ID: 1119602109

View in Genome Browser
Species Human (GRCh38)
Location 14:75983044-75983066
Sequence CAGAGGCAAGCCCTGTGTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 300}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119602109 Original CRISPR CAGAGGCAAGCCCTGTGTTG CGG (reversed) Intronic
900322455 1:2091846-2091868 CAGATGCGCGTCCTGTGTTGGGG + Intronic
900511132 1:3061742-3061764 CAGAGCCTGGCCCTGTGGTGGGG - Intergenic
901850540 1:12012149-12012171 CTGAGGCGGGCCCTGTGCTGGGG + Exonic
903781210 1:25820999-25821021 CAGAGGTGGGCCCAGTGTTGGGG + Intronic
904093565 1:27961054-27961076 GAGGGGCAAGCGCTGTGGTGGGG - Intronic
904294890 1:29513712-29513734 CAGAGGCGAGCCTTCTGGTGGGG + Intergenic
905289657 1:36912571-36912593 CAAATGCAAGCCCTGTGAGGAGG - Intronic
905537709 1:38736272-38736294 CTGAGTCCAGGCCTGTGTTGGGG - Intergenic
906319474 1:44807405-44807427 GAGGGGAAAGACCTGTGTTGTGG + Intergenic
906390689 1:45412976-45412998 CAGAGTGAGGCCCTGTCTTGGGG + Intronic
906939081 1:50239994-50240016 CAGAGGGAAGCACAGTGGTGTGG + Intergenic
907240144 1:53076792-53076814 CAGAGATAGGCCCTGTGTTTAGG + Intronic
907551727 1:55310481-55310503 CAGAGGCAGGCCCCGTTTTGAGG + Intergenic
909752053 1:79173808-79173830 AAAAGGCAAGCCATATGTTGGGG - Intergenic
911999971 1:104820194-104820216 GAGAGGGCAGCCCTGTCTTGTGG + Intergenic
912047053 1:105471852-105471874 CAGAGGCAATCCATATTTTGGGG - Intergenic
912331861 1:108827432-108827454 CAGAGGAGAGCTCTGTGTAGAGG - Intronic
916462991 1:165046026-165046048 CAGAGGCAGGCTCTGTCTTTGGG - Intergenic
916786658 1:168091548-168091570 CACAGGGAAGCCCTGGGTGGTGG - Intronic
920170172 1:204067122-204067144 CAGAGGCAAGCACTGCCTTCAGG - Intergenic
920552746 1:206877757-206877779 CAGAAGTGAGCCCAGTGTTGGGG + Intergenic
921102953 1:211946689-211946711 CAGAGGCATGCTGTGTGCTGGGG + Exonic
922823458 1:228501125-228501147 GAGAAACAAGCCCGGTGTTGGGG - Intergenic
924572126 1:245246497-245246519 CAGAGGCAGGGCCTGGGTGGTGG - Intronic
1062896091 10:1104387-1104409 GAAAGGCAAGCCCTGTGCAGGGG - Intronic
1068410940 10:56653627-56653649 CTGTGGCAAGCCCAGTGTTGGGG - Intergenic
1069801283 10:71083449-71083471 CAGAGGAAAGTCCTGAATTGCGG - Intergenic
1071503183 10:86217880-86217902 CTGAGGCAGGCTCTGTGGTGTGG - Intronic
1072636393 10:97181226-97181248 CAGAGGCCTGCGCTGTGTAGGGG - Intronic
1073671353 10:105593717-105593739 CAGTGGGAAACCCTGGGTTGGGG - Intergenic
1074445572 10:113518635-113518657 CTGAGCCAGGCCCTGTGCTGAGG + Intergenic
1077063091 11:626254-626276 TCGAGGCAACCCCTGTGTAGCGG - Intergenic
1077496245 11:2887832-2887854 CAGAGTCAAACCCAGTGCTGTGG + Exonic
1077600201 11:3569400-3569422 CAGAGTCAAGGGCTGTGATGAGG + Intergenic
1077888713 11:6403937-6403959 CAGAAGCAGGAACTGTGTTGTGG - Intronic
1078095019 11:8291549-8291571 CAGAGACAAGGCCTGACTTGGGG - Intergenic
1078535595 11:12170890-12170912 CTGTGCCAAGCCCTGTGCTGGGG - Intronic
