ID: 1119605489

View in Genome Browser
Species Human (GRCh38)
Location 14:76012626-76012648
Sequence GAAATGAGCACAGCCTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 265}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119605489 Original CRISPR GAAATGAGCACAGCCTGCTG GGG (reversed) Intronic
900089934 1:915796-915818 GAAGTGGGCACAGCGTCCTGGGG + Intergenic
900206281 1:1433230-1433252 AACATGACCACAGCCAGCTGGGG + Intergenic
901030254 1:6303223-6303245 GAGATGAGGACTGCCTGCGGTGG - Intronic
902214636 1:14926631-14926653 GCATTGAGGACAGCCTGCCGTGG + Intronic
903330286 1:22593630-22593652 GAAGCGGCCACAGCCTGCTGAGG - Exonic
904124824 1:28230907-28230929 GAATAGCTCACAGCCTGCTGGGG + Intronic
904250347 1:29219071-29219093 GAAATGAGCACAGGCTGGACCGG + Intronic
904279873 1:29411486-29411508 GAAATCAGCACAGCCTTTGGAGG + Intergenic
904465068 1:30702693-30702715 GAGGGGAGCACAGGCTGCTGTGG - Intergenic
906581732 1:46940730-46940752 GAAAGGAGCTCACTCTGCTGGGG - Intronic
906601983 1:47138168-47138190 GAAAAGAGCTCACTCTGCTGGGG + Intronic
907243911 1:53095153-53095175 GACATGAGCACAGGCAGATGTGG + Intronic
908677777 1:66625044-66625066 GAAAGGATCACAGCCTACTAGGG + Intronic
910506999 1:87960557-87960579 GTAATGAGCTCAGCATGATGTGG - Intergenic
910556409 1:88539273-88539295 GAAAAGAGCAAAGCATGGTGTGG - Intergenic
910790561 1:91045388-91045410 GAAAAAAACACTGCCTGCTGAGG + Intergenic
911108897 1:94162753-94162775 GAAAAAAACACAACCTGCTGAGG - Intronic
912082654 1:105956602-105956624 GAACAGAGTACAGCCTGCTGTGG - Intergenic
914763234 1:150616027-150616049 GAAATGAGCACAGGTGGATGTGG - Intronic
914853996 1:151336798-151336820 GTAGTGAGCACAGAGTGCTGTGG - Intergenic
916290771 1:163164051-163164073 GAAATGTGCAGAGCCCGCTTGGG + Intronic
917679747 1:177353713-177353735 GAAATGCGCACACACTGTTGAGG + Intergenic
917962756 1:180157434-180157456 GGGATGAGCACAGCCCTCTGCGG - Intronic
918180425 1:182082180-182082202 GCAGTGACCACAGCCTTCTGGGG + Intergenic
919991509 1:202710714-202710736 GAAAGGAGACCAGCCTTCTGGGG - Intergenic
920195755 1:204226047-204226069 GTCATGAGCACAGCGTGCAGCGG - Intronic
920272686 1:204778105-204778127 GAAATGTGCAGACCTTGCTGAGG - Intergenic
922065610 1:222136666-222136688 CAAGTGAGCACATACTGCTGGGG + Intergenic
922574972 1:226655348-226655370 GAAATGGGCCCTGCCTCCTGGGG + Intronic
923540219 1:234883367-234883389 GTGATGTCCACAGCCTGCTGTGG - Intergenic
924464815 1:244290417-244290439 GCATTGAGCAATGCCTGCTGAGG - Intergenic
924912093 1:248524400-248524422 GAACTGAGCAGAACATGCTGAGG + Intergenic
1062948709 10:1479533-1479555 GAACCCAGGACAGCCTGCTGAGG + Intronic
