ID: 1119601713

View in Genome Browser
Species Human (GRCh38)
Location 14:75981134-75981156
Sequence GTGTCTAAACAGGTTTTGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119601709_1119601713 4 Left 1119601709 14:75981107-75981129 CCTTGTAGCGCTGGGATTCTTGT 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1119601713 14:75981134-75981156 GTGTCTAAACAGGTTTTGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119601713 Original CRISPR GTGTCTAAACAGGTTTTGCT GGG Exonic
900108719 1:996870-996892 GTGCCTAAGCAGGTTCTGGTGGG + Intergenic
901911898 1:12465652-12465674 GTGTCTTAACAGATTTTGGGTGG - Intronic
906928205 1:50141666-50141688 GTGGCTGAATAGGCTTTGCTGGG + Intronic
907193816 1:52670141-52670163 GTGTATAAACATATTTTTCTAGG - Intergenic
907900167 1:58733872-58733894 GTGTCTCATCATGTTTCGCTTGG + Intergenic
917938884 1:179896403-179896425 GTGTTTAAAAATGTTTGGCTGGG - Intronic
917980447 1:180265931-180265953 GTGTGTGAAAAGGTGTTGCTGGG + Intronic
922247371 1:223813610-223813632 GTGTCTAGACAAATTTTTCTAGG - Intronic
1063601541 10:7485755-7485777 TTGTCTAAACAGGGATTTCTTGG + Intergenic
1064307909 10:14185118-14185140 GTGTCTGAACAGGTTTTCCCAGG + Intronic
1068266899 10:54661962-54661984 ATGTCTAAAGAGGTTTTCCTAGG - Intronic
1072071906 10:91926022-91926044 GTGTCTCAAAATGTTTTCCTTGG - Intronic
1072582344 10:96750354-96750376 GTGGCTAAACAGGTACTGCTGGG + Intergenic
1074171051 10:110937145-110937167 GTGGCTAAACAGGTACTGCTGGG - Intronic
1078781162 11:14440823-14440845 GTGGCTAAGCAGGTACTGCTGGG + Intergenic
1080962384 11:37175552-37175574 TTGAACAAACAGGTTTTGCTGGG + Intergenic
1085634281 11:78146215-78146237 GTGTATCAGCAGGTTTTGCCTGG - Intergenic
1088675952 11:112193340-112193362 CTGACTAATCAGGTTGTGCTGGG + Intronic
1089600070 11:119608562-119608584 GTGTGTGCACAGGTTTAGCTGGG - Intergenic
1091758531 12:3072060-3072082 GTGGCTAAGCAGGTACTGCTGGG - Intergenic
1092879296 12:12875565-12875587 GTGGCTAAACAGGTACTGCTGGG + Intergenic
1096421751 12:51464624-51464646 GTGTCTAAGAAGGTTCTGCTGGG + Intronic
1096658603 12:53106945-53106967 ATGATTAAACAAGTTTTGCTGGG - Intronic
1097255946 12:57674731-57674753 GTGGCTAAGCAGGTGCTGCTGGG + Intergenic
1098888186 12:75981573-75981595 GTGTCTCAACAGGTTTTCCATGG - Intergenic
1101105371 12:101435240-101435262 GTGTGAATACAGGTTGTGCTTGG - Intergenic
1101564079 12:105888940-105888962 GTGTCTAAGCTGCCTTTGCTGGG + Intergenic
1101836315 12:108298181-108298203 GTTTCTGCACTGGTTTTGCTTGG + Intronic
1104975883 12:132551813-132551835 GTGTCTAACCACTTTTTCCTTGG + Intronic
1106306822 13:28519389-28519411 ATGTCTAAAGAGCTTTTCCTAGG - Intergenic
1107976904 13:45697295-45697317 GTTTTTAAATAGGCTTTGCTGGG + Intergenic
1108302931 13:49098194-49098216 GTGTCAAAAAGGGTTGTGCTAGG - Intronic
1108828148 13:54441227-54441249 GTGGCTAAACAGGTACTGCTGGG - Intergenic
1109560984 13:64049865-64049887 GTGGCAAAACAGGTTCTGCTGGG + Intergenic
1109794597 13:67293799-67293821 TTGTCTCAACATGTTTTGTTTGG - Intergenic
1110134972 13:72055481-72055503 GTGCCTATACAAGCTTTGCTGGG - Intergenic
1112551973 13:100429947-100429969 GTGGGTAAACAGGTTTTCATTGG - Intronic
1112923633 13:104646244-104646266 GTGTCTAGTCAGGTTTGGGTTGG - Intergenic
1114066990 14:19068915-19068937 ATGTCTATTCAGGTTTTGTTTGG + Intergenic
1114095276 14:19331113-19331135 ATGTCTATTCAGGTTTTGTTTGG - Intergenic
1114360219 14:21963610-21963632 GTGCCAAAACAGCTCTTGCTTGG - Intergenic
1116620812 14:47201016-47201038 GTGGCTAAACAGGTACTGCTGGG - Intronic
