGTGTGTTGGGAAGAGGG - Intronic
903692877 1:25186624-25186646 CTGTGTGGGCGGAAGGAGAAGGG - Intergenic
904287835 1:29463531-29463553 CTGTGTGTGTGGTGGGCAGGGGG - Intergenic
904373279 1:30064399-30064421 GTGTGTGGGTGGGAGGAAGGAGG + Intergenic
904435431 1:30491914-30491936 CTGGGTCTGGGGAAGGAAGCTGG - Intergenic
904770438 1:32878237-32878259 GTGTGTGTTTGGGAGGAGGAAGG + Intergenic
904876851 1:33661932-33661954 CTGTGTGTGTGGTGGGAGGGAGG - Intronic
904910991 1:33934084-33934106 GTGTGCATGTGGCAGGAAGAAGG + Intronic
905142823 1:35861934-35861956 CTGTGGCTGGAGAAGGAAGAAGG + Intergenic
905186873 1:36203396-36203418 CGAGGTGTGTGGTAGGAAGAGGG + Intergenic
905546884 1:38807281-38807303 GTGTGTGTGTGTCAGGGAGAAGG - Intergenic
906245248 1:44268831-44268853 CTTTGTGGGTGGAAAGGAGAGGG - Intronic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
906320184 1:44810796-44810818 CTGTGTGTGCTGTGGGAAGAGGG + Intronic
906785350 1:48610851-48610873 GTGTGTGTGTGGAAGGAGGAGGG - Intronic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
907784968 1:57602780-57602802 GTGTGTGTGTGGAGGGGAGTGGG + Intronic
908602749 1:65758773-65758795 CTGACACTGTGGAAGGAAGATGG + Intergenic
908928909 1:69292163-69292185 GTGTGTGTGTGTAGGGAAGCTGG + Intergenic
909308778 1:74118566-74118588 ATGTGTGTGTGGGAGGTAGTGGG - Intronic
909449667 1:75784518-75784540 CTGTGTGTGTGGCGAGGAGAGGG + Intronic
910207105 1:84759176-84759198 CTGTGTGTGAGAAAAAAAGAAGG - Intergenic
910340999 1:86187309-86187331 GTGTGTGTGTGTAAGGGAGCTGG - Intergenic
910436415 1:87210455-87210477 CTGTGCATGTGAAATGAAGAGGG - Intergenic
910476344 1:87611406-87611428 TGGTGTGTGAGGAAGAAAGAAGG - Intergenic
910771921 1:90839569-90839591 GTGGGTGTGTGGGAGGAGGAGGG + Intergenic
910793021 1:91070579-91070601 CTGAGTTTGTAGCAGGAAGAGGG + Intergenic
911181585 1:94865372-94865394 GTGTGTGTGAGGAAGAACGAGGG + Intronic
911185723 1:94902707-94902729 GTGTGTATGAGGAAGGAAAATGG - Intronic
911429071 1:97760263-97760285 CTGTATATTTGGAATGAAGATGG - Intronic
911761707 1:101624839-101624861 GTGTGTGTGTGTAAGGAGCAAGG + Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912703908 1:111897954-111897976 CCGTGTTTATGGAAGGAAGGTGG - Intronic
913092701 1:115490330-115490352 CTGTGTGTGAGGGAGGATGAAGG + Intergenic
913108862 1:115640618-115640640 CTGGGGGTGGGGGAGGAAGATGG + Intergenic
915418429 1:155760332-155760354 CTGTGTGTCTGGAAGGAGCTGGG + Intronic
915490296 1:156246840-156246862 CTGTGCGTGTGGGAGGCAGATGG + Intronic
915608316 1:156969432-156969454 CTGTGTGCAGGGCAGGAAGAGGG + Intronic
915893483 1:159792550-159792572 GTGTGTGTGTGGGAGGAGGGTGG - Intergenic
915944578 1:160140513-160140535 TTGTGTGTGTGGGGGGAGGAGGG + Intronic
915978457 1:160405762-160405784 CTGTAAGTGAGGAAGGAGGAAGG + Intronic
916133635 1:161632427-161632449 CTCTGTGTGTGGCAGGGGGAGGG - Intronic
916655411 1:166870981-166871003 CTGTGTGTGTTTAACGGAGAGGG + Intronic
917660116 1:177170123-177170145 TTCTGTGTGTGTCAGGAAGAGGG - Intergenic
917930917 1:179821952-179821974 CTGTGTCTGTCAAATGAAGAGGG - Intergenic
917961597 1:180149948-180149970 ATGTGTGTGTGGAGGGAGAAGGG - Intergenic
918039960 1:180907984-180908006 GTGTGTGTGTGGAGTGAAGCAGG + Intergenic
918264479 1:182828533-182828555 CTGTGTTTGAAGCAGGAAGAGGG + Intronic
918666938 1:187163038-187163060 CTTTGTGTGAGGAAAGATGAGGG - Intergenic
919645066 1:200087207-200087229 GTGTATGTGTTGAAGGGAGAGGG - Intronic
919713359 1:200750542-200750564 TTGTGTGGGAGGTAGGAAGAAGG - Intronic
919728565 1:200899087-200899109 ATGTGTGTGTGCAAGAGAGAGGG + Intronic
920573571 1:207037444-207037466 CTGTGTGGATGGAAGAGAGAAGG - Intronic
920795231 1:209130593-209130615 GTGTGTGTATGAAAGGAAAAGGG - Intergenic
920954626 1:210607029-210607051 CTGGGGGTGAAGAAGGAAGAGGG + Intronic
921277412 1:213533467-213533489 CTGTCTCTCTGGAAGGAACATGG + Intergenic
921612827 1:217232581-217232603 CAGTGTGTGTGAAAGCAAGAGGG + Intergenic
921628295 1:217402678-217402700 GTATGTGTGTGGAAGGGCGATGG + Intergenic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922626154 1:227045781-227045803 CTGTTTTTGTTGAAGGAAAAAGG - Intronic
922994847 1:229947703-229947725 CTATGTTCGAGGAAGGAAGAAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923445493 1:234066819-234066841 GTGTGTGTGTGGGAGAGAGAGGG - Intronic
923525851 1:234772134-234772156 CTGTGGGGGTCGGAGGAAGAAGG - Intergenic
923624139 1:235600444-235600466 GTGTGTGTGTGTAAGAGAGAGGG + Intronic
924377196 1:243424284-243424306 GGTTGTGTGTGGAAGGAACAGGG - Intronic
924565882 1:245198055-245198077 ATGTGTGGGTGGTAGGAGGAAGG - Intronic
1063225179 10:4008847-4008869 CTGTGTTAGTTAAAGGAAGATGG - Intergenic
1063282437 10:4645131-4645153 CTGTGGGTGTGGCAGGAATTGGG - Intergenic
1063379690 10:5576648-5576670 CTGTGTGTGTGCAGGGAGTAGGG - Intergenic
1063725281 10:8630416-8630438 CAGTGTGTGTGAAAGAAAGGGGG + Intergenic
1063838370 10:10042448-10042470 TTGTCTGAGTGGAAGGAAGCTGG - Intergenic
1063984496 10:11487805-11487827 GTGTGTGTGTGGAAGAGTGAGGG - Intronic
1064103739 10:12484338-12484360 CTCTGTGTTTGGAGGGAGGAGGG + Intronic
1064449365 10:15427188-15427210 CTGTCTGTGTTGAAGGACAAAGG - Intergenic
1064959122 10:20944038-20944060 CTGTGTGTCTGAAAGTTAGATGG - Intronic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066048909 10:31617893-31617915 CTGAGTGGGAGGGAGGAAGAGGG - Intergenic
1066507922 10:36064926-36064948 ATGTTTGTGTGTAAGGGAGAAGG - Intergenic
1067033575 10:42897387-42897409 CTGAGCGTGGGGCAGGAAGAGGG + Intergenic
1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG + Intergenic
1067786529 10:49253500-49253522 CTGGGTGGGAGGAAGGAGGAGGG + Intergenic
1067786586 10:49254737-49254759 CTGGGTGGGAGGAAGGAAGAGGG + Intergenic
1067932362 10:50575604-50575626 CTTTGTGTGTGGGGGGAGGAGGG - Intronic
1068036381 10:51765090-51765112 GTGTGTATTAGGAAGGAAGATGG + Intronic
1068411427 10:56660630-56660652 CTCTGCTTGAGGAAGGAAGATGG - Intergenic
1069040675 10:63692639-63692661 GTGTGTGTGTGTAAGAGAGAGGG - Intergenic
1070726332 10:78793724-78793746 CAGTGAGTGTGGCAGGAAGAAGG - Intergenic
1071986478 10:91056056-91056078 ATGAGTGTGGGGTAGGAAGAGGG + Intergenic
1072118609 10:92386759-92386781 CTGTGAGTTTCGAAGCAAGATGG + Intergenic
1072273606 10:93801266-93801288 CTGAGTGTCAGGATGGAAGATGG - Intergenic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1073134208 10:101211047-101211069 CTCTGTGGGGGGAAGAAAGAAGG - Intergenic
1073305399 10:102499985-102500007 GTGTGTGTGTGGAGAGAAGTGGG + Intronic
1073585851 10:104709159-104709181 CTGTGTGTTTGGGAGGAGGCGGG + Intronic
1073789203 10:106922602-106922624 CTGTGTGTGTACAAGGGAGGGGG - Intronic
1073957084 10:108884882-108884904 GTGTGTGTGTGTAAGGAGGCAGG + Intergenic
1074124461 10:110517028-110517050 GTGTAAGTGTGGAAGGAGGAGGG + Intergenic
1074685713 10:115960752-115960774 CTGTGTGTGTGTGAGGGAGGAGG - Intergenic
1074761135 10:116668322-116668344 CTCTGTTAGTGGAGGGAAGAGGG + Exonic
1075429305 10:122366993-122367015 CTGGATATGGGGAAGGAAGACGG + Intergenic
1075445820 10:122512110-122512132 CTGTGGGGGTAGCAGGAAGAGGG + Intronic
1075826312 10:125359610-125359632 GTGTGTGTGTGGAAAGCAAAAGG - Intergenic
1076010997 10:126988086-126988108 CTGTGTTTGTGACAGGAATAGGG + Intronic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1076980845 11:203939-203961 CTTGCTGTGTGGAAGGAAGGAGG + Exonic
1076980847 11:203943-203965 CTGTGTGGAAGGAAGGAGGAGGG + Exonic
1077172244 11:1172287-1172309 CTGAGTGTGTAGCAGGATGAAGG + Intronic
1077231981 11:1461829-1461851 ATGTGTGTGTAGAAAGAAGCAGG - Intronic
1077260488 11:1616368-1616390 CTGTGAGTGTGGAACCTAGAGGG + Intergenic
1077327808 11:1971264-1971286 CTGTGTGGCTGGAAGGTGGAGGG - Intronic
1078035055 11:7794816-7794838 CTGGGTATGTGGAAGCAATAAGG + Intergenic
1078263238 11:9731701-9731723 CTGTTTGTGTGAAAAGAAGGTGG + Intronic
1078334872 11:10455507-10455529 CTGTGTGTGTGGATGGGGGTGGG + Intronic
1078452228 11:11448999-11449021 CTGTTTGTGAGGAAGGGAAAGGG - Intronic
1078754001 11:14191443-14191465 AAGTGTGTGGGGAAGGAAGAAGG - Intronic
1079107499 11:17580916-17580938 CTGTGGTTGTGGGAGGAAGCAGG - Intronic