1063230082 10:4057217-4057239 CAAAGGTGCACAGGCTGCTGGGG - Intergenic
1063714498 10:8513848-8513870 GATCTGAGCTCAGCCTGCGGGGG - Intergenic
1067343240 10:45420727-45420749 GGCAGGAGCAAAGCCTGCTGAGG - Intronic
1068239329 10:54284740-54284762 GGAATGAGGAAGGCCTGCTGCGG - Intronic
1068447462 10:57140542-57140564 GAAAAAAGCATGGCCTGCTGAGG + Intergenic
1070319351 10:75343270-75343292 GAACTCAGCCCAGGCTGCTGTGG + Intergenic
1070651437 10:78239911-78239933 GAAAGGGGGAGAGCCTGCTGGGG - Intergenic
1070739709 10:78894685-78894707 GAAATGAGAAGAGGCTGCAGAGG + Intergenic
1071370052 10:84942011-84942033 GTAATGATCACAACCTCCTGGGG - Intergenic
1071378648 10:85035312-85035334 AAAATAACCACAACCTGCTGAGG + Intergenic
1073278579 10:102334375-102334397 CAAATGAGAAAAGGCTGCTGCGG + Intronic
1073839391 10:107481012-107481034 TAAATGAGCTCAGGCTGCTGAGG + Intergenic
1074539017 10:114349685-114349707 GAAATGACTACAGTCTGCTTTGG - Intronic
1075783434 10:125032205-125032227 GAGCTGAGCACAGCCTCTTGAGG - Intronic
1076345168 10:129774575-129774597 GGAAGGATCAAAGCCTGCTGGGG - Intergenic
1076607875 10:131701194-131701216 CACATGAGCACTTCCTGCTGAGG + Intergenic
1077325048 11:1960066-1960088 GCTATGAGCACAGCCCGGTGCGG - Intronic
1077373489 11:2194558-2194580 GAAGGGCGCACAGCCTGCTCAGG - Intergenic
1079642754 11:22827847-22827869 GAAAAGAGCAAAGCTTGCAGAGG - Exonic
1080513060 11:32994429-32994451 TAAATGAGCAGAGACTTCTGTGG - Intergenic
1080601588 11:33826035-33826057 GGAATGAGAACATCCAGCTGTGG - Intergenic
1081661865 11:44893319-44893341 ACCAGGAGCACAGCCTGCTGTGG - Intronic
1083032515 11:59606078-59606100 GAAATGAGCACAGGCTGCTATGG - Intronic
1083134235 11:60656400-60656422 TCAATAATCACAGCCTGCTGAGG + Intergenic
1083278132 11:61609015-61609037 TAAATGTGCACAGGCTGCTGGGG - Intergenic
1083769596 11:64859083-64859105 GGAGCGAGCACAGGCTGCTGCGG - Intronic
1084605395 11:70169130-70169152 GACACGAGCACAGCCTGCAGTGG + Intronic
1085331357 11:75654463-75654485 GAAATGTGCACAGGCTATTGAGG - Intronic
1085730839 11:78997097-78997119 AAAGTGACCACAGGCTGCTGAGG + Intronic
1086032268 11:82374434-82374456 GAGATCTGCACAGCCTGCTAGGG - Intergenic
1088439717 11:109856314-109856336 GAAGTGAGCACAGGATGTTGGGG + Intergenic
1089160795 11:116435498-116435520 AAAATGAGAACAGCCAGCTGTGG + Intergenic
1089360295 11:117881354-117881376 GAAATGATCACAGCCCTGTGAGG - Intergenic
1089832161 11:121338304-121338326 CAAATGAGCACAGCCTGGCTGGG + Intergenic
1090228509 11:125085591-125085613 GAGATGAGCCCAGCCAGCAGAGG - Exonic
1090596659 11:128328006-128328028 CAAATTCTCACAGCCTGCTGAGG - Intergenic
1090744843 11:129697306-129697328 GAAATGTGCAGAGCTTACTGTGG + Intergenic