1080101772 11:28467546-28467568 GAGATGCAAGGACTGTGTTGAGG - Intergenic
1081193826 11:40136780-40136802 TACAGGCAAGCCCTCTGTTCTGG - Intronic
1082835739 11:57649118-57649140 CAAAGGCAAGCCGAGTGCTGGGG + Exonic
1083713110 11:64560662-64560684 CAGAGCCAGGCACTGTGATGAGG - Intronic
1083844358 11:65322146-65322168 CAGAGGCAAGCCCTCAGCTCTGG - Exonic
1084174696 11:67417256-67417278 GAGAGGAAAGGCTTGTGTTGGGG - Intronic
1084638715 11:70411511-70411533 CTGAGGCGAGCCCTGTGCTTAGG + Intronic
1084816640 11:71651283-71651305 CAGAGTCAAGGGCTGTGATGAGG - Intergenic
1085324273 11:75594798-75594820 GAGAGCCAAGCCCTGACTTGGGG + Intronic
1085635860 11:78159037-78159059 CACAGACAAGCACTGTGCTGAGG - Intergenic
1085907532 11:80782360-80782382 CAGAGGGAAGCTCTGTGCTTGGG + Intergenic
1086723331 11:90148625-90148647 CAGAGGCAAGCAATGGGCTGGGG + Intronic
1087275425 11:96156120-96156142 CAGATGGAAGCCCTGGGTTACGG - Intronic
1089336223 11:117725698-117725720 CAGGGGCCAGCCCTGTGTCTAGG - Intronic
1090387135 11:126363901-126363923 CAGAGGCAAGCTCTGGGCTGGGG - Intronic
1091055043 11:132410024-132410046 CAGAGGTAAGCTCTCTGATGAGG + Intergenic
1091798205 12:3309148-3309170 CAGAGGCAAGGCCAGTGCAGGGG + Intergenic
1092147818 12:6226923-6226945 CAGAAGGGAGCCCTGTGCTGGGG + Intronic
1092426348 12:8378762-8378784 CAGAGTCAAGGGCTGTGATGAGG + Intergenic
1092507456 12:9118466-9118488 CAGATGGAAGCCATGTGTTAAGG + Intergenic
1094419220 12:30253224-30253246 CAGAGGCCAGACCTGTCTTTGGG - Intergenic
1094643948 12:32302948-32302970 CAGAGTGAGGCCCTGTCTTGAGG - Intronic
1098477692 12:70924242-70924264 CACAGTAAAGCTCTGTGTTGAGG + Intergenic
1103331006 12:120154006-120154028 CTGAGGCAAACACTGTTTTGGGG + Intronic
1104183800 12:126408829-126408851 CAAAGGCAAGTGCTGTGTGGTGG + Intergenic
1105434378 13:20364173-20364195 CAGTGGCTAGTCCTGTGGTGTGG - Intergenic
1105883708 13:24624861-24624883 TGGAGGGAAGCCCTGCGTTGGGG + Intergenic
1106236181 13:27862467-27862489 GAGAGGCTACCCCTGGGTTGTGG + Intergenic
1109652848 13:65352766-65352788 CTGGAGCAAGCCCAGTGTTGGGG - Intergenic
1111454988 13:88469841-88469863 CAGAGGCAAAATCTGTTTTGTGG - Intergenic
1111987275 13:95077966-95077988 AAGTGGGAAGCCCTGGGTTGGGG + Intronic
1112432555 13:99363568-99363590 CAGGTGGAAGCCCTGTGCTGAGG - Intronic
1112753210 13:102602709-102602731 CAGAGGAAATACTTGTGTTGGGG + Intronic
1112896015 13:104301800-104301822 CAGATGCTAGCCCTGTGGTCTGG - Intergenic
1114046747 14:18882083-18882105 CTGAGGCCAGCCCTGTGGGGTGG - Intergenic
1114117466 14:19637364-19637386 CTGAGGCCAGCCCTGTGGGGTGG + Intergenic
1117435391 14:55711211-55711233 CAGAGCCAAGCCCCTGGTTGGGG + Intergenic
1118589620 14:67391751-67391773 CAGAGGCAAGCCGTGTCCTGCGG - Intronic
1119602109 14:75983044-75983066 CAGAGGCAAGCCCTGTGTTGCGG - Intronic
1119863995 14:77957740-77957762 CACAGGAAAGCCTTGTGGTGAGG + Intergenic
1120455688 14:84727550-84727572 CAGAGGCAAGAACAGAGTTGAGG + Intergenic