1079525830 11:21386447-21386469 CTTTGTCTATGGAAGGAAGTGGG - Intronic
1079661884 11:23048327-23048349 TTGGGTGTGTGTAAGGATGAGGG - Intergenic
1080070314 11:28076168-28076190 GTCTGTGTTTGGAAGGGAGAGGG + Intronic
1080216479 11:29847652-29847674 GTGTGTGTGTGGCAGGGATAAGG - Intergenic
1080558223 11:33436977-33436999 TTGTGTTTGTGAAAGGAAAAAGG + Intergenic
1080875624 11:36271774-36271796 CTTTCGGTGTGGCAGGAAGATGG + Intergenic
1080905655 11:36542394-36542416 CTTTGTGTGTAGAAGGAAAGAGG - Intronic
1080961969 11:37171386-37171408 GTGTGCGTGTGGTTGGAAGAGGG + Intergenic
1081107522 11:39088969-39088991 GTGTGTGTGTATAAGAAAGAGGG - Intergenic
1081977496 11:47244954-47244976 GTGTGTGTGAGGGAGGGAGAGGG + Intronic
1082256916 11:50041990-50042012 CTGTGTGTAAAGAAGGAAAATGG + Intergenic
1082898643 11:58220935-58220957 ATGTGAGTGTGGAAGGTAGTTGG + Intergenic
1083366917 11:62146935-62146957 CCATGTGTGTGGAAGAGAGACGG + Intronic
1083474316 11:62906162-62906184 CGGTGGGAGTGGAAGGAAGGTGG + Intergenic
1083861625 11:65423120-65423142 TGGTCTGTGTGGAAGGAGGAAGG + Intergenic
1084456031 11:69268768-69268790 CTGTGTGGTGGGAAGGAAAATGG + Intergenic
1085474750 11:76782946-76782968 CTGTGTGTGTGGAAAGAGAGAGG - Intronic
1086033147 11:82384243-82384265 CTCTGCCTGTGGAAAGAAGAAGG + Intergenic
1086497505 11:87419734-87419756 TTGTGGGTGTGGGAGGAAGGAGG - Intergenic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1086902874 11:92387399-92387421 CTGTGTGTGTTGCAGGGTGAAGG + Intronic
1086954545 11:92922381-92922403 GTGTGTCTGGGGAGGGAAGAGGG - Intergenic
1087434143 11:98091206-98091228 CTGTGTGTGTAGGGGGATGAAGG + Intergenic
1087478561 11:98669560-98669582 GTGTGTGTGTTGGAGGGAGAAGG - Intergenic
1087966672 11:104423242-104423264 CTGTGTTTGTAAAAGGAACAGGG + Intergenic
1088010802 11:104998702-104998724 ATGTGTGTGTGGGAGGGGGAAGG + Intronic
1088190719 11:107225528-107225550 GTGTGTGTGTGTATGGAAGGAGG - Intergenic
1088624700 11:111721354-111721376 GTGTGTGTGTGGCAGGAGAAGGG - Intronic
1088824319 11:113481155-113481177 CTGATTGTGTTGGAGGAAGAGGG - Intergenic
1089481850 11:118812184-118812206 CTCTTTGTGTGGCAGCAAGAGGG + Intergenic
1089598489 11:119598106-119598128 CTTTGTGTGTGGGAGAAGGATGG + Intergenic
1089802319 11:121043685-121043707 CTGGGAGTGGAGAAGGAAGATGG - Intronic
1089805843 11:121088086-121088108 GTGTGTGTGGGGAATGAAGTTGG + Exonic
1089829100 11:121309409-121309431 CTGTGTGCCTGGGAGGAAGGGGG + Intergenic
1089935566 11:122360519-122360541 CTGTGTGTGAGGAAGAAATCAGG - Intergenic
1089943381 11:122442205-122442227 CTGTGGGTGTGGAAAGAATGGGG - Intergenic
1090075040 11:123575229-123575251 CTGGGTTTGGGGAAGGATGAAGG + Intronic
1090313429 11:125763885-125763907 CTGAGGGTGTGGAAGGCAGGAGG - Intergenic
1090452430 11:126818645-126818667 GTGTGTGTGTGTTGGGAAGAGGG + Intronic
1090803554 11:130189003-130189025 CAGTGTGTGGGGCAGGAAGCGGG + Intronic
1202810788 11_KI270721v1_random:26444-26466 CTGTGTGGCTGGAAGGTGGAGGG - Intergenic
1091696000 12:2628506-2628528 CTAGGTGTGTGAAAGGAGGAAGG - Intronic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1091903790 12:4166074-4166096 GTGTGTGTGTGCAGGGAAGAGGG - Intergenic
1091935994 12:4434921-4434943 CTGTGTGTGGTGGGGGAAGAAGG + Intronic
1092184600 12:6469810-6469832 CTGTGTGTGTTGGAGGAAAGGGG + Intronic
1092203166 12:6599831-6599853 CAGTGGATGTGGTAGGAAGAAGG + Exonic
1092552270 12:9515661-9515683 CTCTGTGTCTGCAATGAAGAAGG - Intergenic
1093544029 12:20323872-20323894 CTGTGTGTGTGTATGAGAGAGGG + Intergenic
1093759927 12:22897701-22897723 CAGTGTGTGTGGAAAGAAATGGG + Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1093988793 12:25567691-25567713 CAGTGAGAGTGGAAGCAAGATGG - Intronic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1094204295 12:27824286-27824308 CTGGGTGTGTGGGAGGCAGTGGG + Intergenic
1094241395 12:28229819-28229841 CTGTGTTTGTGGCTAGAAGAAGG + Intronic
1094251041 12:28361865-28361887 CTGTGTGTGTGGGAGGGGGGCGG + Intronic
1094536465 12:31325907-31325929 GTGTGTATGTGGAAGGACGGGGG + Intronic
1096000623 12:48126895-48126917 CTATGTGTGTGAAAGGAACAAGG - Intronic
1096099597 12:48961632-48961654 GTGTGTCTGATGAAGGAAGAGGG + Intergenic
1096099613 12:48961832-48961854 TAGTGTATGTGGAAGGAAGAGGG - Intergenic
1096216586 12:49801161-49801183 CTGTGTGTGTGTATGGGGGAGGG - Intronic
1096491575 12:52015612-52015634 CTGTGTGTGTGGAGGGTGGGGGG - Exonic
1097468450 12:59957378-59957400 TTGTGTGTCTGGAAGTAAAATGG + Intergenic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1097971478 12:65637939-65637961 AAGTGTTTGTGGAAGGATGAAGG + Intergenic
1098784420 12:74732582-74732604 ATGTGTGAGAGGAAGGAATATGG - Intergenic
1098934913 12:76467539-76467561 CTGAGTGTTTGAAAGAAAGATGG - Intronic
1099096490 12:78380292-78380314 TTGTGTTTGGGGAAGGAGGAAGG - Intergenic
1099725897 12:86427497-86427519 CTGTGTGTGTGTAAGGTGGATGG - Intronic
1100132383 12:91512240-91512262 GTGTGTGTGTGGCAGGGAGGCGG + Intergenic
1100292609 12:93232225-93232247 AGGTGTGTGTGGCAGCAAGATGG - Intergenic
1100743081 12:97616632-97616654 CTGTTTGTGTGGGTGGGAGAGGG - Intergenic
1101131080 12:101691938-101691960 CTGGTTGTGTGGGAGTAAGAGGG + Intergenic
1101197911 12:102404510-102404532 CTGACTGAGTAGAAGGAAGATGG + Intronic
1101556953 12:105819013-105819035 GGGTGTGTGTGGAAGGAAGATGG + Intergenic
1101658730 12:106747544-106747566 CTGTGTGTGACGGAGGAAGAAGG - Exonic
1102123167 12:110458971-110458993 CTGAGGGTGAGGAAGGCAGAGGG - Intronic
1102547080 12:113665034-113665056 GTCTGTGTGTGCAAGGGAGACGG - Intergenic
1103172307 12:118832225-118832247 GTGTGTGGGAGGCAGGAAGAGGG - Intergenic
1103254776 12:119531679-119531701 CAGTGAGTATGGAAGGAAGCAGG + Intronic
1103791720 12:123476884-123476906 CTGTGTGTGGGGAACGAAGAAGG + Intronic
1104064891 12:125298309-125298331 CTGGGTGGGTGGGAGGGAGATGG - Intronic
1104460718 12:128953661-128953683 TTGTGTGTGTGGAGTGAGGAAGG + Intronic
1104476270 12:129073009-129073031 CTGTGGGTGGGGGAGGGAGAGGG - Exonic
1104636418 12:130440375-130440397 GTGTCTGTGTTGGAGGAAGAAGG - Intronic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1105213656 13:18272365-18272387 CTGTGTGTGGGGAGGGCACAGGG - Intergenic
1105332574 13:19431910-19431932 GTGTCTGTGTGGAAGGAATGGGG - Intronic
1105662577 13:22514826-22514848 GTGTGTGTGTGGCAGGGAGGAGG + Intergenic
1105724702 13:23150704-23150726 TTTTGTGTATGGTAGGAAGAAGG + Intergenic
1105879112 13:24587867-24587889 GTGTCTGTGTGGAAGGAATGGGG + Intergenic
1105920726 13:24961185-24961207 GTGTCTGTGTGGAAGGAATGGGG - Intergenic
1106249141 13:27970963-27970985 CTTCGTGTTTGTAAGGAAGAAGG + Exonic
1106912375 13:34476632-34476654 CTGTGTGTGTGGGAGGGTGTAGG - Intergenic
1107829748 13:44363989-44364011 GTGTGTGTATGTAAGGAAGGGGG - Intergenic
1108322786 13:49303794-49303816 GCGTGTGGGAGGAAGGAAGAGGG - Intergenic
1108352925 13:49603507-49603529 CTGTGAGACTGGAAGCAAGATGG + Intergenic
1108394685 13:49980855-49980877 CCCATTGTGTGGAAGGAAGATGG - Intergenic
1108626721 13:52236227-52236249 GTGGGGGTGTGGGAGGAAGATGG - Intergenic
1108659347 13:52570258-52570280 GTGGGGGTGTGGGAGGAAGATGG + Intergenic
1109163550 13:59005421-59005443 GTGTGTGTGTGTAAGGGAGTGGG - Intergenic
1110003552 13:70236824-70236846 GTGTGTGTGTGTAAGGGGGAGGG - Intergenic
1110160628 13:72373972-72373994 TTTTGTGTGTGGAGGGATGATGG + Intergenic
1110204210 13:72892775-72892797 GTGTGTGTGTGTAAGGCAGGAGG - Intronic
1110668149 13:78142274-78142296 GTGTGGGAGTTGAAGGAAGAAGG + Intergenic
1110732917 13:78901381-78901403 TTGTGTATGTGTAAGGAAGGGGG - Intergenic
1111128579 13:83944345-83944367 CTGTGTGTGTGGTGGGGTGATGG + Intergenic
1111294751 13:86264156-86264178 CCTTGTGTGTGGAAGGATGAGGG + Intergenic
1111619719 13:90708422-90708444 CTGTGTGTGTTGTAGAAGGAGGG - Intergenic
1111928232 13:94485523-94485545 CTGTGTTTGTGCAAGGTTGATGG - Intergenic
1112030816 13:95454649-95454671 GTGTGAGTGTGGAAGGATGAAGG + Intronic
1112414132 13:99190267-99190289 AGGTGTATGCGGAAGGAAGAAGG + Intergenic
1112487737 13:99834998-99835020 CACTGTGTGTGTTAGGAAGAGGG - Intronic
1112490165 13:99855581-99855603 CAGTGTGTGTGGCAGAGAGAGGG + Intronic