1202808030 11_KI270721v1_random:15245-15267 GCTATGAGCACAGCCCGGTGCGG - Intergenic
1091582761 12:1799076-1799098 GAACTGAGCAGAGCCCGCTGAGG + Intronic
1091973639 12:4809057-4809079 GAAATGAGAAGAGCCGACTGCGG + Intronic
1095088725 12:38085267-38085289 GAAATGAGCCCAGCCCTCTCAGG + Intergenic
1095344365 12:41132343-41132365 GGAATGAGCACAGGGTGCTGTGG + Intergenic
1096385512 12:51192419-51192441 GCAATGACCACAGCAGGCTGGGG + Exonic
1096557691 12:52413595-52413617 GAAATGAGAAGAGGCAGCTGTGG + Intergenic
1098269526 12:68756337-68756359 TAAATGGCCTCAGCCTGCTGTGG - Intronic
1099578310 12:84407321-84407343 AAAATAACCACAACCTGCTGAGG + Intergenic
1099963149 12:89416224-89416246 GAGATAAGCACAGAATGCTGAGG + Intergenic
1100872617 12:98926288-98926310 TAACTGAGCACAGACTTCTGTGG + Intronic
1106506395 13:30374235-30374257 GAGATGAGCAGAGGATGCTGAGG + Intergenic
1107323330 13:39212301-39212323 GCAATGAGCACCGCCTGGAGGGG - Intergenic
1107983315 13:45754036-45754058 GAAAAAACCACAACCTGCTGAGG - Intergenic
1109764248 13:66872401-66872423 GACATGAGCACAGCCAGATATGG - Intronic
1111257713 13:85694347-85694369 GCAATGTGCTCTGCCTGCTGAGG + Intergenic
1112492564 13:99880650-99880672 AGGATGGGCACAGCCTGCTGTGG - Intronic
1116925536 14:50631631-50631653 TAAATGAGGAAAGCTTGCTGAGG + Intronic
1117276664 14:54200989-54201011 GAGATGAGAAAAGTCTGCTGGGG + Intergenic
1117389515 14:55249633-55249655 CACATGAGCAAAGCCAGCTGAGG + Intergenic
1117838059 14:59828389-59828411 GAAATGAGCACAGCACTCTAGGG - Intronic
1118472971 14:66092823-66092845 GAGCTGAGCACAGCCTGCAGGGG - Intergenic
1118788724 14:69068911-69068933 GAAATGAGAAAAGCCAGATGGGG + Intronic
1118840415 14:69505794-69505816 GGAATGAGCAGAGCGTGCAGGGG + Intronic
1119605489 14:76012626-76012648 GAAATGAGCACAGCCTGCTGGGG - Intronic
1120070296 14:80095205-80095227 GAAATGAGCACACGCAGGTGTGG + Intergenic
1120492465 14:85194527-85194549 GAAATGAGAAAAGCCTGCACTGG + Intergenic
1120969770 14:90197693-90197715 TGAAAGAGAACAGCCTGCTGAGG + Intergenic
1121729370 14:96175718-96175740 GCACAGAGCACAGCCTCCTGGGG - Intergenic
1121842836 14:97149183-97149205 GGCAGGAGCACAGGCTGCTGGGG + Intergenic
1121864615 14:97351062-97351084 GAGATGTACACAGCCTGCTCTGG + Intergenic
1125057209 15:35375593-35375615 GAAAGGAGGACAGCCAGCTGGGG - Intronic
1126382368 15:48062325-48062347 TAAATTAGACCAGCCTGCTGTGG + Intergenic
1126532917 15:49731186-49731208 GTACTGAGCACCGCCTGGTGAGG - Intergenic
1126950114 15:53871447-53871469 TAAATGAGCAGAGCCTGCTGTGG - Intergenic
1129844059 15:78760184-78760206 AGACTGAGCCCAGCCTGCTGGGG + Intronic