1121951047 14:98171537-98171559 AAGAGGCAAGCTCTGTGTGGTGG + Intergenic
1122117661 14:99535827-99535849 CAGAGGGAAGCCCAGAGGTGTGG + Intronic
1202934926 14_KI270725v1_random:78850-78872 CAGAGGCAAGCAATGGGCTGGGG + Intergenic
1124383828 15:29190023-29190045 CAGAGGCAGGCCCTGTCATCGGG + Intronic
1124504877 15:30264083-30264105 CAGTGCCAGGCCCTGTGCTGAGG + Intergenic
1124589021 15:31036844-31036866 CAGAGCAAAGCTCTGTGTGGGGG - Intronic
1124738675 15:32274552-32274574 CAGTGCCAGGCCCTGTGCTGAGG - Intergenic
1124962524 15:34409551-34409573 CAGAGGCAGCCACTGTGTGGAGG - Intronic
1124979148 15:34555773-34555795 CAGAGGCAGCCACTGTGTGGAGG - Intronic
1126262760 15:46713666-46713688 CAAAGGCAAAGACTGTGTTGGGG - Intergenic
1127848691 15:62894476-62894498 CAGAAGCCAGCCATGTGATGGGG - Intergenic
1128086186 15:64888370-64888392 CAGGAGGAAGCCCTGTGGTGGGG - Intronic
1129116047 15:73365990-73366012 CAGAGGCAAGCCCACTCTTCAGG + Intronic
1129312145 15:74720301-74720323 CAGAGGCAAGTCCAGGGTAGGGG + Exonic
1130262956 15:82373774-82373796 CAGAGGCAGGGGCTGTGTTAGGG - Intergenic
1132114341 15:99124797-99124819 CAGCCACAGGCCCTGTGTTGGGG + Intronic
1132851124 16:2025517-2025539 CAGAGGCGAGCCCTGTGCTTGGG + Intronic
1134573042 16:15308150-15308172 CAGAGGCAGATCCTGTGATGAGG - Intergenic
1134729340 16:16447806-16447828 CAGAGGCAGATCCTGTGATGAGG + Intergenic
1134938093 16:18264058-18264080 CAGAGGCAGATCCTGTGATGAGG - Intergenic
1136292173 16:29281562-29281584 GAGAGGCAATGCCTGTGTGGGGG - Intergenic
1136855720 16:33655564-33655586 CAGAGGGCAGCCCGGTGTTAGGG + Intergenic
1139112071 16:63904303-63904325 CAGGGGCTAGCCTTGTGTTTGGG + Intergenic
1140895374 16:79320064-79320086 CAGAAGGAAGGCCAGTGTTGAGG + Intergenic
1141646510 16:85370699-85370721 CAGTGTCCAGCCCTGGGTTGGGG - Intergenic
1141737373 16:85862527-85862549 CAGTGGCAGGCCCTGTCTTGGGG + Intergenic
1141744079 16:85914123-85914145 CAGAGATAAGCCCTGGGTGGTGG + Intronic
1141920751 16:87133885-87133907 CACAGGGAAGCCGTGTGTTGAGG - Intronic
1142068169 16:88074546-88074568 CAGTGGCCAGACCTGTGTTCTGG - Intronic
1142098062 16:88255515-88255537 GAGAGGCAATGCCTGTGTGGGGG - Intergenic
1142259247 16:89034910-89034932 GAGGGGCAGGGCCTGTGTTGAGG + Intergenic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1203117306 16_KI270728v1_random:1504045-1504067 CAGAGGGCAGCCCGGTGTTAGGG + Intergenic
1142882023 17:2889352-2889374 CAGTGCCAGGCCCTGTGCTGGGG + Intronic
1142968305 17:3594711-3594733 CAGAGTCCAGCCCTGCGCTGGGG + Intronic
1142969970 17:3604702-3604724 CAGAGGCAGGCAGTGTGTGGCGG + Intergenic
1144050771 17:11495552-11495574 CAAAGACAAGCCCTGTGTCCAGG + Intronic
1146281861 17:31549948-31549970 CAGAGTCAAGCCCGGGCTTGCGG + Intergenic
1146663855 17:34683568-34683590 GAGAGGCAAGGGCTGGGTTGGGG + Intergenic
1147455922 17:40538121-40538143 GAGAGGCAAGCCCAGGCTTGTGG - Intergenic
1149996413 17:61408275-61408297 CAGAGGCCAGCCCGGTGGTGAGG - Exonic