1112636403 13:101222481-101222503 TTATGTGAGTGGAAGTAAGATGG - Intronic
1112641901 13:101284933-101284955 ATGTGTGTATGGTAGGAATAGGG + Intronic
1113285204 13:108838906-108838928 TGGTGCTTGTGGAAGGAAGAAGG + Intronic
1113333192 13:109352033-109352055 GTGTGTGTGTGGAGGTGAGAGGG + Intergenic
1113386040 13:109849146-109849168 CTGCATGTGTAGAAGGATGATGG + Intergenic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113597315 13:111542766-111542788 GTGTGTGTGTGTATGGATGAAGG + Intergenic
1113865277 13:113517862-113517884 GAGTGTGGGTGGAGGGAAGAGGG + Intronic
1113974839 13:114219854-114219876 CTGTGTGTGAGGGAGGAAGGAGG + Intergenic
1114487488 14:23071576-23071598 CTGTGTGTGCGGATGGGGGAGGG + Intronic
1114899793 14:27043415-27043437 CTGTGGGTGAAGAAGGAAAAGGG + Intergenic
1115426867 14:33270471-33270493 GTGTGTGTGTGTAAGAGAGAGGG + Intronic
1115446718 14:33498980-33499002 GTGTGTGTGTGGTGGGAAGGGGG + Intronic
1115841296 14:37473531-37473553 CTGTGTGTGTGAATGGGAGTAGG + Intronic
1116167121 14:41349101-41349123 GTGCGTGTGTGTAAGGGAGAGGG - Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117181104 14:53192591-53192613 CTGTCAGGGAGGAAGGAAGAAGG + Intergenic
1117732279 14:58735445-58735467 GTGTGTGTGTGTAGGAAAGAGGG - Intergenic
1118167863 14:63355859-63355881 GTGTGTGTGTGCAGGGAACAGGG - Intergenic
1118751559 14:68811386-68811408 CTGTGTGGGTGGGAGGACGCAGG + Intergenic
1118810330 14:69268510-69268532 GTGTGTGTGTGGAGGCAGGAGGG - Intronic
1119153065 14:72383230-72383252 GTATGTGTGTGGATGGGAGAGGG + Intronic
1119383774 14:74244662-74244684 CTCTGTGCTTGGGAGGAAGAGGG + Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119655093 14:76411602-76411624 CTGTGTGTGTTGCAGGAAGGAGG + Intronic
1119796883 14:77406580-77406602 GTGTGTGTGTGTAAGGCACAAGG - Intronic
1120033449 14:79668689-79668711 CTGTTGGTGTGTAAGGAAGGGGG + Intronic
1121243518 14:92446948-92446970 CTGTGGGTGTGGGAGGAAAGGGG - Intronic
1121481609 14:94281751-94281773 CAGTGTATGTGGTGGGAAGAAGG + Exonic
1121633978 14:95441178-95441200 CAGTGTCTGTGGAATGTAGAAGG - Intronic
1121759712 14:96434828-96434850 CTCTGTCTTTGGAAAGAAGAGGG - Intronic
1121991423 14:98561607-98561629 CTGTATGTGTGGAAGGTAGTGGG + Intergenic
1122046825 14:99029880-99029902 CACTGTGTGTGGAAGGAGAAGGG + Intergenic
1122796041 14:104206775-104206797 GTGTGTGTGTGAAGGGAAGCAGG + Intergenic
1123508587 15:20972089-20972111 CTCTGCCTGTGGAAGGAAGAGGG - Intergenic
1123565809 15:21545838-21545860 CTCTGCCTGTGGAAAGAAGAGGG - Intergenic
1123602071 15:21983125-21983147 CTCTGCCTGTGGAAAGAAGAGGG - Intergenic
1124460266 15:29883528-29883550 GTTTGTGTGTGGAAGGAGGTAGG - Intronic
1124561042 15:30773869-30773891 CTGCGAGTGGGGATGGAAGAAGG - Intergenic
1124598368 15:31110514-31110536 CTCTTTGTCTGGAAGGCAGAGGG + Intronic
1124669488 15:31625190-31625212 CTGCGAGTGGGGATGGAAGAAGG + Intronic
1124792267 15:32739614-32739636 ATGTGTTTGTGGATTGAAGAAGG - Exonic
1124907845 15:33888307-33888329 GTGTGTGTGTGGCAGGGGGAAGG + Intronic
1126393880 15:48191086-48191108 GTGTTTGTGTGGAAGAGAGAAGG + Intergenic
1126437068 15:48646574-48646596 CTGTGTGTGGGGGAGGGCGAGGG - Intergenic
1126578750 15:50222789-50222811 GTGTGTGGGTGGCAGGAAAAAGG + Intronic
1126857563 15:52853754-52853776 GTATGTCTGTGGAAGGAAGAGGG + Intergenic
1126951553 15:53887169-53887191 GTTTGTGTGTGGAAGGAGAAGGG + Intergenic
1127532055 15:59852959-59852981 CTGTCTGTGAGCCAGGAAGAGGG - Intergenic
1127899320 15:63329583-63329605 GTGTGTGTCTTGGAGGAAGAAGG + Intronic
1127961507 15:63894194-63894216 CTGTATGTGTTGAAGGCAGCTGG + Intergenic
1128258407 15:66214858-66214880 GAGTGTGTGTGGAAAGAAGATGG + Intronic
1128913328 15:71536801-71536823 GTGTGTATGTGGGAGGAAGTAGG + Intronic
1128969289 15:72092900-72092922 GTGTGTGTGTGTAAGTAAGGTGG - Intronic
1129046817 15:72742809-72742831 CTGTGTGTGTGTAAGAGACAAGG - Intergenic
1129147243 15:73659779-73659801 CTGTGTGTGCAGAAGGAAAAAGG + Intergenic
1129205820 15:74036511-74036533 CCATGAGTGTGGGAGGAAGAGGG - Intronic
1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG + Intergenic
1130033691 15:80339414-80339436 CTGTCTACTTGGAAGGAAGAAGG + Intergenic
1130071233 15:80647966-80647988 GTGTCTGTGTGGAAAGAAGTAGG + Intergenic
1130375358 15:83324155-83324177 CTGTGTGTTTGAGAGGAAGCAGG + Intergenic
1130764743 15:86858486-86858508 GTGTGTGTGTGTAAGGGAGCAGG + Intronic
1130977236 15:88786462-88786484 CTGTGTGTGTGTTGGGGAGAGGG - Intergenic
1131345898 15:91647812-91647834 GTGTGTTTGTGGAAAGGAGAAGG + Intergenic
1131353003 15:91718590-91718612 GAGTGTGTGTTGAAGGGAGAAGG + Intergenic
1131645395 15:94336783-94336805 CTGTGTGTTTGGAATGGAGCAGG + Intronic
1131826915 15:96329746-96329768 CTGGGTGTGTGGCAGGATGTTGG + Intronic
1132323439 15:100944631-100944653 TTTTGTGTTTGGAAGGCAGATGG + Intronic
1202974178 15_KI270727v1_random:272931-272953 CTCTGCCTGTGGAAAGAAGAGGG - Intergenic
1132667125 16:1086636-1086658 TTGTGTGTGTGGAGGGGTGAGGG + Intergenic
1132773659 16:1579623-1579645 CAGTGTGTGTGGGATGCAGACGG + Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132910225 16:2306484-2306506 CTGGGTCTGTGGAAGGAGGTGGG - Intronic
1133149153 16:3813914-3813936 CATTTGGTGTGGAAGGAAGATGG - Intronic
1133437094 16:5789089-5789111 CTGTGTGAGAGAGAGGAAGAGGG - Intergenic
1134747830 16:16601557-16601579 AAGTGTGTGTGGAAAGAAGGAGG + Intergenic
1135123996 16:19791583-19791605 CCTTGTGTGTGGAAGGATGAGGG - Intronic
1135327956 16:21539387-21539409 GTCTCTGTCTGGAAGGAAGATGG + Intergenic
1135407413 16:22207844-22207866 CTGTGTGTGTAAAGGGGAGAGGG + Intronic
1135548107 16:23379104-23379126 CTGGGTGTGTGGGTGGATGATGG - Intronic
1135791113 16:25396981-25397003 CTGTATTTGAGGCAGGAAGATGG + Intergenic
1135902668 16:26477953-26477975 TCGTATGTGTGGAAGAAAGAAGG + Intergenic
1136618988 16:31415516-31415538 CTGGGTGTGTGGATGGAGGTGGG - Intronic
1136632164 16:31495333-31495355 CTGTGGGTGTGGCAGGAAACTGG + Intronic
1137373756 16:47933023-47933045 CTGTGTGTGTTGAGGGGTGAGGG - Intergenic
1140022048 16:71247957-71247979 CTGTGTGCGTGGCAGGGGGAGGG + Intergenic
1140341074 16:74162847-74162869 CTGTGTGTGTGGTTGTGAGAGGG + Intergenic
1141234040 16:82198998-82199020 CTGTGTGTGTGGGGAGAGGAGGG - Intergenic
1141421528 16:83920982-83921004 ATGGATGGGTGGAAGGAAGATGG + Exonic
1141421570 16:83921172-83921194 ATGGGTGGATGGAAGGAAGATGG + Exonic
1141421640 16:83921462-83921484 CAGGGTATATGGAAGGAAGATGG + Exonic
1141588157 16:85048967-85048989 GTGTGTGTGTGAGAGGGAGAGGG + Intronic
1141749709 16:85950138-85950160 CTGTGGGTGAGGGAGGAAGTAGG + Intergenic
1142363739 16:89639139-89639161 GTGTGTGTGTGCAAGGATGAGGG - Intergenic
1142363841 16:89639508-89639530 GGGTGTGTGTGCAAGGATGAGGG - Intergenic
1142809577 17:2389046-2389068 CTGTGTGTGATGAGGGCAGACGG - Intronic
1143248653 17:5505873-5505895 CTGTGTGTGTGAAAGAAAACGGG - Intronic
1143989490 17:10944588-10944610 GTGTGTGTGTGCACAGAAGAGGG + Intergenic
1144256723 17:13475740-13475762 CTGTGAGGCTGGAAGCAAGATGG - Intergenic
1144379836 17:14683767-14683789 CAGGGAGTGAGGAAGGAAGAAGG - Intergenic
1144398242 17:14867102-14867124 CTGTATCTGTAGCAGGAAGAGGG + Intergenic
1146519656 17:33516418-33516440 GTGTGTGTGTGTATGGAGGAGGG + Intronic
1146596416 17:34173000-34173022 CTGTGAGGCTAGAAGGAAGATGG + Intronic
1146646156 17:34578901-34578923 CTGTTGCTGGGGAAGGAAGACGG - Exonic
1146820913 17:35983033-35983055 ATGTGTGGATGGAAGGATGAAGG - Intergenic
1146925484 17:36742043-36742065 GTGTGTGAGAGGGAGGAAGAGGG + Intergenic
1146974096 17:37096317-37096339 CTGGGTGCCTGGTAGGAAGAAGG - Intronic
1147170232 17:38614214-38614236 ATGTGTGTAAGGAAGGAAGGGGG - Intergenic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1147647646 17:42043426-42043448 CTGTGTGTGGGGGAGGCAGGGGG - Intronic
1148350527 17:46938809-46938831 GTGTGTGTGTGAAAGAGAGAGGG + Intronic
1148492763 17:48033766-48033788 CTGTGGGTGTGCAAGGCTGATGG + Intronic
1148895092 17:50834964-50834986 CTCGGTGTGTCGATGGAAGAGGG + Intronic
1149490460 17:57081216-57081238 AAGTGTCTGTGAAAGGAAGAAGG - Intergenic
1151015761 17:70551006-70551028 GTGTGTGTGTGTATGGAAGCTGG + Intergenic