1130923719 15:88369580-88369602 GGAATGAGTACAGCAGGCTGGGG + Intergenic
1131368823 15:91862660-91862682 GAAATGAGCAGGGGCTGATGAGG + Intronic
1134790991 16:16989133-16989155 GAGATGAGTACAGCATGCTAGGG + Intergenic
1135487579 16:22879494-22879516 GTGATGAGCACACTCTGCTGGGG + Intronic
1135864018 16:26083994-26084016 GGAGTGAGCACAGCATGCTGAGG + Intronic
1136111131 16:28064013-28064035 GACAAGGGCAGAGCCTGCTGGGG + Intergenic
1138545862 16:57719068-57719090 GAACTGAGAACAGCCAGCTCTGG - Intronic
1139972054 16:70782371-70782393 GAAGTGAGCAAGGCCTGTTGAGG - Intronic
1141281589 16:82634184-82634206 GAAATGAGCTCAGCCTCTGGAGG + Intronic
1141656903 16:85421396-85421418 GAAAAGAGCACAGCAAGCAGGGG + Intergenic
1141861430 16:86719073-86719095 CAGATGAGCACCGCCTACTGAGG - Intergenic
1142138528 16:88462313-88462335 GAAGTGAGCCCGGCGTGCTGAGG + Intronic
1144581821 17:16463514-16463536 AGAATGAGGACAGCCTGCAGTGG - Intronic
1146393757 17:32445047-32445069 GTAATCAGCACAGCCTGCTCCGG + Intronic
1147384265 17:40072289-40072311 GGAATGAGCACTGGCTGCTGTGG - Intronic
1150266925 17:63837938-63837960 GAATAGGGCACAGCATGCTGGGG - Intronic
1151586376 17:75011138-75011160 CAAATAAACACAGCCTGCTTGGG - Intergenic
1151603669 17:75122852-75122874 GAAAGAAGCAAAGCCTGGTGAGG + Intronic
1152316897 17:79586215-79586237 GAAGTGAGCAAGGCCTGCTGAGG - Intergenic
1152570345 17:81118917-81118939 GAGATGAGCCCAGCCTGGGGTGG + Intronic
1153627630 18:7037108-7037130 CAGATGAGCACAGCCTGCCACGG + Intronic
1156142392 18:34131238-34131260 GCAGTGAGCTCAGTCTGCTGGGG - Intronic
1156286930 18:35705985-35706007 GACATAAGCAGAGCCTGCTAAGG - Intronic
1156382959 18:36580528-36580550 GAACAGAGCACACCCTGCAGGGG - Intronic
1156627852 18:38931317-38931339 GAAATGAGGTCAGCCTGGTTGGG + Intergenic
1157090700 18:44633420-44633442 GAAAGGAGCACAACATGGTGTGG - Intergenic
1157210187 18:45735585-45735607 TAAATAAGCACAGCCTGCTGTGG + Intronic
1157599915 18:48887540-48887562 CCATTGGGCACAGCCTGCTGCGG + Intergenic
1159257178 18:65962093-65962115 GCAATGAGGAGAGCCTCCTGGGG - Intergenic
1160399830 18:78602061-78602083 GAGACAAGCCCAGCCTGCTGGGG - Intergenic
1161589472 19:5122773-5122795 CTAATGAGCCCAGCCTGCTCTGG + Intronic
1162580644 19:11528171-11528193 GAAATGACCAGAGACAGCTGTGG - Intronic
1162950126 19:14066464-14066486 GAAGTGGGCAGGGCCTGCTGGGG + Intergenic
1164445377 19:28313160-28313182 GAGATGTACACAGGCTGCTGTGG - Intergenic
1165263982 19:34645399-34645421 GAACTCAGCTCAGCCTGCAGTGG - Intronic
1166140857 19:40804412-40804434 GCGATGAGCTCAGCCTGTTGAGG + Intronic
1166831705 19:45643380-45643402 GAAAAGAGGAATGCCTGCTGGGG - Intronic