1150122969 17:62618659-62618681 CAGAGGCAAGCCCTGCTCTTAGG - Intergenic
1150673612 17:67224135-67224157 CTGAGCCAATCCCTGTGTTCAGG - Intronic
1150804296 17:68307083-68307105 CAGATGTAAGGCCTGTGCTGTGG + Exonic
1151719103 17:75845534-75845556 CAGAGGCCAGAGCTGTCTTGGGG + Intergenic
1152469648 17:80483629-80483651 TATTTGCAAGCCCTGTGTTGGGG - Intergenic
1152660494 17:81539784-81539806 CAGAGGCCACCCCGGTGGTGAGG + Intergenic
1153122840 18:1751434-1751456 GAGAGGCAGGCCCTCTGTTGGGG - Intergenic
1153238386 18:3010085-3010107 CAGTGGCAACCCATGTGTAGTGG - Intronic
1153444329 18:5154985-5155007 CAGAAACCAGCCCTGTGGTGTGG - Intronic
1155215053 18:23635870-23635892 CAGAGGCAGGCTCTGTGGTGGGG + Intronic
1155552594 18:26981595-26981617 CAGAGGCAAGCCCTGAGGGTTGG - Intronic
1155596093 18:27489281-27489303 GAAAAGCAAGCTCTGTGTTGAGG - Intergenic
1160263973 18:77322768-77322790 GAGAGGCAAGCCCCGTGGTCAGG + Intergenic
1160461968 18:79046373-79046395 CAGAGGCTTGCCCGGTGCTGTGG + Intergenic
1160574324 18:79842132-79842154 CAGAGGCCACCCTTGTGCTGGGG - Intergenic
1160859674 19:1232350-1232372 CAGTGGGAGACCCTGTGTTGTGG - Intronic
1161176070 19:2842588-2842610 CTGAGGCAACACCTGAGTTGGGG + Intronic
1161176228 19:2843822-2843844 CTGAGGCAGCCCCTGTGTTCGGG - Intronic
1161525905 19:4755036-4755058 CAGAGGCATGCCCGGTTCTGGGG + Intergenic
1162016609 19:7849743-7849765 CAGTGGCCAGCCCTGGGTTCAGG + Intronic
1163129700 19:15264839-15264861 CAAAGCCAGGCCCTGTCTTGGGG + Intronic
1163520264 19:17787894-17787916 CAGGGGCAAGCCCCGGGGTGTGG + Intronic
1165244439 19:34490187-34490209 CAGCGGCAATCCCTGGGTCGTGG + Intronic
1167349198 19:48964258-48964280 CAAAGAGAAGCCCTGCGTTGTGG - Intergenic
1167371692 19:49086254-49086276 CAGAGAACAGTCCTGTGTTGCGG - Intronic
1168050733 19:53827703-53827725 CCGGGGTAAGCCCTGTTTTGGGG + Intergenic
1168173763 19:54608208-54608230 AAGAGGAAAGCCCAGTGTTCAGG + Intronic
1168325177 19:55535193-55535215 CTGAGGCCAGCCCTGTGCTGGGG - Intronic
925237805 2:2294254-2294276 CTGAGGGGAGCCCTGTGGTGAGG + Intronic
925778338 2:7356657-7356679 CTTAGGTAAGCCCTGTGTTCAGG - Intergenic
927903810 2:26842990-26843012 CTCAGTAAAGCCCTGTGTTGTGG + Intergenic
929591449 2:43150125-43150147 CAGTGCCAAGCCCTGTGCTAAGG - Intergenic
930667672 2:54115674-54115696 CGGCGGCGAGCCCTCTGTTGAGG - Exonic
934306311 2:91825432-91825454 CAGAGGCAAGCAATGGGCTGGGG - Intergenic
934326945 2:92027310-92027332 CAGAGGCAAGCAATGGGCTGGGG + Intergenic
934465322 2:94257865-94257887 CAGAGGCAAGCAATGGGCTGGGG + Intergenic
934502326 2:94870673-94870695 CGGAGGCAGGTCCTGTGCTGCGG - Intergenic
934663949 2:96157498-96157520 CAGGGGCCACCCCTGTGTTCAGG - Intergenic
935296374 2:101653234-101653256 CAGAGGCAAGCCCAGGGTCCAGG + Intergenic
937718116 2:125058840-125058862 CAGAGGCTAGCCAGGTGTGGTGG + Intergenic
937989815 2:127655933-127655955 CAGAGGCAGGCCCTGCTGTGGGG + Intronic
938064877 2:128276480-128276502 CAGAGGCTAGCCCTGGGGTGTGG + Intronic