1151104188 17:71593292-71593314 GTGTGTGTGTGGAGGGAATAGGG + Intergenic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151435760 17:74096111-74096133 GAGAGTGTGAGGAAGGAAGAGGG - Intergenic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152271596 17:79328177-79328199 CTGTGTGTCTGGAACGGAGATGG + Intronic
1152388277 17:79988106-79988128 GTGTGTGTTTAGAAGGGAGAGGG + Intronic
1152523295 17:80872925-80872947 CTGGGTGTGAGCAAGGGAGAGGG + Intronic
1152641838 17:81452516-81452538 CAGTGTGTGTGGATGGTAGGAGG + Intronic
1152660067 17:81537945-81537967 CTGTGGATGTGGACGGAAGTGGG - Intergenic
1152901935 17:82947316-82947338 GTGGGTGTGTGGAGGGAAGGTGG - Intronic
1152986607 18:327186-327208 GTGTGTGTGTGAATGTAAGATGG + Intronic
1153073258 18:1131526-1131548 CTGTGTGTGTAGGAGGATGGAGG + Intergenic
1156365066 18:36418531-36418553 AAGTGTGTGTGGAAGGCACATGG + Intronic
1156610014 18:38714766-38714788 CTGCGTATGTGGAGGGAAGCTGG + Intergenic
1156795875 18:41045582-41045604 CTGTGTGTCTGGAAGCAGAATGG - Intergenic
1156808111 18:41211848-41211870 AAGTGTGGCTGGAAGGAAGAAGG + Intergenic
1157279469 18:46336061-46336083 GGGTGTGTGAGGAAGAAAGAGGG + Intronic
1157918470 18:51692741-51692763 GTGTGTGTGTGGAGGGGAGGGGG + Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158315973 18:56211447-56211469 GTGTGTGTGTGTAGGGAGGAAGG - Intergenic
1158532222 18:58273921-58273943 CTCTCTGTGTGGATGGGAGAGGG - Intronic
1159324395 18:66895542-66895564 CTGTGTGTGTGTGAGAGAGAGGG + Intergenic
1159657350 18:71048073-71048095 CTGAGATTGAGGAAGGAAGAAGG - Intergenic
1159750204 18:72291637-72291659 GTGTGTGTGTTTAAGGAAAATGG - Intergenic
1159797614 18:72863804-72863826 GTGTGTGTGTGGGGGGAAGGTGG + Intronic
1160179715 18:76623756-76623778 CTGTGTGCTTGGAGCGAAGAGGG + Intergenic
1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG + Intergenic
1160939182 19:1612154-1612176 CTGGGTGTGGGGAAGGGAGAGGG + Intronic
1161807977 19:6456093-6456115 CTGTGTGGGTGGAAGGTGGGAGG + Intronic
1162777623 19:12989569-12989591 TTGTGTGTGTGGATGAAGGATGG + Intergenic
1162788840 19:13052777-13052799 CTGTGTGTGTGGACGGGTGCAGG - Intronic
1163108577 19:15142580-15142602 TTTGGTGTGTGGAAGGAAGATGG + Intergenic
1163704464 19:18804250-18804272 CTGTGTGCGTTGCAGGGAGATGG + Intergenic
1164503772 19:28841376-28841398 CTGTGTGTGTGGGGAGAAGGTGG + Intergenic
1164518777 19:28960752-28960774 CTGTGAGGCTGGAAGCAAGATGG - Intergenic
1164753976 19:30676339-30676361 CTGTGAATGTGTAAAGAAGATGG + Intronic
1165108307 19:33487216-33487238 CTGGGTGAGTGGAAGGCAGGGGG + Intronic
1165320087 19:35079883-35079905 CTGTGTGAGTGCAAGGAGGCTGG + Intergenic
1165403276 19:35615210-35615232 CCGTGTCTGTGGGAGGAACAGGG - Exonic
1166437278 19:42778170-42778192 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166446988 19:42866615-42866637 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166453917 19:42924284-42924306 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166456389 19:42943566-42943588 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166466181 19:43032837-43032859 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166472325 19:43088905-43088927 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166483456 19:43192854-43192876 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166485926 19:43211941-43211963 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166493082 19:43275894-43275916 CTGTGTGTTTGCAGAGAAGATGG - Intergenic
1167071969 19:47226981-47227003 TTGTCAGTGTGGAAGGTAGACGG + Intronic
1167248063 19:48385716-48385738 CTTGGTTTGTGGAAGGAAGGTGG + Intronic
1167263999 19:48474363-48474385 GGGTGTCTGTGGCAGGAAGAGGG - Intronic
1167445517 19:49534958-49534980 CTGTGTGTGTGGCAGGGTGTGGG - Intronic
1167454772 19:49592270-49592292 TTGTGTGTGTGTAAGGGAGGGGG + Intronic
1168153238 19:54460188-54460210 CTGTGTGTGTGGAAAGGGTAGGG + Intronic
1168231419 19:55034706-55034728 GTGTGTGTGTGTAAGAATGAGGG - Intronic
1168475668 19:56673424-56673446 CTGTGTGTGTGGATGGGAGGAGG + Intergenic
1168522103 19:57060669-57060691 TTGTGTGTGTGTAAGAAAGACGG - Intergenic
1168627942 19:57933850-57933872 CTGTGTTTGAGGGAGGAGGAAGG - Exonic
925342774 2:3148466-3148488 CTGACTGTGGGGAAGGATGAGGG - Intergenic
925363219 2:3294271-3294293 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925363263 2:3294475-3294497 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925363388 2:3295082-3295104 GTGTATGTGTGGAAAGAGGATGG - Intronic
925363484 2:3295554-3295576 GTGTGTGTGTGGAGAGAGGATGG - Intronic
925363670 2:3296447-3296469 GTGTGTGTGTGGAGAGAGGATGG - Intronic
925363724 2:3296716-3296738 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925523997 2:4779601-4779623 TTGTGTGTGTGTATGAAAGATGG - Intergenic
925636404 2:5945444-5945466 CTAAGTCTGTGGAAGGAATATGG + Intergenic
925774311 2:7319123-7319145 CTGTGTGTGTGGTGGGGGGAGGG + Intergenic
926197600 2:10773139-10773161 CTGTGTGTCAGGAGGGATGAAGG + Intronic
926204721 2:10828014-10828036 CTGTGTGTGTGGCAGGGGGAGGG - Intronic
927517264 2:23679780-23679802 CAGAGGGTGTGGGAGGAAGAGGG + Intronic
927964223 2:27259122-27259144 CTCTGTGTATGGAAGGAAAAGGG - Intronic
928106106 2:28471566-28471588 CTGTGAGGGTGACAGGAAGAGGG + Intronic
928270293 2:29849372-29849394 CTGTGCATGTGGTAAGAAGAGGG + Intronic
928375405 2:30769501-30769523 ACGTGTGTGTGTGAGGAAGAGGG - Intronic
929582876 2:43094514-43094536 CTGTGTGAGTGGGAGAGAGAAGG - Intergenic
929583078 2:43096504-43096526 CTGTGTGAGTGGGAGAGAGAAGG - Intergenic
929643499 2:43604903-43604925 TGGTGTGTGTGGAAGGAAGAGGG - Intergenic
930311272 2:49743152-49743174 CTCCCTGTGTGGAAAGAAGATGG + Intergenic
930876068 2:56218418-56218440 ATGTTTGTGTGGCTGGAAGATGG - Intronic
930932707 2:56906896-56906918 CTGTTTCTGTGGAATGAAAATGG + Intergenic
930965015 2:57311982-57312004 GTGTGTGTGAGGGAGAAAGAAGG - Intergenic
931516578 2:63053736-63053758 GTGTGTGTGTGCAGGGGAGAGGG + Intronic
931694790 2:64863671-64863693 CCGTGTGTGTGGTAGGTTGATGG - Intergenic
932022724 2:68104053-68104075 AGGTGGGAGTGGAAGGAAGAAGG + Intronic
932288803 2:70557854-70557876 CTGTGTATGAGAAAGAAAGAGGG + Intergenic
932469213 2:71942984-71943006 GTGTGTGTGTGGTGGGGAGATGG + Intergenic
932543529 2:72682754-72682776 CTTTGTATGTGGAATCAAGAGGG - Intronic
932697372 2:73968234-73968256 CTGGGTGGCTGGAAGGATGATGG - Intergenic
932835385 2:75031142-75031164 ATGCTGGTGTGGAAGGAAGAGGG - Intergenic
933298484 2:80517031-80517053 CTGTTTGTCTGAAATGAAGAAGG + Intronic
933647621 2:84825331-84825353 CCGTGTGTGAGGAAGGGAGGAGG + Intronic
934040680 2:88125508-88125530 CTGTGTGAGTGGTTGGCAGATGG - Intronic
934300672 2:91774381-91774403 CTGTGTGTGGGGAGGGCACAGGG + Intergenic
934495796 2:94796728-94796750 AAGGGTGTGTGGAAGGCAGAAGG - Intergenic
934578445 2:95418260-95418282 GTGTGTGTGTGTAAGGAAAGAGG + Intergenic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
935313642 2:101809730-101809752 TTGTTTGTTTGGGAGGAAGATGG + Intronic
935597228 2:104888715-104888737 CTGAGAGTGGGGAAGGAAGTGGG - Intergenic
936341519 2:111637853-111637875 CTGGCTGTGGGGAAGAAAGAAGG + Intergenic
936460805 2:112712691-112712713 CAGTGAGTGTGAAAGGGAGAAGG - Intergenic
936847579 2:116854918-116854940 GTGTTTGTTTGGAAGAAAGAAGG - Intergenic
936857521 2:116978142-116978164 TTGTGTGTGTGTAAGGACAAGGG + Intergenic
936937357 2:117851207-117851229 CAGTGGGTGAGGAAGAAAGATGG + Intergenic
937015723 2:118603498-118603520 GTGTGTGTGTTGAGGGCAGAGGG + Intergenic
937019080 2:118633835-118633857 GTGTGTGTGTGGGAGGGAGTGGG - Intergenic
937159346 2:119745755-119745777 CTGGTTCTGTGGAAGGAAGTTGG - Intergenic
937472586 2:122186824-122186846 CGGTGTGGGTGGAAGAGAGATGG - Intergenic
937579761 2:123470531-123470553 CTGTGTATGTCAAAGTAAGAGGG + Intergenic
937708372 2:124948787-124948809 GTGTGTGTGTGAAAGAGAGAGGG + Intergenic
937712875 2:124997807-124997829 CTGTGAGGGTGGAAGCAGGATGG + Intergenic
939110360 2:137999403-137999425 TGGTGTGTGTGGAGGGAAGGAGG - Intronic
939319985 2:140606760-140606782 GTGTGTGTGTGATATGAAGAAGG - Intronic
939614456 2:144346899-144346921 ATGTGTATGTGAAAGAAAGAGGG - Intergenic