1168534555 19:57158224-57158246 GAAATGTGCCCAGCATGATGAGG + Intronic
1168669309 19:58229054-58229076 GAAACGAGCAGGGCCTGCGGGGG + Intronic
925121931 2:1425874-1425896 GGAAGGAGCACAGACTTCTGAGG - Intronic
925121951 2:1426186-1426208 GGAAGGAGCACAGACTTCTGAGG - Intronic
925200203 2:1961107-1961129 GAAATGATCACAGGCTACTGTGG - Intronic
925280222 2:2678776-2678798 AAAAAAAGCACAACCTGCTGAGG + Intergenic
926305166 2:11632880-11632902 GAAATGAGCAGCACCTGCAGTGG - Exonic
929048022 2:37809634-37809656 GAAAAGAGCAGAGCCTGCAGGGG - Intergenic
929236266 2:39608404-39608426 GAAAATATCACAGCCTGCGGTGG + Intergenic
931426776 2:62178647-62178669 GCAAGGTGCACATCCTGCTGGGG + Intergenic
931852787 2:66269765-66269787 GAAATAAGCAAAACTTGCTGTGG + Intergenic
932453465 2:71831109-71831131 GGAAGGAGCCCAGCCTGCTCTGG + Intergenic
933025131 2:77247635-77247657 GTAATGAGCACAGGGAGCTGTGG - Intronic
933328949 2:80872998-80873020 GAAATCAGGAAAGCCAGCTGGGG - Intergenic
933571131 2:84014047-84014069 TAACTGAGCACAGCCTTCAGTGG + Intergenic
935935463 2:108177718-108177740 GAAGTGTGCACACCCTGCTTTGG + Intergenic
936055418 2:109258606-109258628 GTTAGGAGCACAGCCAGCTGTGG - Intronic
936977092 2:118231406-118231428 GCACTGAGCACAGCCCGCTAAGG + Intergenic
937379567 2:121364308-121364330 GAAATGAGAAGAGAGTGCTGTGG - Intronic
939214134 2:139214165-139214187 GAAAAAACCACAACCTGCTGAGG + Intergenic
940798655 2:158107820-158107842 GCAAGGAGCACAGCCTGGAGAGG - Intronic
941651165 2:168094092-168094114 GAATGGCGCACAGCATGCTGGGG - Intronic
943146293 2:184050014-184050036 GAAATGGTTGCAGCCTGCTGGGG + Intergenic
945248698 2:207744899-207744921 GAATTGTGCACAGTCTGGTGTGG + Intronic
945993374 2:216415011-216415033 GAAATGCCCACAGCCTGCCCAGG + Exonic
948188229 2:236038190-236038212 GAAACGAGCACAGGGTGCTTTGG + Intronic
1168748579 20:266053-266075 GATAAGAGCTCAGCCTGCTAGGG + Intergenic
1169386327 20:5152850-5152872 TAAATGAGGACAGCTTGGTGTGG + Intronic
1171227899 20:23456603-23456625 GAAATGAGCACAGCTGCCAGGGG - Intergenic
1171250809 20:23645555-23645577 GAGATGAGCATGGGCTGCTGGGG - Intergenic
1172119280 20:32588309-32588331 GGAGTGAGAACAGCCTACTGCGG + Intronic
1176331068 21:5548762-5548784 GAAAGGAGCACAGGCAGCAGGGG - Intergenic
1176364458 21:6024318-6024340 GTAAAGAACACAGCCTGGTGGGG - Intergenic
1176396689 21:6272189-6272211 GAAAGGAGCACAGGCAGCAGGGG + Intergenic
1176440468 21:6716915-6716937 GAAAGGAGCACAGGCAGCAGGGG - Intergenic
1176464730 21:7043984-7044006 GAAAGGAGCACAGGCAGCAGGGG - Intergenic
1176488291 21:7425763-7425785 GAAAGGAGCACAGGCAGCAGGGG - Intergenic
1176976642 21:15328116-15328138 GAACTGAGTGCAGCCTGCTAGGG + Intergenic