938266612 2:129932818-129932840 CTGAGGCCAGCCCTGTGGGGTGG + Intergenic
938328354 2:130428969-130428991 CATAGGTATGCCCGGTGTTGCGG - Intergenic
938361594 2:130692525-130692547 CATAGGTATGCCCGGTGTTGCGG + Intergenic
938732084 2:134154444-134154466 CACAGGCAAGCCCCGTTTTGGGG + Intronic
945534050 2:210989721-210989743 GAGAGGCAAGCCCTAAGTTTTGG - Intergenic
945942004 2:215959693-215959715 CAGAGGCAGACTCTGTGTGGAGG - Intronic
946434312 2:219641791-219641813 CAGAGCCCAGCCCTGGGCTGGGG + Exonic
948640216 2:239370997-239371019 CTGTGGGAAGCCCTGTGGTGTGG - Intronic
948842212 2:240657687-240657709 GAGAGGCTAGGCATGTGTTGGGG - Intergenic
949025215 2:241764628-241764650 CTGAGGCAGGACCTGAGTTGGGG + Intronic
1169009694 20:2239860-2239882 GAGAACCAAGCCCTGTATTGGGG - Intergenic
1169669618 20:8081905-8081927 CAGAGGAAAGCCCAGAGGTGGGG - Intergenic
1169971101 20:11270374-11270396 CAGAAGCAGGCCCTGTGATAAGG + Intergenic
1172068189 20:32236352-32236374 CAGAGCAAGGCCCTGTCTTGGGG - Exonic
1173809272 20:45946432-45946454 CAGAGGCGGGCCCTGTGCTCTGG - Intronic
1174267731 20:49344138-49344160 AAGAGGCCAGCAATGTGTTGGGG + Intergenic
1174579478 20:51561726-51561748 CAGAGGGGAGCACTGCGTTGGGG - Intronic
1174744413 20:53047367-53047389 CAGAAGGAAGCCTTGTGTTACGG - Intronic
1175515320 20:59566310-59566332 CATAGGCAGGCCCTGGCTTGTGG + Intergenic
1176065618 20:63192945-63192967 CTGAGGGAAGCCATGAGTTGTGG + Intergenic
1176596342 21:8701072-8701094 CAGAGGCAAGCAATGGGCTGGGG + Intergenic
1180172374 21:46066325-46066347 GAGAGCAAAGCGCTGTGTTGGGG + Intergenic
1180279256 22:10678521-10678543 CAGAGGCAAGCAATGGGCTGGGG + Intergenic
1180465283 22:15604722-15604744 CTGAGGCCAGCCCTGTGGGGTGG - Intergenic
1180708958 22:17826770-17826792 CACAGGCCAGCCCAGTGATGCGG + Intronic
1181391754 22:22588158-22588180 TAGAGGCAGGCCCGGTGCTGGGG + Intergenic
1181413300 22:22740250-22740272 CAGAGGAAAGGCCTGAGTTATGG + Intronic
1181428440 22:22859396-22859418 CAGAGGAAAGGCCTGAGTTAAGG + Intronic
1181456486 22:23062959-23062981 CAGAGGAAAGCCCTGTCCTCAGG + Intronic
1184177702 22:42798721-42798743 CAGAGGTTATCCCTGTGATGTGG + Intronic
1184369988 22:44076095-44076117 CACAGACCAGCCCTGGGTTGAGG - Intronic
1184895596 22:47404849-47404871 CTGAGGCCAGCCCGGTGTGGTGG + Intergenic
950641855 3:14353616-14353638 CAGGGCCAAATCCTGTGTTGGGG - Intergenic
952872427 3:37912538-37912560 CCGAGGCCAGCTGTGTGTTGGGG + Intronic
953453018 3:43019789-43019811 TAGAGGGAAGCCATGTGATGGGG - Intronic
953871861 3:46633919-46633941 TTGAGGCAAGCCCTGCGTTCTGG - Intergenic
954151494 3:48659721-48659743 CAGAGACCAGCCCTGTATAGTGG + Exonic
954160471 3:48717805-48717827 CTCAGACAAGCCCTGTGGTGTGG - Intronic
954369805 3:50164190-50164212 CAGAGACAAGGCCTGTGCTGCGG - Intronic
954700285 3:52447247-52447269 CTGTGTCAGGCCCTGTGTTGGGG + Intergenic
957071027 3:75568051-75568073 CAGAGTCAAGGGCTGTGATGAGG + Intergenic