940115563 2:150204561-150204583 CTGTGTGTGTGGGTGGCAGTAGG - Intergenic
941296938 2:163750460-163750482 CTGTGTGTGTTGGAGTAAAAAGG - Intergenic
941745252 2:169080323-169080345 CTGAGCCTGTGGAAGGGAGAGGG - Intronic
942711649 2:178842971-178842993 GTGTGTGTGTTGAGGGTAGAGGG + Intronic
942726851 2:179019023-179019045 CTGTGGGTGTCCAAAGAAGAGGG - Intronic
942986426 2:182148268-182148290 CTGTGTGTGTGGAGGGGGGTGGG + Intronic
943745657 2:191460355-191460377 GTGTGTGTGTGGAGGGATGGTGG - Intergenic
944133206 2:196369758-196369780 CTCTGTTTGTGGAAAGATGAGGG - Intronic
944238360 2:197461587-197461609 GTGTGTGTGAGGGAGGGAGAGGG + Intronic
944619460 2:201499039-201499061 GGGTGTGTGGGGATGGAAGATGG - Intronic
944629038 2:201604159-201604181 GTGTGTGTGTGAAAGAGAGAGGG + Intronic
944990471 2:205229881-205229903 CTCTGCTTGTGGAAAGAAGAGGG - Intronic
945039281 2:205730611-205730633 CGGTGTGCAGGGAAGGAAGAGGG + Intronic
945523442 2:210858709-210858731 CTATGTGTGAAGAAGGATGACGG - Intergenic
945624030 2:212177970-212177992 GTGTGTGTGTGTTGGGAAGAGGG + Intronic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
947305168 2:228737898-228737920 CTGTGGATGTGAAAGGAAGGTGG + Intergenic
947345083 2:229182298-229182320 CTGTGTGTTTTGAAGGAAAGAGG + Intronic
947913161 2:233814908-233814930 GTGTGTGTGTGGAAGGACAGAGG - Intronic
948004539 2:234596425-234596447 GTGTGCGTGTGGCAGGAAGTAGG + Intergenic
948297805 2:236875937-236875959 CTGTGTGTCTGGAAGCACGTTGG - Intergenic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948580880 2:238986549-238986571 GGGTGTGTGTGCCAGGAAGAAGG - Intergenic
948797418 2:240412080-240412102 CTGTGTGCGGGGAAGGAGAACGG - Intergenic
948931072 2:241132720-241132742 CAGTGTGTGTGGAAGAGAGCAGG + Intronic
949050627 2:241895659-241895681 CTGTGTGGGTGGATGGAGGGGGG + Intronic
1169198625 20:3696957-3696979 CTGTGTGTGTGGCAGGAGGTGGG - Intronic
1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG + Intergenic
1171298889 20:24042124-24042146 ATGGGTGTGTGGAAAGAAGGTGG - Intergenic
1171431868 20:25087964-25087986 CTGTGGCTGTGGAATAAAGATGG - Intergenic
1172820473 20:37728838-37728860 CTGTGTGTGAGGGAGGAGGTTGG + Intronic
1173000253 20:39100528-39100550 TTGTGTGTGTGGTAGGAGGGGGG - Intergenic
1173287495 20:41686560-41686582 CTTTGTGTGTGGAAGTCAAATGG - Intergenic
1173347712 20:42216103-42216125 ATGTGAGTGTGGAACGGAGAAGG - Intronic
1173356038 20:42291549-42291571 CTGTGCATGTGTAAGGGAGATGG + Intronic
1173446683 20:43125343-43125365 CAGTGTGGGTGGTAGAAAGAGGG - Intronic
1173549815 20:43924863-43924885 CTGTGTGTGGAGAAGGGAGAGGG - Intronic
1173577617 20:44123271-44123293 CTGTGGATGTGGAAGGAGGTGGG - Intronic
1173894614 20:46541557-46541579 CTGGGTGTGGGGACGCAAGAAGG + Exonic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174390078 20:50213633-50213655 TTGTGTGTGTGCATGCAAGAGGG + Intergenic
1174736769 20:52972468-52972490 GTGTGTGTGTGCGAGGAAGCGGG + Exonic
1175001764 20:55636796-55636818 CTTTGTGTGTGGGAGGGAGCAGG - Intergenic
1175348718 20:58302481-58302503 CTGTGTGTGAGGGAGGGAGTGGG - Intergenic
1175541443 20:59750596-59750618 CGGTGTGTGGGCAGGGAAGACGG - Intronic
1175660041 20:60804522-60804544 TTGTGGGTCAGGAAGGAAGAGGG + Intergenic
1175716642 20:61259061-61259083 CTTTGTTTTAGGAAGGAAGAAGG + Intronic
1175779220 20:61671756-61671778 GTGGGTGTGTGGATGGATGATGG + Intronic
1176002639 20:62839853-62839875 GTGTGTGCGTGGAGGGGAGAAGG - Intronic
1176940286 21:14915634-14915656 CTGTGTGTGTGGATGGGGGTGGG + Intergenic
1177110395 21:17020404-17020426 GTGTGTGTGTGTAACTAAGAGGG + Intergenic
1177389288 21:20445781-20445803 GTGTGTGTGTGTATGTAAGAAGG + Intergenic
1177778409 21:25595442-25595464 TTGAGTGTGTGGTAGGAGGAAGG - Intronic
1177942263 21:27425305-27425327 CTGTGTGTGTGGCAGAAAGGGGG + Intergenic
1178111788 21:29376452-29376474 CTTTGAGTGGGGAAGAAAGATGG + Intronic
1178575729 21:33788270-33788292 GTGTGTGTGTGGAAGGAGGTGGG - Intronic
1179106318 21:38403797-38403819 CTGTGCTTGTGGAAGGCAGCTGG - Intronic
1179497364 21:41781118-41781140 CTGTGTGTGTTGAAGCATAAAGG + Intergenic
1179511479 21:41876894-41876916 CTGTGTGTGGGGAATGGAGCTGG - Intronic
1180031085 21:45208454-45208476 CCAGGTGTGTGGCAGGAAGAAGG + Intronic
1180173103 21:46071041-46071063 CTGTGGATTTGGAAGCAAGAAGG + Intergenic
1180742181 22:18061364-18061386 CAGTGTGTGTGGGAGGAGAACGG + Intergenic
1181315235 22:21966758-21966780 CTGTCTGTCTGGAATGCAGAAGG - Intronic
1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG + Intronic
1181783195 22:25207608-25207630 GTGGGTGGGTGGAAGGATGATGG - Intergenic
1182172282 22:28243830-28243852 CTGTCTGTGTTCAAGGAAGTTGG - Intronic
1182608577 22:31527352-31527374 CTGTGTGTGTGTAAAGAAAAAGG + Intronic
1182741329 22:32570144-32570166 CAGTGTGTGTGGAGGGAGGTTGG - Intronic
1182793686 22:32974652-32974674 GTGTGTGTGTGCATGTAAGAGGG + Intronic
1183122514 22:35741042-35741064 CTGTGGCTGTTGAAGGATGATGG + Intronic
1183964615 22:41434341-41434363 CTGTGTGTGTGGATGGGAGGAGG + Exonic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184482350 22:44755243-44755265 CAGTGTGTGTGGGAGGAAGGTGG - Intronic
1184707392 22:46224058-46224080 TTGTGGGTGTGGGTGGAAGAGGG - Intronic
1184744623 22:46449129-46449151 CTGGGTGAGTGGATGGAAGCTGG - Intronic
1184864835 22:47196305-47196327 GTGTCTGGGTGGAAGGAAGGAGG + Intergenic
1184990628 22:48167034-48167056 CTGTGTGTGTGCATGTATGAAGG - Intergenic
1185056358 22:48580657-48580679 CGGTGTGTGTGGAAGGAGGAGGG + Intronic
1185127592 22:49020125-49020147 ATGTGTGTGGGTGAGGAAGAAGG - Intergenic
949094549 3:70884-70906 AAGTGTGTGTGGAAGGAGTAGGG - Intergenic
949676677 3:6462668-6462690 CTGTGTGTGTGTAGGGAACATGG - Intergenic
949712321 3:6885577-6885599 CTGGGTGTGTGGTAGGAGGCAGG - Intronic
950545700 3:13636788-13636810 ATGTGTGTGTATGAGGAAGAGGG - Intronic
950656410 3:14439753-14439775 TTGTGTGTGTGTGAGGAAGCTGG + Intronic
950829700 3:15860667-15860689 GGGTGTGTGTGGCAGGATGAGGG - Intergenic
950854228 3:16090468-16090490 TAGTGTGTGTGGAAGGAGGAGGG + Intergenic
950943459 3:16918667-16918689 CTTTATGTGTTGAAGGAAAAAGG + Intronic
951038655 3:17963715-17963737 CTGTGTGTGTGGATTGGACATGG + Intronic
951154915 3:19339948-19339970 TTCTGTGTGTGGAAAGAAGAGGG + Intronic
951966455 3:28391342-28391364 GTGTGTGTGTGGCAGGGAGAGGG - Intronic
952841967 3:37654179-37654201 GTGTGTGTGTGGAGGCAGGAGGG - Intronic
952966507 3:38624198-38624220 GTGTGTGTGTGTAAGGGAGAAGG - Intronic
953004857 3:38968954-38968976 CTGTGTGTGGGGTAGGGACATGG - Intergenic
953201276 3:40780564-40780586 CTGGATGTTTGGGAGGAAGAAGG + Intergenic
953607024 3:44418935-44418957 TTGTGTGTGTGGTAGGGAAAGGG - Intergenic
953699598 3:45185556-45185578 GTGTGTGTGTGGAAGGAAGCTGG + Intergenic
954055113 3:48016694-48016716 CTGTGTTAGAGGAAGGAAGTGGG - Intronic
954280353 3:49572868-49572890 CTGTGTGTGCAGAAGAAAGGAGG + Intronic
954466501 3:50658266-50658288 AGGTGGGTTTGGAAGGAAGATGG + Intergenic
954609249 3:51935571-51935593 CTGTGAGTGTGGATGGGAGAGGG - Exonic
954640916 3:52097236-52097258 GTGTGTGTGTGGCGGGGAGAGGG + Intronic
954884111 3:53857030-53857052 CTTAGTGTGTTGAAGGAAAATGG + Intronic
954989235 3:54825255-54825277 CCTTCTGTGTAGAAGGAAGAAGG - Intronic
955333734 3:58068409-58068431 CTGTGTGGATGGAAGGGATATGG + Intronic
955947755 3:64211544-64211566 CTGTGTGTGTGGAAAGAGAGAGG + Intronic
956954701 3:74323225-74323247 GTGTGTGTGTGGGAGGATGGGGG + Intronic
956994417 3:74807869-74807891 GTATGTGTGTGGCAGGGAGAAGG + Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957954101 3:87161384-87161406 CTGTGTGTGTGTAGGGTAGGGGG - Intergenic
959068448 3:101680605-101680627 CTGGGAGTGTGGAAGGTGGAAGG - Intergenic
959116947 3:102189767-102189789 CTGTGGGTGTGGCATGAGGAAGG + Intronic
959201582 3:103254717-103254739 ATGTCTGTGTGGAAAGAAGTAGG - Intergenic
959427067 3:106204318-106204340 GTGTGTGTGTGAAAGAGAGATGG - Intergenic
959784102 3:110272679-110272701 CAGGGTGTGGGGCAGGAAGAGGG - Intergenic
960622518 3:119650686-119650708 GAGTGAGTGTGGATGGAAGAGGG - Intronic
960707946 3:120499332-120499354 GTGTGTGTGTAGTAGAAAGAGGG - Intergenic