1177032558 21:15999860-15999882 GATAAGAGCACAGCCAGGTGTGG + Intergenic
1178393286 21:32216883-32216905 CAAATGAGCAGAGCCTTCAGGGG + Intergenic
1178503752 21:33146703-33146725 GAAATGAGCTCAGCTCTCTGGGG - Intergenic
1179715089 21:43282296-43282318 GGAACGAGCAGTGCCTGCTGTGG - Intergenic
1179759060 21:43514227-43514249 GTAAAGAACACAGCCTGGTGGGG + Intergenic
1180145441 21:45916084-45916106 TAAATCAGCAGAGCCTGCTAAGG + Intronic
1180900065 22:19364467-19364489 GAAATGAGCACCTGCTGTTGGGG - Intronic
1180942161 22:19666477-19666499 GGAATCAGCACAGCCTGCTTGGG + Intergenic
1181486883 22:23237213-23237235 CAAATGAGCAGATCCTGATGAGG - Intronic
1181981481 22:26769830-26769852 CACATCAGCTCAGCCTGCTGAGG + Intergenic
1183217711 22:36491881-36491903 GATATGGGCTCAGCCTTCTGAGG + Intronic
1184832524 22:46997944-46997966 GGAGTGAGCACTGCCTGCTTTGG - Intronic
1185304133 22:50103181-50103203 CAAATGTGGACAGCGTGCTGGGG + Intronic
949408466 3:3739193-3739215 GATAGGAGCACAGCCTCGTGTGG - Intronic
949734317 3:7153866-7153888 GTAATGAACACAGCCTGGTTAGG + Intronic
950936555 3:16845239-16845261 GTAATGGGTACAGCATGCTGGGG + Intronic
952825658 3:37522440-37522462 GAAGTGAGCACAGCCAGGAGTGG + Intronic
952977713 3:38710106-38710128 GGAATGACCACTTCCTGCTGTGG - Intronic
953667979 3:44939825-44939847 AGAGTGAGTACAGCCTGCTGAGG + Intronic
956992854 3:74788666-74788688 ACAATGAACACAGCCTTCTGTGG + Intergenic
957701014 3:83712602-83712624 GACATGAGCACAGAGTGCTCTGG + Intergenic
959745755 3:109775353-109775375 GAAAAAACCACAACCTGCTGAGG - Intergenic
963766043 3:149336916-149336938 AAAATGAGGACAGCATGGTGGGG + Intergenic
964849653 3:161081400-161081422 GTTATGAGCAAAGGCTGCTGCGG - Intergenic
967183698 3:186928238-186928260 GAACTAAGAACAGCCTGGTGCGG - Intergenic
967298174 3:187986049-187986071 GCACTGAGCACAGGATGCTGTGG - Intergenic
967832059 3:193927912-193927934 GAAAAAACCACAACCTGCTGAGG + Intergenic
967931255 3:194692172-194692194 GAAATGTGCACGGACTGCTGGGG + Intergenic
969294774 4:6263396-6263418 GAAATGGGCCCAGCCTGCCCTGG - Intergenic
969389253 4:6878643-6878665 GAAAAAACCACAACCTGCTGAGG - Intronic
969946581 4:10789343-10789365 GAAAATAGCACATCCTTCTGGGG - Intergenic
970667880 4:18358601-18358623 GAAATGACCCCATCCTCCTGTGG - Intergenic
974418384 4:61641040-61641062 GAAAAGAACACAGAATGCTGTGG + Intronic
975297260 4:72749139-72749161 GAAATGAGTAGACTCTGCTGTGG - Intergenic
976052361 4:81024288-81024310 GAAAGGAGGGCTGCCTGCTGGGG - Intergenic
976857243 4:89619239-89619261 GGAGTGAGCAGAGCCTGATGTGG - Intergenic
979359899 4:119749274-119749296 GACAAGAGCACAGCCTGCAATGG - Intergenic