1117520919 14:56550556-56550578 GAATCTAAACAGGCCTTGCTGGG + Intronic
1119601713 14:75981134-75981156 GTGTCTAAACAGGTTTTGCTGGG + Exonic
1119816223 14:77570815-77570837 GTGTAAAAGCAGATTTTGCTAGG - Intronic
1126349058 15:47725593-47725615 ATGTCTAAACAGGTTATCTTGGG - Intronic
1126994243 15:54421563-54421585 TTGTCAAAACAGGAATTGCTGGG - Intronic
1127238207 15:57080077-57080099 GTAACTAATCAGGTTTTTCTTGG - Intronic
1128318474 15:66676335-66676357 GTGTCTAGACATGTTTGGGTGGG + Intronic
1131655860 15:94457960-94457982 GTGACTGAACAGATTTTTCTGGG + Intronic
1138102757 16:54267583-54267605 GTGTCTAAGAAGGCTTTCCTTGG + Intronic
1138802178 16:60046943-60046965 ATGCATAAACAGATTTTGCTTGG + Intergenic
1144074899 17:11708539-11708561 GAGTCTTAACAGGTGTTACTTGG + Intronic
1146723638 17:35140527-35140549 GTGACTTAAAAGGTCTTGCTAGG - Intronic
1156578270 18:38345194-38345216 GTGTCTAGAATGGTTTTCCTAGG - Intergenic
1157547566 18:48557217-48557239 GTCTCCAAACAAGTTTTGCAGGG - Intronic
1158727486 18:59986736-59986758 GTGTCTTATCAGGTATTGGTAGG + Intergenic
1158867830 18:61655008-61655030 GGCTCTCAAAAGGTTTTGCTGGG + Intergenic
1167437785 19:49489901-49489923 GTGGCTAAACAGGTACTGCTGGG + Exonic
927232786 2:20841844-20841866 GTGTCTAAACTGGGTTTGTTTGG + Intergenic
939577493 2:143913835-143913857 TTGTCTTGACAGGTTTTGCTTGG + Intergenic
943197351 2:184771377-184771399 GTGTCCAGACAGGTTTTGCTGGG + Intronic
944352477 2:198745217-198745239 TTGTCTAAGCAGCATTTGCTGGG - Intergenic
947192319 2:227519948-227519970 GTCTGTAAACAGATTTGGCTAGG + Exonic
947239203 2:227976145-227976167 GTGCACAAACAAGTTTTGCTGGG + Intergenic
948399801 2:237675258-237675280 GCCCCTAAACAGGTGTTGCTTGG - Intronic
1177757174 21:25361887-25361909 GTGGCTAAACAGGTACTGCTGGG + Intergenic
1180028644 21:45185234-45185256 GGTTCTAAACAGGTGCTGCTGGG + Intronic
1180485467 22:15791499-15791521 ATGTCTATTCAGGTTTTGTTTGG + Intergenic
1184082718 22:42235497-42235519 TTTTCTAAACATGTTTTTCTTGG - Intronic
949684084 3:6548381-6548403 GTACCAAAACAGGTTTTTCTAGG + Intergenic
955084548 3:55690036-55690058 GTGTCTAAAAAGGATCTGATGGG + Intronic
956065061 3:65389234-65389256 GTGTCTAAAAAGTTTTCACTAGG - Intronic
960627162 3:119692344-119692366 GAGTCTATACAGATTTTCCTTGG - Intergenic
960801888 3:121548340-121548362 GTGTCTAAACTCGTGTTCCTTGG + Intergenic
961771307 3:129252166-129252188 TTGTCTAAACAGGGCTTTCTGGG - Intronic
962119197 3:132544296-132544318 GAGTCTAAACAGACCTTGCTGGG - Intergenic
963471296 3:145745428-145745450 GTGTATATACACGTCTTGCTGGG - Intergenic
964422265 3:156516175-156516197 GTGTTTAAACAGAATTTGGTAGG - Intronic
965396649 3:168167172-168167194 GTTTCTAAAAAGGTTTTATTGGG + Intergenic
965760662 3:172072584-172072606 ATGTCAAAGCAGTTTTTGCTTGG - Intronic
966102719 3:176292843-176292865 GTGTCTAAACAGTTTGAGATAGG - Intergenic
967302500 3:188029221-188029243 TTGTGTAAACATGTTTTGCCGGG - Intergenic
968550234 4:1218709-1218731 GAGTCTTCACAGGTTATGCTGGG + Intronic
971160726 4:24130949-24130971 GAATCTCAGCAGGTTTTGCTGGG - Intergenic
971176571 4:24288035-24288057 GTTTCTAAAGAGGGTTTACTTGG - Intergenic
971786646 4:31112329-31112351 GTGTCTTAAAATGTTTTCCTTGG + Intronic
973534148 4:51864392-51864414 GTGTTTAAATAATTTTTGCTAGG - Intronic
973859868 4:55052519-55052541 CTGTAAAAACAGGTCTTGCTAGG + Intergenic
974338029 4:60576732-60576754 ATATCTTAAAAGGTTTTGCTTGG - Intergenic
977710036 4:100114214-100114236 GTATCTGGACAGGCTTTGCTGGG + Intergenic