960972669 3:123150706-123150728 CAGTGTCTGGAGAAGGAAGAGGG - Intronic
961211763 3:125131042-125131064 ATTTGTGTGTGGAAGGAAAGAGG + Intronic
961666757 3:128497600-128497622 GTGCGAGTGTGGAAGGAAGAGGG + Intergenic
962027375 3:131562614-131562636 CTGTGTGTGTGGTATAAAGAAGG + Intronic
962282322 3:134061278-134061300 CAGAGTGTGAGGAAGGACGAGGG + Intergenic
962284798 3:134076660-134076682 CTGTGTGTGTGTAAATAGGAGGG + Intronic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
962920942 3:139949940-139949962 ATGTGTGTGTAGAGGCAAGAAGG + Intronic
963320682 3:143806097-143806119 CTGTGTGTGTGGGTGGGGGACGG - Intronic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
964158859 3:153621519-153621541 CTGTGTGTGTGGAAGAGAAAGGG + Intergenic
964198048 3:154087384-154087406 CTAGGTGTATGGAAGGATGATGG - Intergenic
964297970 3:155254595-155254617 CTGAGAGTGTGGGTGGAAGAAGG - Intergenic
965806668 3:172549364-172549386 GTGTGTGTGTGTAAAGAAAAAGG + Intergenic
965812916 3:172610258-172610280 CTGTGCTTCTGGCAGGAAGAGGG + Intergenic
966940061 3:184740664-184740686 CTGTGTTTGGGGGAGGAAGAGGG - Intergenic
967042408 3:185705753-185705775 CTGTGTCTCTGGATGGAGGAAGG + Intronic
967636028 3:191804325-191804347 CTCTGTATGGGGAAAGAAGAGGG + Intergenic
967676513 3:192305518-192305540 GTGTGTGTCTGGAAGAGAGACGG - Intronic
968845186 4:3037091-3037113 GTGTGTGTGTGTGAGAAAGAGGG + Intronic
968978517 4:3834427-3834449 CTGTGTGGGTGGATGGAGGGTGG - Intergenic
969088555 4:4675117-4675139 GTAGGTGTTTGGAAGGAAGAAGG - Intergenic
969232671 4:5842538-5842560 CAGGGAGTGTGGAAGGAGGAAGG - Intronic
969233809 4:5851199-5851221 CTGTGTGAGTGGCATGCAGAAGG - Intronic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
970869413 4:20798486-20798508 GTGTGTGTGTGGTAGAAAGAAGG - Intronic
970981249 4:22100090-22100112 TTGTGTCTGTGGCAGGAAGTGGG - Intergenic
971153477 4:24058501-24058523 CTGGGTATGTGGTGGGAAGAGGG - Intergenic
973074039 4:45900587-45900609 CTGTGAGTCTAGAAGCAAGATGG + Intergenic
973321569 4:48816101-48816123 CTGTGTGACTAGCAGGAAGAAGG - Intronic
973341630 4:49011363-49011385 ATGTGTGTGTGCATGCAAGATGG + Intronic
973764675 4:54152299-54152321 CTATGTTTGTGGAAAGTAGATGG + Intronic
974775850 4:66479380-66479402 CTGTTTGTGTGAAAGAAAGAAGG - Intergenic
974937762 4:68428779-68428801 GTGTGTGTGTGGGAGGAAGTGGG + Intergenic
975581630 4:75912004-75912026 CTGTGAGGCTAGAAGGAAGATGG + Intergenic
976391719 4:84512398-84512420 CTGTGTGTACTGAAGGAAGCAGG + Intergenic
976470568 4:85423978-85424000 CTGTGTGTGTGGAAGGGGGGCGG + Intergenic
976600938 4:86936467-86936489 CGGTGTGTGTAGAAGGTAGGTGG + Intronic
976767490 4:88612317-88612339 GTGTGTGTGTGGTAAGAAGGAGG + Intronic
976786469 4:88826986-88827008 CTGTAAGTGGGGAAGGAAGAGGG - Intronic
979264257 4:118683112-118683134 GGGTGTGTGTGGCAGGAAGAGGG - Intergenic
979346915 4:119598836-119598858 CTGGGGGGTTGGAAGGAAGATGG + Intronic
979669102 4:123343574-123343596 CTGTGTGCTTGGAAGGAGGTGGG - Intergenic
979882000 4:125971293-125971315 ATGTGTGTTTGGAAAAAAGATGG - Intergenic
980582366 4:134771702-134771724 TGGTGTGTGTGGAAGACAGAGGG - Intergenic
980587896 4:134841920-134841942 CTGTGTATGTGAAAGTAAAAGGG - Intergenic
980731338 4:136827888-136827910 CAGTGTGTGTGGGAAGGAGAGGG + Intergenic
980866397 4:138558130-138558152 GTGTGTGTGTGGAAAGAGAAAGG + Intergenic
984877018 4:184378337-184378359 ATGTGTGTCTGGAAAGAAAATGG - Intergenic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
985010442 4:185577147-185577169 GTGTGTGTGTGGAAGGATGTCGG + Intergenic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
986443527 5:7801277-7801299 CTGTGTGTCTGGCAGGGCGAGGG - Intronic
986603299 5:9495927-9495949 TAGTGTGTGTGGATGGGAGAGGG - Intronic
987527338 5:19069824-19069846 CTCTGTGTGTGGTAGGATGAAGG + Intergenic
987628502 5:20435126-20435148 GTGTGTGTGTGGTGGGGAGAGGG - Intronic
988494167 5:31730599-31730621 GTGTGTGTGTGTAAGGGAGTTGG + Intronic
988627082 5:32888782-32888804 CTGTGTGTCTGGAAGGAGAAAGG + Intergenic
988731950 5:33981187-33981209 CTCTGTGTAAGGAAGGCAGAGGG - Intronic
988997118 5:36725167-36725189 CTGGGTGTGTGGGAGGGAGTAGG + Intergenic
989104149 5:37845271-37845293 GTGTGTGTGTGTATGGAAGGGGG + Intergenic
989242806 5:39219847-39219869 CTGGGTGTGTGGAAAGATTATGG - Intronic
990497533 5:56363487-56363509 TTGTGTGTGTGCAGGGAGGAGGG - Intergenic
990703629 5:58502306-58502328 CTGTGTATGTAGCAGCAAGAAGG + Intergenic
990972782 5:61527635-61527657 GTGTATGTGTTGAAGGAAGAAGG - Intronic
991512580 5:67396196-67396218 CTGGGTGTGGGGATGGGAGATGG + Intergenic
991947620 5:71915006-71915028 CTGTGTGGGTGGGCGGAAGGTGG + Intergenic
991959005 5:72022879-72022901 GTGTGTGTGTTGGAGGAAGAGGG - Intergenic
994010303 5:94894614-94894636 ATGTGTCTCTGGAAGGAGGAGGG + Intronic
994077581 5:95670612-95670634 CTTTGTGTGGGGAAGTAAAAGGG - Intronic
994303400 5:98173809-98173831 GAGTGTGTGAGGAAGGAAGGAGG - Intergenic
994580928 5:101641027-101641049 CTGTGTTTATGGAAGGGAGAGGG - Intergenic
994676841 5:102833911-102833933 ATGTGTTTGTGGAAGCAAAATGG + Intronic
994720911 5:103379404-103379426 GTGTGTGTGTGTATGGAACAGGG - Intergenic
995312135 5:110726097-110726119 GTGTGTGTGTGAAAGAGAGAGGG - Intronic
996290263 5:121844402-121844424 TTGGGTCTTTGGAAGGAAGACGG - Intergenic
997264254 5:132485951-132485973 CTGAGGGTGAGGAAGGAAGTAGG - Intronic
997816739 5:137026610-137026632 GTGTGTGTGTGGACAGAAAAAGG - Intronic
998052897 5:139051185-139051207 GTGTGTGTGTTCAAGGGAGAGGG - Intronic
998128754 5:139640661-139640683 CTGTGTGTGGGGAGGAATGAGGG + Intergenic
998298339 5:140993449-140993471 GTGTGTGTGAGAAAGAAAGAAGG - Intronic
998679037 5:144444201-144444223 CTTTGTGTGTGGAGGGGGGAGGG - Intronic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
998816280 5:146017442-146017464 CTGTGAGTGTGGGAGGCAGAGGG - Intronic
998921992 5:147079686-147079708 CTGGGAGGGTGGTAGGAAGATGG + Intronic
999254235 5:150200929-150200951 CTGGGTGTGTGAAGGGAGGAGGG + Intronic
999379442 5:151109989-151110011 TTGTGCTTGAGGAAGGAAGAGGG - Intronic
999525280 5:152398679-152398701 ATGTGAGTGTGGAAGGTAGAGGG - Intronic
999623953 5:153500600-153500622 GTGTGTGTGTGTATGTAAGAGGG - Intronic
999748586 5:154609988-154610010 GTTTGTGTGTGGCAGGAACATGG - Intergenic
999842451 5:155443475-155443497 GTGTGTGTGTGCTAGGGAGATGG + Intergenic
1000245769 5:159447281-159447303 ATGTGTTTGTGGAGGAAAGAAGG + Intergenic
1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG + Intergenic
1000806143 5:165795112-165795134 CTGTGTGTGTGGTACCAAAAAGG + Intergenic
1000926663 5:167202646-167202668 CTGTGTGACTGGGAGGATGATGG - Intergenic
1001670490 5:173469452-173469474 CTGTCTCTGTGGATGGAAGAGGG - Intergenic
1001750428 5:174126064-174126086 GTGTGTGTGTGGATGGGAGATGG - Intronic
1001930852 5:175672054-175672076 GTGTGTGTGTGGAGGGGTGAAGG - Intronic
1002105702 5:176878577-176878599 CTGTGGGTGTGGCAGGTGGAGGG + Exonic
1002321344 5:178377819-178377841 CTGTGTGTGTGGCAGGAGCTGGG + Intronic
1002384346 5:178855131-178855153 TTGTGTGTCTGGCAGGGAGAAGG - Intergenic
1002513282 5:179737257-179737279 CTGTGTCTCTGCTAGGAAGAGGG + Intronic
1002599930 5:180348295-180348317 CTGTGTGTGTTGGGGGAAGAGGG + Intronic
1004086375 6:12453474-12453496 CTGAGTGTGAGGCAGGAAGAGGG + Intergenic
1004367018 6:15021243-15021265 GTGTGTGTGTGGCAGGCACATGG - Intergenic
1004613825 6:17270822-17270844 GTGTGTGTGTGTAAGGAAAGTGG + Intergenic
1004980906 6:21022599-21022621 TTGTGTGTGAGGAGGGAAGGGGG + Intronic
1005364138 6:25060505-25060527 GTGTGTGTGTGGAAAGGGGAGGG + Intergenic
1005611016 6:27525238-27525260 GTGTGTGTGTTGGAGGTAGAGGG + Intergenic
1005639180 6:27778524-27778546 CTGTAAGTATGGAAGGAGGAGGG - Intergenic
1005882155 6:30070065-30070087 CTCTGGGAGAGGAAGGAAGAGGG + Exonic
1006405075 6:33840338-33840360 CTCTGTGTGTGCGTGGAAGAGGG - Intergenic
1007098811 6:39230607-39230629 GTGTGTGTGTGGCGGGGAGAGGG - Intergenic
1007181455 6:39932106-39932128 TTGTTTGTGTGGCAGGATGAGGG - Intronic
1007352477 6:41283956-41283978 GTGAGTGGGAGGAAGGAAGAGGG + Intronic
1007475052 6:42114050-42114072 TGGTGTGTGTGGGAGGAAGACGG + Intronic