979848639 4:125548796-125548818 AATATGAACACAGCCTGGTGGGG + Intergenic
981231311 4:142359057-142359079 GAAATGATCCCAGCCTGTGGAGG + Intronic
985771716 5:1815939-1815961 GAAATGCTCACAGGATGCTGCGG - Exonic
985788325 5:1911517-1911539 GAAAGGAGCAAAGCCAGCTGGGG - Intergenic
985811764 5:2095163-2095185 GAAATGAGGTCAGCATCCTGTGG - Intergenic
986723277 5:10575819-10575841 GAACTGATCAGAGGCTGCTGGGG + Intronic
986743211 5:10721675-10721697 GAAAAAACCACAACCTGCTGAGG + Intronic
988168954 5:27630924-27630946 AAAAACACCACAGCCTGCTGAGG - Intergenic
988189037 5:27903164-27903186 AAAAAAAGCACAACCTGCTGAGG + Intergenic
988540272 5:32102242-32102264 GAAATGTGCACTGCAGGCTGGGG + Intronic
990494441 5:56333501-56333523 GAAAGGAGCACACACTGCTTTGG - Intergenic
999278371 5:150347489-150347511 GAAATGGCCTCAGCTTGCTGCGG + Intergenic
1001719518 5:173845341-173845363 GATATGATCACAGCTTACTGCGG - Intergenic
1002998246 6:2306690-2306712 GAAAAAACCACAGCCTGCTGAGG + Intergenic
1004574059 6:16875726-16875748 GAAATAAGCACAGGATGCTCTGG - Intergenic
1005933021 6:30497903-30497925 GAACAGAGCACAGCCTCCAGAGG + Intergenic
1006459401 6:34149629-34149651 GAAATTCCCACAGCCTGCTCGGG + Intronic
1007018109 6:38490091-38490113 CAAATCTGCACAGCCTGCAGAGG + Intronic
1007932844 6:45707945-45707967 GAAATGGGCAGAGTGTGCTGAGG + Intergenic
1008082068 6:47204987-47205009 GTAATGAGCACAGAGTGCAGGGG - Intergenic
1009851622 6:69206835-69206857 AAAATAATCACAACCTGCTGAGG - Intronic
1014332204 6:120083368-120083390 GAAGTGAGCATAGCCTGGCGGGG + Intergenic
1017436399 6:154419642-154419664 GAAATGAGATCAGTATGCTGAGG + Intronic
1017716404 6:157216824-157216846 GAGATGTGCACAGGGTGCTGTGG + Intergenic
1017864497 6:158431457-158431479 TACATGTGCACAGTCTGCTGGGG - Intronic
1020058649 7:5135999-5136021 GAAATGGTCCCAGCCCGCTGGGG - Intergenic
1020205176 7:6109043-6109065 GAAATCAGCACAGGGTGCTGTGG + Intronic
1021021101 7:15599730-15599752 GACAACAGCACAGCCAGCTGTGG - Intergenic
1022079165 7:27002264-27002286 GAAAATACCACAACCTGCTGAGG + Intergenic
1024040815 7:45552072-45552094 GAAAAAAACACAACCTGCTGAGG + Intergenic
1024273377 7:47658959-47658981 GAAGTGTTCAGAGCCTGCTGGGG + Exonic
1026275461 7:68872105-68872127 GAAATGAGGATAGACAGCTGAGG - Intergenic
1026466402 7:70658534-70658556 GACAAGAGCACAGGCTTCTGGGG + Intronic
1027420617 7:78014549-78014571 GACATGCACACAGCCTGCTAGGG + Intergenic
1030367747 7:108665094-108665116 AATATGAGCACAGCCTTCAGAGG + Intergenic
1030918250 7:115344800-115344822 GAAATAGGCACAGCCTATTGTGG - Intergenic
1034170191 7:149056822-149056844 GAAAATACCACAACCTGCTGAGG + Intergenic