980635920 4:135502908-135502930 GTGTCTAATAATATTTTGCTGGG - Intergenic
982094713 4:151911405-151911427 GAATCTAGACAGGTCTTGCTGGG + Intergenic
983999058 4:174218231-174218253 GTTGCGAAAAAGGTTTTGCTTGG + Intergenic
984976700 4:185237308-185237330 CTGTCAAACCAGGTTTTGTTTGG + Intronic
988538141 5:32087193-32087215 GTGTCTACAGAGGTCTTGCTGGG - Exonic
989382314 5:40821577-40821599 GTGTTCAAACAAGTTTTGATTGG + Intergenic
992108767 5:73472745-73472767 GGGTCTAAACAGGTTGTCTTGGG - Intergenic
993118571 5:83746901-83746923 GTGGCTAAACAGGTACTGCTGGG - Intergenic
993535233 5:89075993-89076015 GTCTCTAAACGTGTTTTGATTGG + Intergenic
998152037 5:139763106-139763128 GTGCCTGAACAGGCTCTGCTGGG + Intergenic
999280271 5:150360624-150360646 TTGTCTAAAAAGGTTTTAGTTGG + Intronic
999900739 5:156084120-156084142 GTGTCTACAAAAATTTTGCTTGG + Intronic
1000039527 5:157474754-157474776 GTGATTAAACTGGTTTTTCTAGG + Intronic
1000676036 5:164123697-164123719 TTAACTAAATAGGTTTTGCTTGG + Intergenic
1000879568 5:166681755-166681777 TTATCCAAACAGGTTTTTCTTGG + Intergenic
1005161667 6:22871381-22871403 GGATCTAAACAGGCCTTGCTGGG - Intergenic
1005751693 6:28888963-28888985 ATGTCTAAAAAGGTTCTGATGGG + Intergenic
1006064117 6:31449646-31449668 GTCTCAACACAGGTTTTGCAGGG - Intergenic
1012188930 6:96257037-96257059 CTGTCTAAACAGATTTTTATAGG - Intergenic
1012624174 6:101386673-101386695 GTTTCTAAACAAGTCTTGGTTGG + Intergenic
1014364986 6:120528569-120528591 TTGTGTAAACAGGTTTTATTGGG + Intergenic
1020407383 7:7852879-7852901 GTGAACAAACAGGTCTTGCTGGG - Intronic
1021740892 7:23684155-23684177 GGGACTAAACAAGTTTTACTGGG - Intronic
1025725082 7:64050361-64050383 GTGGGTAAACAGGTTTTTTTGGG - Intronic
1027550376 7:79585736-79585758 GTGGCTAAACAGCTTCTGCATGG + Intergenic
1027730671 7:81868329-81868351 ATGTTTAAAGAGGTTTTTCTAGG + Intergenic
1030286994 7:107837146-107837168 TTGTCTAAACAGGTTTAAATTGG + Intergenic
1031350427 7:120723915-120723937 GTGTAGAACCAGGTTATGCTGGG + Intronic
1035602926 8:907900-907922 GTTTTAAAACAGGTTTTGCCTGG + Intergenic
1038369515 8:26973845-26973867 GTGAGGAAACAGGTTTTGCGAGG - Intergenic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1041902191 8:62994528-62994550 GTGTCCAAACAGGTTTTATGAGG - Intronic
1041983678 8:63894194-63894216 CTCTCTAAACAGGCTCTGCTGGG - Intergenic
1042513691 8:69637648-69637670 GTTTCTAAAAAAATTTTGCTGGG + Intronic
1042934224 8:74042675-74042697 CTGTACAAACAGGTTTTGTTTGG - Intergenic
1045579168 8:103459892-103459914 GTTGCTAACCAGGTTTTGGTTGG + Intergenic
1045911872 8:107419409-107419431 CTGCATAAACAGGTTTTGCTAGG + Intronic
1046289221 8:112135282-112135304 TTGCCTACACAGGTTTTGATTGG - Intergenic
1046979819 8:120324943-120324965 GTTTCTAAACATTTTTTGGTAGG - Intronic
1047527880 8:125649227-125649249 TTTTTTAAACAGGGTTTGCTGGG - Intergenic
1052753814 9:32520735-32520757 GTGTCATAACAGGGTTTTCTTGG + Intronic
1057753724 9:97812567-97812589 GTGACTACACAGTTTTTGTTTGG - Intergenic
1060373735 9:123099602-123099624 CTGTATAAACAGGTTTTGGGAGG + Intronic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1189850387 X:45171320-45171342 GGGTCTAAACATGGTTTGCAGGG - Intronic
1190514496 X:51208764-51208786 GTGTTTAAACTGCTTTTTCTAGG - Intergenic
1192005684 X:67209641-67209663 ATGAGTAAACAGGTTTTGTTGGG + Intergenic
1192170564 X:68851950-68851972 GTGTGGGAACATGTTTTGCTGGG + Intergenic
1197159735 X:123309766-123309788 GTGTAGAAACAAGTCTTGCTGGG + Intronic