1007693672 6:43718460-43718482 CTGTGTGTGGTGTAGGGAGATGG + Intergenic
1007907595 6:45477927-45477949 GTGTGTGGGTGGAAGGCAGTTGG - Intronic
1008042974 6:46821472-46821494 GTGTGTGTGTAGAAGGAAGAAGG + Intronic
1008447773 6:51613038-51613060 CTGTTTGTGAACAAGGAAGAGGG - Intergenic
1008646229 6:53517668-53517690 GTGTTTGTGTGGAAGGGAGAAGG + Intronic
1009512114 6:64566012-64566034 CTGTGTGTGTGCAAGAAATCTGG + Intronic
1009547605 6:65041295-65041317 TTGTGTGTCTGGCAGGAAGCTGG - Intronic
1010029343 6:71256918-71256940 CTATGTATGAGTAAGGAAGAGGG + Intergenic
1010487635 6:76434450-76434472 CTGTGTATGTGGAAGGGAATTGG + Intergenic
1011236069 6:85218524-85218546 CTCTGTTTGTGGAAAGGAGAGGG + Intergenic
1011488627 6:87868760-87868782 CTGGGTGAGAGGAGGGAAGAAGG - Intergenic
1012096640 6:94970862-94970884 GTGTATGTGGAGAAGGAAGAGGG + Intergenic
1012405792 6:98896271-98896293 GTGTGTGTATCAAAGGAAGAAGG + Intronic
1012426629 6:99122066-99122088 CTGTCAGTGAGGAAGGGAGAAGG - Intergenic
1012742446 6:103035559-103035581 CTGTTTGTGTGAAAGTAAAATGG - Intergenic
1012881574 6:104797386-104797408 GGATGTGTGTGGTAGGAAGAAGG - Intronic
1012978588 6:105806320-105806342 TTGTATGTGTGTAAGGAGGAAGG - Intergenic
1013067505 6:106698092-106698114 CTGTGAGTCTAGAAGCAAGATGG + Intergenic
1013524131 6:110958882-110958904 CTGTGTGTGGGGAAGGGAGTTGG + Intronic
1013601564 6:111709982-111710004 CTGTATGTGTTTAAGGAAAATGG + Intronic
1013644116 6:112118735-112118757 GTGTGTGTGTGTAAGAAAAATGG + Intronic
1013680709 6:112522411-112522433 CTGTGAGGCTAGAAGGAAGATGG - Intergenic
1014125205 6:117769278-117769300 GTGTGTGTATGCAAGGAATAGGG - Intergenic
1014694859 6:124607645-124607667 GTGTGTGTGTATAACGAAGATGG - Intronic
1014757044 6:125312880-125312902 CTGTGTGTGTGCATGTTAGAGGG - Intergenic
1015692243 6:135937926-135937948 CTGGTTTTGCGGAAGGAAGAAGG - Intronic
1016678468 6:146799716-146799738 ATGTGTGTGTAGGAGGAAGGGGG + Intronic
1016705223 6:147099309-147099331 GTGTGTGTGCAGAAGGAAGATGG - Intergenic
1017062116 6:150493564-150493586 GTGTGTGTGTAGAGGGGAGAGGG + Intergenic
1017661916 6:156683351-156683373 CTTTGAGTGTGGAGAGAAGAGGG - Intergenic
1017865738 6:158441760-158441782 GTGTGTGTGGGAAGGGAAGATGG - Intronic
1018433943 6:163744535-163744557 CGGTGTGTAAGGAAGGAACATGG + Intergenic
1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG + Intergenic
1018660794 6:166085708-166085730 CTTTTTTTGTGGAAGAAAGAAGG + Intergenic
1019067602 6:169315441-169315463 GTGTGTGTGTGGACGGAGGGAGG - Intergenic
1019067638 6:169315757-169315779 GTGTGTGTGTGGACGGAGGGAGG - Intergenic
1019086999 6:169487937-169487959 CTGTGTCTGTGGGAGTAAAAGGG - Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1019911401 7:4102504-4102526 CTGCGTGTGGGGAAGGGAGGAGG - Intronic
1020375674 7:7482919-7482941 GTGTTTGTGTGGTGGGAAGAAGG + Intronic
1020789184 7:12604728-12604750 GTGTGTGTGTGTAAGGCAGCAGG + Intronic
1020877674 7:13718511-13718533 GTGTGTGTGTGGTGGGGAGAAGG + Intergenic
1020907749 7:14085672-14085694 CTGTGCTTCTGGAAGGGAGAAGG - Intergenic
1021337433 7:19420856-19420878 CAGTGTTGGTGAAAGGAAGAAGG + Intergenic
1022489364 7:30804960-30804982 ATGTGTGAGTGGTGGGAAGAGGG + Intronic
1023245720 7:38201423-38201445 GTGGGTTTGTGGAAGGAAAAAGG + Intronic
1023519243 7:41034253-41034275 ATGAGTGTGTGCAAGGGAGAAGG + Intergenic
1023968794 7:44977188-44977210 CTGAGAGTGGAGAAGGAAGAAGG + Intronic
1024089657 7:45924730-45924752 CTGTGTGCCTGGAGGGACGAGGG + Intergenic
1024148784 7:46545356-46545378 ATGTGTGTGTGAAAGAGAGAGGG - Intergenic
1024943475 7:54785509-54785531 ATGTGTGTGTGGTAGGGACAGGG - Intergenic
1024963386 7:55001856-55001878 AGGTGTCTGTGGAAGGAGGATGG - Intergenic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026157783 7:67842270-67842292 ATGTGAGGGTGGAAGGTAGAGGG + Intergenic
1026197826 7:68188241-68188263 GTGTGTGTTGGGAAGGGAGAGGG - Intergenic
1026421614 7:70242967-70242989 CTGAATGTGTGGAAGGCAGTAGG - Intronic
1026449619 7:70516270-70516292 GCGGGTGTGTGGAAGGAGGAGGG - Intronic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1027026075 7:74852501-74852523 CTATGTGTGTTGAGGGGAGATGG + Intergenic
1027061681 7:75091618-75091640 CTATGTGTGTTGAGGGGAGATGG - Intergenic
1027516663 7:79150059-79150081 ATGTTTGTGTGGCAGAAAGATGG + Intronic
1027533581 7:79367140-79367162 ATGGGTAAGTGGAAGGAAGAGGG - Intronic
1028399625 7:90410703-90410725 TTGTGGGGGTGGAAGGAGGAGGG + Intronic
1028775153 7:94667286-94667308 CTCTGTGTGTGGCAGCAAAATGG - Exonic
1029373483 7:100164254-100164276 GTGTGTGTGTGCATGTAAGAGGG - Intronic
1030061315 7:105623546-105623568 GTGTGTGTGTTGAAGGAAAGAGG - Intronic
1030232732 7:107225032-107225054 CTGTGTGTGTGTATGTATGAGGG + Intronic
1030607430 7:111652574-111652596 GTGTGTGTGTGTTAGGATGAAGG - Intergenic
1030655453 7:112162540-112162562 GTGTGTGGGTGGCAGGGAGAGGG - Intronic
1031044018 7:116866906-116866928 TTGTGTGAGAGGAAAGAAGATGG - Intronic
1031077319 7:117225464-117225486 GACTGTGTGGGGAAGGAAGATGG + Intronic
1031284331 7:119844724-119844746 GTGTGTGTGTGGGTGGAAGGCGG + Intergenic
1031962682 7:128004075-128004097 ATGTATTTGTGGGAGGAAGATGG + Intronic
1032068821 7:128791605-128791627 CTGGGGGTCTGGAAGGAGGAGGG - Intronic
1032667279 7:134049296-134049318 ATGGGTGAGTGGAAGGATGAAGG - Intronic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033111634 7:138583669-138583691 CAGTGTGTGTGGAAGGCAGTGGG + Intronic
1033158346 7:138975279-138975301 TTGAGTGTGTGGATGCAAGAGGG + Intronic
1033218033 7:139508301-139508323 ATGAATTTGTGGAAGGAAGAAGG + Intergenic
1033492348 7:141855716-141855738 CTCTGTGTGGGGAAGGCATACGG - Intergenic
1033889226 7:145988304-145988326 TTGTGTGTGGAGAAGAAAGAGGG - Intergenic
1033902845 7:146163765-146163787 AAGTGTGTTTGTAAGGAAGAGGG + Intronic
1034428084 7:151025121-151025143 GTGTGTGTGTGGAGGGAAGTGGG - Intergenic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034581923 7:152050938-152050960 CTGTGTTTGGGGGAGGGAGAGGG - Intronic
1034694685 7:153043217-153043239 TTGTGTGTGTTGAAGGAAGGAGG - Intergenic
1034858968 7:154580190-154580212 GTGTGTGTGTGTAAGGGGGAGGG - Intronic
1034859154 7:154581420-154581442 CAGGGTGTGTGGGAGGAAGTGGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034986926 7:155522072-155522094 CTGTGTGTGTGGATGCATGTGGG - Intronic
1035272338 7:157727922-157727944 CTCTGAGTGTGGAAGGATGGAGG - Intronic
1035278954 7:157765466-157765488 GTGTGTGGGTGGATGAAAGAAGG - Intronic
1035279069 7:157765961-157765983 GTGTGTGGGTGGATGAAAGAAGG - Intronic
1035308777 7:157952019-157952041 CTGTGAGCTTGGGAGGAAGATGG - Intronic
1036175877 8:6538263-6538285 ATGTGTGTGTGTAAGACAGATGG - Intronic
1036285662 8:7442510-7442532 CTATGTTTGTGGAAAGAAGGAGG - Intergenic
1036335811 8:7869019-7869041 CTATGTTTGTGGAAAGAAGGAGG + Intergenic
1036776681 8:11617666-11617688 TTGGGGGTGTGGGAGGAAGAGGG - Intergenic
1036963743 8:13273718-13273740 GTGTGTGTGTGTAAGGGGGAAGG + Intronic
1037444949 8:18956090-18956112 CTGAATGAATGGAAGGAAGAAGG + Intronic
1037929108 8:22867018-22867040 CTGTGTGATAGGAACGAAGAGGG + Intronic
1038046264 8:23767969-23767991 AAGTGTGTGGGGAAGGAAGTAGG + Intergenic
1038271992 8:26082701-26082723 GTGTGAGTGTGGAAGCAGGAGGG - Intergenic
1038688444 8:29739777-29739799 CAGTGGGGGTTGAAGGAAGAGGG + Intergenic
1039129180 8:34242272-34242294 ATGTGTGTGTGTGAGCAAGAAGG + Intergenic
1039143464 8:34419355-34419377 ATGTGTGTGTGTAGGGGAGAGGG + Intergenic
1040879008 8:52183974-52183996 CTTTGTGTGTGCATGGAAAATGG + Intronic
1040969439 8:53117821-53117843 GTGTGTGTGTGGTAGGGAGAAGG + Intergenic
1040972305 8:53149458-53149480 CTGAATGTGTGGAAAGAAGCTGG - Intergenic
1041255436 8:55976477-55976499 CTGTGTGAGTGAAAGGGAGCGGG - Intronic
1041306835 8:56470488-56470510 CTGTGTGTGTGATGGGAATAAGG + Intergenic
1041351019 8:56947653-56947675 GTGTGTGTGTTGCAGGGAGAGGG - Intergenic
1041368004 8:57129830-57129852 ATCTGTTTGTGAAAGGAAGATGG + Intergenic
1041568906 8:59313574-59313596 CAGAGAGGGTGGAAGGAAGATGG - Intergenic
1042421659 8:68597592-68597614 GTGTGTGTGTGCACGGACGAAGG + Intronic
1042989808 8:74626441-74626463 CTCTGTGGATGGAAGTAAGAGGG + Intronic