960721512 3:120628672-120628694 CAGGCTCAAGCCCTGAGTTGTGG + Intronic
961384874 3:126517738-126517760 CAGAGGCCAGCACTGTGGGGAGG + Exonic
962085435 3:132186613-132186635 CAGAGATAAGCCCTGTTTTGTGG + Intronic
962649482 3:137474112-137474134 CACAGGCAAGCCCAGATTTGAGG - Intergenic
962933808 3:140061005-140061027 CAGAGGGAAGCCCTGAGCAGAGG + Intronic
963728622 3:148948939-148948961 GAGATGGAAACCCTGTGTTGGGG - Intergenic
965079979 3:164022489-164022511 CAGAGGCAAGCTGTTTGTTAAGG + Intergenic
967996251 3:195168913-195168935 CAGAGGTAAGCCCTGTTTAAAGG - Intronic
968615821 4:1577330-1577352 CAGAGGCAGGGCCTGTGCTCAGG + Intergenic
969324234 4:6431685-6431707 CAGAGGCAGGCCCCGAGGTGTGG - Intronic
969739313 4:9012690-9012712 CAGAGTCAAGGGCTGTGATGGGG - Intergenic
969798494 4:9544203-9544225 CAGAGTCAAGGGCTGTGATGGGG - Intergenic
976381126 4:84400274-84400296 CTGAGGTAATCCATGTGTTGAGG + Intergenic
976521990 4:86039406-86039428 CTGTGGCAGGCCCAGTGTTGGGG - Intronic
977821699 4:101479185-101479207 CAGAGGGAAACCCTGTCTAGAGG - Intronic
980283764 4:130756149-130756171 CTGTGGCAGGCCCAGTGTTGAGG + Intergenic
983666326 4:170188598-170188620 CAGATGCAAGCTCAGTGATGAGG + Intergenic
984542767 4:181060860-181060882 CAGAGGCAAGCCTGGTGGTGAGG - Intergenic
985973851 5:3399229-3399251 CAGAGGCAGGCCAGGTGTGGTGG - Intergenic
986286850 5:6365509-6365531 CAGAGCCAAGCCCTGTGATGAGG + Intergenic
986725750 5:10595130-10595152 CAGAGGGAGGTGCTGTGTTGGGG + Intronic
992113504 5:73517692-73517714 CAGAGGCTATCTCTGGGTTGTGG + Intergenic
992494844 5:77282132-77282154 CAGAGGCAGACCCTGTGATTTGG + Intronic
994684570 5:102933519-102933541 CAGATGCACACCCTGTGTTCAGG - Intronic
994946783 5:106404188-106404210 CAGAGGCAAGTCTTGTATTTAGG - Intergenic
995275574 5:110274169-110274191 CAGAGCCAGGCTCTGTCTTGGGG - Intergenic
996428701 5:123345091-123345113 CAGAAGCAAGCCTTATGTTTTGG - Exonic
998957140 5:147450466-147450488 TAGAAGCAAGGCTTGTGTTGAGG + Intronic
999061527 5:148640553-148640575 CACTGGCATTCCCTGTGTTGTGG - Intronic
999147694 5:149406821-149406843 AAGAGGCAAGCCCCGTATTGGGG - Intergenic
999231290 5:150063636-150063658 GGGAGGCAAGCCCTGGGATGTGG + Intronic
999750884 5:154627575-154627597 CAGAGGCAGGGTGTGTGTTGGGG - Intergenic
999891485 5:155982706-155982728 CAGAGGGAAGCCCAGAGTTCAGG - Intronic
1000267536 5:159652090-159652112 CAGAAGCCAGCCCTGTGCTAAGG - Intergenic
1000290388 5:159864585-159864607 GCGAGGCAAGGGCTGTGTTGAGG - Intergenic
1000883867 5:166728270-166728292 CTGATGGAAGCCCTGTATTGAGG - Intergenic
1001323100 5:170698992-170699014 CAGAGGCCAGGGCTGTCTTGGGG - Intronic
1001554780 5:172629456-172629478 CAGAGGCTAGCCCAGAGCTGGGG + Intergenic
1001994679 5:176146810-176146832 CAGAGGTAAGGTCTGTTTTGTGG + Intergenic
1002182569 5:177438563-177438585 CAGGGGCCAGCCCTGTGAGGTGG + Intronic
1002279457 5:178122096-178122118 CAGAGGCCAGCCCGGGGCTGGGG + Exonic
1002647834 5:180669926-180669948 CACAGGCGTGCCCTGAGTTGTGG - Intergenic