1035281882 7:157783800-157783822 GAAATGTGAACAGCCTCCGGAGG - Intronic
1038620399 8:29137303-29137325 GAAATGAACACAGGCTGTTTGGG + Intronic
1039547187 8:38418734-38418756 AGAATGAGCACAGGCTTCTGAGG + Intronic
1049106590 8:140617636-140617658 GAACTGAGCACAGCCACCCGTGG + Intronic
1049274019 8:141710836-141710858 GAACTGAGCACAGCAGGCTGGGG - Intergenic
1049365654 8:142235657-142235679 GAAATGGGCGCATTCTGCTGGGG + Intronic
1049938239 9:520045-520067 GAAATGACCATAGCCGGGTGCGG + Intronic
1050103427 9:2141945-2141967 GAATTGAAGACAGCCTCCTGGGG + Intronic
1051017968 9:12504045-12504067 GGAATAAGAAAAGCCTGCTGTGG - Intergenic
1051801787 9:20942850-20942872 TAAATTAGCACAGGGTGCTGTGG + Intronic
1051992682 9:23171692-23171714 GAAATGCAGTCAGCCTGCTGTGG - Intergenic
1052409134 9:28100476-28100498 GAAATGAACACATGCTGATGAGG + Intronic
1054994485 9:71369890-71369912 GAAGTGAGCACATGCTGTTGGGG - Intronic
1056433904 9:86556761-86556783 GAAAAAAGTACAGCCTTCTGTGG + Intergenic
1058445890 9:105054460-105054482 GAAATGAGTAGATCTTGCTGTGG - Intergenic
1058770035 9:108221894-108221916 CAAATGGGCACAGCATGCTTCGG - Intergenic
1060761417 9:126253054-126253076 GAAGTGAAGACAGACTGCTGAGG - Intergenic
1062087333 9:134655582-134655604 GTAATGACCATAGCCAGCTGTGG - Intronic
1062325978 9:136012719-136012741 GCCAAGAGCACAGCCTCCTGTGG - Intronic
1062335049 9:136061302-136061324 GCCATGGGCAGAGCCTGCTGTGG - Intronic
1203431034 Un_GL000195v1:91564-91586 GAAAGGAGCACAGGCAGCAGGGG + Intergenic
1186524754 X:10238279-10238301 GAAATGGGCCTAGCCTGCTGGGG + Intergenic
1188143966 X:26586824-26586846 GAACTGAGAACAGTCTGCTTGGG - Intergenic
1188673857 X:32914162-32914184 AAAATGAACACAGACTGCAGAGG + Intronic
1190286908 X:48967392-48967414 GCAGTGAACACAGCCTCCTGGGG + Intronic
1190591781 X:52010225-52010247 GAACTGAACACAGGCTGCTATGG - Intergenic
1192597833 X:72429988-72430010 GAAATGAGAGCAGCCTGTTTAGG - Intronic
1193086409 X:77450801-77450823 GAAAAGGGCAGAGCCTGATGTGG + Intronic
1195438645 X:104875466-104875488 GACATAAGCACAGGGTGCTGTGG + Intronic
1197062602 X:122199318-122199340 TAAAAAAGCACAACCTGCTGAGG - Intergenic
1198282285 X:135154056-135154078 GAAAAGAGTTCACCCTGCTGGGG - Intergenic
1198288674 X:135218466-135218488 GAAAAGAGTTCACCCTGCTGGGG + Intergenic
1198438846 X:136641962-136641984 GAAGTGAACACAGAGTGCTGTGG - Intergenic
1198735061 X:139776025-139776047 GAGGTAAGCACAGCCTGCTAAGG + Intronic
1199664607 X:150086902-150086924 GAAGTGATCACAGCAGGCTGGGG - Intergenic
1199944850 X:152657115-152657137 GAATTTAGCACAGCTGGCTGTGG + Exonic
1200006046 X:153084984-153085006 GAAATGAGCACAGCCTTTTCAGG + Intergenic