1043151267 8:76719176-76719198 GTGTGTGTGTGTAAGAGAGAGGG + Intronic
1043708223 8:83379687-83379709 GTGTGTGTGTGGGAGGAATGTGG - Intergenic
1043968507 8:86505451-86505473 ATATGAGTGTGGAAGGCAGACGG + Intronic
1044392562 8:91669143-91669165 CTGGGCGTGTGGAGGGAGGAAGG - Intergenic
1044493550 8:92849283-92849305 CAGAGTCTGAGGAAGGAAGAAGG + Intergenic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1045192952 8:99901144-99901166 CTGTGTGTCTGAAAGGAGAATGG - Intergenic
1045252372 8:100492685-100492707 CCGTCTCTGTGCAAGGAAGAAGG - Intergenic
1045535927 8:103027839-103027861 CTGTGTGTGTGCAGGGAGGGTGG - Intronic
1045536996 8:103039718-103039740 CTGTGTGTGTGGGAAGGGGAAGG + Intronic
1045733377 8:105267227-105267249 CTTTGCCTGTGGAAAGAAGAGGG - Intronic
1045767155 8:105686958-105686980 CTGTGTGCGTAGAAGGAAGAGGG - Intronic
1045817746 8:106296455-106296477 TTGTAACTGTGGAAGGAAGATGG + Intronic
1046328166 8:112677247-112677269 CTGTGTGTGTGTAAGCATGGGGG + Intronic
1046621570 8:116533990-116534012 CTGCTTGTGTGGAAGGAGGAGGG + Intergenic
1046708412 8:117481095-117481117 ATGTGGATGTGGAAAGAAGAAGG + Intergenic
1046994550 8:120502868-120502890 CTGTGTATGTCTATGGAAGATGG - Intronic
1047095287 8:121618435-121618457 TAGTGAGTGTGGAAGGAATAAGG - Intronic
1047228649 8:122977393-122977415 CTCTGTATCTGAAAGGAAGAAGG + Intergenic
1047368873 8:124238357-124238379 CTGTATGTGAGGAGGGAAGGTGG - Intergenic
1047983244 8:130205174-130205196 CTATGTGAGAGGAAGGAAGAAGG - Intronic
1048460107 8:134614473-134614495 CTGTGTGTGTGTAAGGAGAATGG - Intronic
1048493724 8:134918353-134918375 CTGTGTGTGTGCATGCAACACGG + Intergenic
1048542140 8:135352232-135352254 CTCTGTGTGAGTCAGGAAGAAGG - Intergenic
1048707427 8:137169483-137169505 CTGTGTTTGTGGAACGAGGTTGG + Intergenic
1048765274 8:137836820-137836842 CTGTGTTGGGGGAAGGGAGAGGG - Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1049456093 8:142690103-142690125 GTGTGTGTGTGGAGGGGAGGCGG + Intergenic
1049499631 8:142955022-142955044 CTGTGAGGGTGTAAGGAAGGGGG - Intergenic
1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG + Exonic
1051226377 9:14903665-14903687 CTATGTGTTTTGAAGGCAGAAGG + Intronic
1051475795 9:17507823-17507845 CTGTGTCTGCTGAAGAAAGAAGG - Intergenic
1051543131 9:18243733-18243755 CTGGGTCTGTGGACAGAAGATGG - Intergenic
1052078249 9:24171938-24171960 GTGTGTGTGTGGCAGGGGGAGGG + Intergenic
1052354470 9:27490068-27490090 CTTTGTGTGTGCAATGCAGAGGG - Intronic
1052756345 9:32546343-32546365 CTGTGTGTGTGGTAGAGGGAAGG + Intronic
1053136016 9:35650638-35650660 CTGTGGATGTGAAAGGAAGGGGG + Intronic
1053189565 9:36050905-36050927 ATGTGTGTGTGGAAGTGAGTGGG - Intronic
1053480624 9:38414024-38414046 GTGTGTGTGTGTGAGAAAGAGGG - Intronic
1053548842 9:39053821-39053843 ACATGTGTGTGGCAGGAAGAGGG - Intergenic
1053661343 9:40283653-40283675 AGGGGTGTGTGGAAGGCAGAAGG + Intronic
1053729442 9:41037971-41037993 CTGTATGAGGGGTAGGAAGAAGG - Intergenic
1053812960 9:41873889-41873911 ACATGTGTGTGGCAGGAAGAGGG - Intergenic
1053904872 9:42831414-42831436 TTGTGTGTGTGTAAGAGAGAGGG - Intergenic
1053911718 9:42912999-42913021 AGGGGTGTGTGGAAGGCAGAAGG + Intergenic
1054337870 9:63823833-63823855 CTGTGTGTGTAGTAGGTACACGG - Intergenic
1054373462 9:64429871-64429893 AGGGGTGTGTGGAAGGCAGAAGG + Intergenic
1054523267 9:66092631-66092653 AGGGGTGTGTGGAAGGCAGAAGG - Intergenic
1054617635 9:67313550-67313572 ACATGTGTGTGGCAGGAAGAGGG + Intergenic
1054699067 9:68394095-68394117 CTGTATGAGGGGTAGGAAGAAGG + Intronic
1054743925 9:68835294-68835316 CTGCTGGTGAGGAAGGAAGACGG - Intronic
1055058550 9:72045935-72045957 GTGTGTGGGGGGAAGGAAGGTGG + Intergenic
1055521380 9:77084370-77084392 GTGTGTGTGTGTTATGAAGAGGG + Intergenic
1055762344 9:79622341-79622363 ATGTCTGTGTGGCTGGAAGAGGG - Intronic
1056740223 9:89248083-89248105 CTGTGAGGTTGGAAGAAAGACGG + Intergenic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057400823 9:94721458-94721480 CTGTGAGGCTGGAAGCAAGATGG + Intergenic
1057483838 9:95466552-95466574 CTGTGTGTGGGTGAGGAAGGGGG + Intronic
1057581189 9:96289221-96289243 ATGTGTGTGTGTATGGAAGTGGG + Intronic
1057791399 9:98127364-98127386 TTGTGGGGGTGGAAGGGAGAGGG + Intronic
1057857707 9:98614721-98614743 TTGTTTCTGTGGAGGGAAGAAGG + Intronic
1058113540 9:101058076-101058098 CTAGGTGTGTTCAAGGAAGAAGG - Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059172814 9:112142576-112142598 GTGTGTGTGTGTGAGGAATAGGG - Intronic
1059287840 9:113191711-113191733 TTGTGTGTGTGAAAGGAGGGAGG + Intronic
1059510328 9:114839391-114839413 CTGTCTGTGTGGAGGCCAGAGGG + Intergenic
1059815959 9:117915398-117915420 ATGTGTGTGTGGTAGGTAGAGGG + Intergenic
1060200474 9:121649392-121649414 GAGTGTGTGTGGAGGGGAGAGGG - Intronic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1060237050 9:121871856-121871878 CTTTGAGTGTGGAAGGGAGCTGG - Intronic
1060925864 9:127454696-127454718 CTGTGGGTGGGGGAGGCAGATGG - Intronic
1061652000 9:132058219-132058241 CTCTCTGTGAGGTAGGAAGAGGG - Intronic
1061872897 9:133530098-133530120 CTGTGTGTGTGCTGGGAGGACGG + Intergenic
1062106383 9:134757225-134757247 CTGTGTGTGTGGCATGAATGAGG + Intronic
1062288505 9:135784392-135784414 CTGTGTGTGTGTATGCATGAGGG + Intronic
1062445270 9:136591052-136591074 CTGAGTGTGTGGTTGGAGGAAGG + Intergenic
1062451307 9:136616877-136616899 ATGAGTGTGTGGAAGGATGTCGG + Intergenic
1202784659 9_KI270718v1_random:37432-37454 CTGTGTGTGTAGTAGGTACATGG + Intergenic
1185622987 X:1464788-1464810 GTGTGTGTGTGGGGGGAAGTGGG + Exonic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1186068828 X:5795542-5795564 ATGTGTTTGTGGAAGCAAGGAGG - Intergenic
1186148406 X:6648607-6648629 TTGTGTGTGTGGCAGGGGGATGG + Intergenic
1186265924 X:7833777-7833799 CTGTGTGTGTGGGTGGGAGGAGG - Intergenic
1186270341 X:7879886-7879908 TTCTGAGTGTGGAAGGAGGAAGG - Intergenic
1186394045 X:9189888-9189910 GTGTCTGTGTGGGAGGAAGCAGG + Intergenic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1187391359 X:18888436-18888458 CTGTGTGTCAGGAGTGAAGAGGG - Intergenic
1187955064 X:24509477-24509499 ATGTGTGTGTTGGGGGAAGAGGG - Intronic
1189499184 X:41539111-41539133 CTGTGTGTGTGGGAGTTAGAGGG + Intronic
1189657093 X:43255839-43255861 ATGTGTGTGTTGAAGCAGGAGGG - Intergenic
1189883529 X:45515977-45515999 CTGTGTGGGTGAAAGGGAGCAGG + Intergenic
1190374284 X:49774368-49774390 CTCTGCCTGTGGAAGGAGGAGGG - Intergenic
1192229372 X:69254617-69254639 CTGGGGGTGGGGAAGGGAGAAGG + Intergenic
1192229542 X:69255735-69255757 CTGTGTGTGCGGAAGAACAAAGG - Intergenic
1192538634 X:71949819-71949841 CTTGGTATGTGGAAGGCAGAGGG - Intergenic
1192576683 X:72248340-72248362 CAGTGTGTGTCAAAGGAATAAGG - Intronic
1193442270 X:81557036-81557058 GTGTGTGTGTGGGAGGGGGAAGG - Intergenic
1193943550 X:87705815-87705837 TTATGTGTGTGAAAGGTAGAGGG - Intergenic
1194249977 X:91562729-91562751 CTGTGTCTCTGGGTGGAAGAGGG + Intergenic
1194852678 X:98888758-98888780 CTGCATGTGTGGCATGAAGAGGG - Intergenic
1195438668 X:104875733-104875755 CTGTATGTGTGTAAGGTGGATGG - Intronic
1195967876 X:110445484-110445506 CTGTGGGGGAGGAAGGAAGTGGG + Intronic
1196025134 X:111034027-111034049 TTGTGTGTATGGCAGGGAGAGGG - Intronic
1196050514 X:111298966-111298988 GTGTGTGTGTGTAAGAAGGAGGG + Exonic
1197170344 X:123426924-123426946 CTGTGTGTGGGGGTGGAAGGGGG + Intronic
1198621898 X:138521751-138521773 TTGTGTGTGTGAAAGGCAGTAGG - Intergenic
1198828582 X:140724780-140724802 CTGTGTGTATGGAATGAGTATGG - Intergenic
1199860750 X:151798734-151798756 CTGTGTGTCTGGAATTAGGAGGG + Intergenic
1199864111 X:151827636-151827658 CTGTGGGCCTGGAAGGAAGGAGG - Intergenic
1200568940 Y:4803978-4804000 CTGTGTCTCTGGGTGGAAGAGGG + Intergenic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic
1201645809 Y:16230323-16230345 CTATGTGTGTGGATGGATGCTGG + Intergenic
1201657004 Y:16354993-16355015 CTATGTGTGTGGATGGATGCTGG - Intergenic
1201790316 Y:17832590-17832612 TTGTGTGTGGGGAAGGACGTTGG - Intergenic
1201811238 Y:18073399-18073421 TTGTGTGTGGGGAAGGACGTTGG + Intergenic
1202518816 Y:25667778-25667800 TTGTGTGTGGGGAAGGACGTTGG + Intergenic