1003269287 6:4593137-4593159 CAGAGCCAGGCCCTGCGGTGGGG - Intergenic
1003316449 6:5016914-5016936 CAGAGTGAGACCCTGTGTTGGGG - Intergenic
1005900710 6:30214265-30214287 CAGGGCCATGCCCTGTGCTGCGG + Intergenic
1006079920 6:31559192-31559214 AAAGGGAAAGCCCTGTGTTGGGG - Intergenic
1009058482 6:58368038-58368060 AACAGGCAAGCCTTGTGATGTGG - Intergenic
1009232353 6:61079084-61079106 AACAGGCAAGCCTTGTGATGTGG + Intergenic
1011335105 6:86251539-86251561 ATGAGCCAGGCCCTGTGTTGGGG + Intergenic
1014785377 6:125612331-125612353 CAGATGAAAGCCGTGTGTTGTGG + Intergenic
1014824335 6:126031701-126031723 GAGAGGGAAGCCCAGTGTTGAGG + Intronic
1014863936 6:126505452-126505474 CATAAGCAATCCCTGTGGTGAGG + Intergenic
1015981409 6:138843305-138843327 CAGAGGACAGCCCTGTCTTTCGG + Intronic
1016536201 6:145109534-145109556 CAGAGGCAAGCCCTGAGCTGTGG + Intergenic
1018729826 6:166640446-166640468 GAGAGGCGCGCCCTGTGGTGCGG + Intronic
1018900356 6:168048825-168048847 CAGCTGCACGCCCTGTGATGGGG - Intergenic
1018972111 6:168536865-168536887 CAGAGGCATTCCCTGAGTTCTGG + Intronic
1019432927 7:1007727-1007749 CAGCGGCAAGTCCTGTGCGGAGG - Intronic
1020217777 7:6207931-6207953 CAGAGCCAGACCCTGTCTTGGGG + Intronic
1022794136 7:33718683-33718705 AAGAGGCATGCCCTGTCCTGGGG - Intergenic
1022966825 7:35481964-35481986 GAGAAGAAAGCCCGGTGTTGTGG + Intergenic
1024363710 7:48497538-48497560 AGCAGGCAAGCCCTCTGTTGAGG + Intronic
1029073308 7:97917380-97917402 CAGAGTCAAGGGCTGTGATGAGG + Intergenic
1030107097 7:105996442-105996464 CAGAGGGATGCCCTTTGCTGTGG + Intronic
1030638665 7:111979030-111979052 CAGAGCCATAGCCTGTGTTGAGG + Intronic
1034540689 7:151756132-151756154 CAGAGGCGAGACCTGCTTTGGGG - Intronic
1035866835 8:3093254-3093276 CACAGGCACGCCCTGAGTGGGGG + Intronic
1035926380 8:3732139-3732161 CACGGGCAAGCCCTGAGTTCAGG + Intronic
1036244382 8:7103910-7103932 CAGAGTCAAGGGCTGTGATGAGG - Intergenic
1036256361 8:7209829-7209851 CAGAGTCAAGGGCTGTGATGAGG + Intergenic
1036308411 8:7668414-7668436 CAGAGTCAAGGGCTGTGATGAGG + Intergenic
1036361125 8:8077663-8077685 CAGAGTCAAGGGCTGTGATGAGG - Intergenic
1036397205 8:8379384-8379406 CAGAGGCAGGCCCTGCTTTGAGG - Intronic
1036897449 8:12647499-12647521 CAGAGTCAAGGGCTGTGATGAGG + Intergenic
1038522084 8:28242519-28242541 CAGAGCCAGACCCTGTCTTGGGG + Intergenic
1039557322 8:38485806-38485828 CAGTGGCAGGGGCTGTGTTGTGG - Intergenic
1042212173 8:66391824-66391846 TAGAGGGGAGTCCTGTGTTGAGG - Intergenic
1043024019 8:75044314-75044336 CAGAGGCCATCCCTTTGTTTCGG + Intergenic
1044334950 8:90970733-90970755 GAGATGGAAGCCATGTGTTGAGG + Intronic
1045332596 8:101168251-101168273 CAAGGGGAAGCCTTGTGTTGAGG + Intergenic
1047198989 8:122747921-122747943 CAGAGGCACAGCCTGTGGTGAGG - Intergenic
1047911059 8:129529775-129529797 CAGAGTATAGCACTGTGTTGAGG + Intergenic
1047958022 8:129990540-129990562 CAGAGTGAAACCCTGTCTTGGGG - Intronic
1048062255 8:130932433-130932455 CTGTGGCAGGCCCAGTGTTGGGG + Intronic
1048402189 8:134082398-134082420 AAGAGGAAAGCCCAGTGTGGTGG - Intergenic
1049445143 8:142626671-142626693 AAGTGGCAAGCACTGTGGTGTGG - Intergenic
1049638826 8:143705246-143705268 CTGGGGCAAGAACTGTGTTGGGG - Intronic
1049700947 8:144012290-144012312 CCGAGGCAAGGCCTGTGTACAGG + Intronic
1050434534 9:5594830-5594852 CAGAGTGAAACCCTGTGTTGGGG + Intergenic
1053695385 9:40634649-40634671 CAGAGGCAAGCAATGGGCTGGGG + Intergenic
1053942380 9:43265690-43265712 CAGAGGCAAGCAATGGGCTGGGG + Intergenic
1054306629 9:63433875-63433897 CAGAGGCAAGCAATGGGCTGGGG + Intergenic
1054405371 9:64757864-64757886 CAGAGGCAAGCAATGGGCTGGGG + Intergenic
1054438995 9:65243353-65243375 CAGAGGCAAGCAATGGGCTGGGG + Intergenic
1054491411 9:65778589-65778611 CAGAGGCAAGCAATGGGCTGGGG - Intergenic
1055104682 9:72500143-72500165 CAAAGGTTAGCCCTGTGTGGTGG + Intergenic
1055804614 9:80078274-80078296 AAGAGGCAGGGCCTGTGGTGGGG - Intergenic
1056105386 9:83341933-83341955 CAGTGACAAGCTCAGTGTTGTGG + Intronic
1056900676 9:90596717-90596739 CAGAGGCAAGCCCCCTTCTGTGG + Intergenic
1058128438 9:101223050-101223072 CACAGGTAATCCCTGTGCTGTGG + Intronic
1060776686 9:126379829-126379851 CAGAGGCCATCCATGTGCTGTGG + Intronic
1060824416 9:126679814-126679836 CAGAGTCAGGCTCTGTGTAGAGG - Intronic
1060881582 9:127121844-127121866 CAAAGGCAAGCGCTGTGCTGAGG - Intronic
1061747474 9:132750886-132750908 CAGAGGCCAGCCCTGTGGCTTGG + Intronic
1062105648 9:134753438-134753460 CTGAGTCAGGCCCTGTGTGGAGG - Intronic
1062406091 9:136397421-136397443 CAGAGGCAGGCCCTGGGTCTGGG + Intronic
1062563841 9:137154896-137154918 GAGAGGCAAGCCCTGGGCAGTGG + Intronic
1202777829 9_KI270717v1_random:8265-8287 CAGAGGCAAGCAATGGGCTGGGG + Intergenic
1203746874 Un_GL000218v1:44923-44945 CAGAGGCAGGTCTTGTGCTGCGG + Intergenic
1203563233 Un_KI270744v1:74557-74579 CGGAGGCAGGTCCTGTGCTGCGG - Intergenic
1185963260 X:4570127-4570149 AAGAGGAAAGCCCTCTGTAGTGG + Intergenic
1187464864 X:19518024-19518046 CAGAGGTAAGCCTGGTGTGGTGG - Intergenic
1190881037 X:54492952-54492974 CAGAGGCAAGGACTTCGTTGGGG + Intronic
1192194184 X:69017745-69017767 GAGAGGCCTGCCCAGTGTTGTGG + Intergenic
1192197157 X:69036186-69036208 CAGAGGCAAGCAGTGTGTACAGG - Intergenic
1192360373 X:70435130-70435152 CAGAGGCTGGCGCTGGGTTGGGG - Intergenic
1194057321 X:89151596-89151618 CAGAGCCCATCCCTTTGTTGTGG + Intergenic
1195094167 X:101489945-101489967 CAGAGGCAATCCCAATGTTATGG + Exonic
1196395573 X:115258363-115258385 CAGAGGCAAGTCCAGTGCAGAGG - Intergenic
1199681729 X:150229411-150229433 CTGTGCCAAGCCCTGTGCTGAGG - Intergenic
1199857828 X:151774730-151774752 GAGAGGCAAGCCCTGTGCGAGGG - Intergenic
1200390785 X:155944820-155944842 CAGAGGCAAGACAAGTGTTAGGG + Intergenic
1200747247 Y:6913052-6913074 CAAAGCAAAGCCCTGTTTTGGGG + Intronic
1201193166 Y:11466543-11466565 CAGAGGCAAGCAATGGGCTGGGG + Intergenic