ID: 1119606471

View in Genome Browser
Species Human (GRCh38)
Location 14:76022342-76022364
Sequence TTACCTCGCTGCCGACAGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 40}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119606467_1119606471 0 Left 1119606467 14:76022319-76022341 CCTTGTAGACTTCCTCTGCTAAA 0: 1
1: 0
2: 0
3: 9
4: 146
Right 1119606471 14:76022342-76022364 TTACCTCGCTGCCGACAGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119606471 Original CRISPR TTACCTCGCTGCCGACAGGG AGG Exonic
900482506 1:2905896-2905918 TTACCTGGCTGCAGGGAGGGAGG + Intergenic
915598785 1:156909744-156909766 TTACCACGCTGCCAACCTGGAGG - Exonic
1063104111 10:2977727-2977749 TTACCGCACTGCAGCCAGGGAGG + Intergenic
1069613730 10:69792826-69792848 TTAGCTAGCTGCTGACAGGCAGG - Intergenic
1076359820 10:129879746-129879768 TTACCTCGCTGCGGAACGTGTGG - Intronic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1086272389 11:85083080-85083102 TTAGCTCACTTCCAACAGGGAGG - Intronic
1102666373 12:114577489-114577511 TCAGCACGCTGCCTACAGGGTGG - Intergenic
1108777520 13:53784497-53784519 TTACTGCACTGCTGACAGGGTGG - Intergenic
1117981155 14:61343077-61343099 TTATCTGACTGCTGACAGGGTGG + Intronic
1119606471 14:76022342-76022364 TTACCTCGCTGCCGACAGGGAGG + Exonic
1127656900 15:61064161-61064183 TTAGCCCTCTGCCTACAGGGAGG + Intronic
1127735351 15:61834276-61834298 TTCTCTCGCTGGCCACAGGGTGG - Intergenic
1134691229 16:16192113-16192135 TCACCTCCCTGCAGTCAGGGCGG - Intronic
1137623342 16:49891596-49891618 TGACCTGACTGCCTACAGGGAGG - Intergenic
1146329758 17:31917443-31917465 TTCCCTCCCTGTGGACAGGGAGG - Intergenic
1161457392 19:4376396-4376418 CTGCCTGGCTGCCGGCAGGGAGG - Intronic
936056012 2:109262481-109262503 TTACCTGGCTGCAGAGAGTGGGG - Intronic
939167129 2:138652099-138652121 TTACATCCCTGCACACAGGGTGG + Intergenic
944896658 2:204172283-204172305 TTTCAACCCTGCCGACAGGGAGG + Intergenic
948391289 2:237613235-237613257 TTACCTCGCTATCTGCAGGGTGG - Intergenic
1175223108 20:57428866-57428888 ATTCCTGGCAGCCGACAGGGAGG - Intergenic
1179054113 21:37915880-37915902 TTACCTGGCTGCGGACGGGGTGG + Exonic
953422626 3:42766184-42766206 TTTCCACGCTGCAGACAAGGTGG + Intronic
968085949 3:195873930-195873952 TTCCCTCCCTGCAGGCAGGGTGG - Intronic
968618425 4:1592771-1592793 TGCCATCGCTGCCCACAGGGAGG + Intergenic
978608290 4:110507122-110507144 TTAACTCGCTGATGACAGGGAGG - Intronic
982164921 4:152605506-152605528 TTACCTAGCTGGCCACAGAGAGG + Intergenic
999121000 5:149209303-149209325 TTACCTGGCTGCTGGCAGAGTGG + Intronic
1002905065 6:1441588-1441610 TTCCCTTGCTACCCACAGGGAGG + Intergenic
1006012974 6:31057744-31057766 AATCCTCCCTGCCGACAGGGAGG + Intergenic
1006012976 6:31057747-31057769 TTCCCTCCCTGTCGGCAGGGAGG - Intergenic
1008379774 6:50827894-50827916 TTACCTAGGTGCTGACTGGGAGG + Intronic
1021434586 7:20599830-20599852 TTCCCGTGCTGCCCACAGGGAGG - Intergenic
1028969473 7:96841693-96841715 TTATCTGGCTCCCAACAGGGAGG - Intergenic
1039400189 8:37262670-37262692 GTAGCTAGCTACCGACAGGGCGG + Intergenic
1046282194 8:112048327-112048349 TTACATCTCTGATGACAGGGTGG - Intergenic
1049851855 8:144836843-144836865 CTCCCTCGCTGCAGACTGGGTGG - Intronic
1056643158 9:88388248-88388270 TCACCTGGCTGGCGGCAGGGCGG - Intergenic
1187045801 X:15646803-15646825 TTACCAGGCTGCGGACAGGCTGG - Intronic
1189606675 X:42685345-42685367 TTACCTCACTGTGGACTGGGGGG - Intergenic
1189877652 X:45453563-45453585 TTACCTGGATGGCTACAGGGAGG + Intergenic
1195983109 X:110601054-110601076 TTCCCTTGCTGGAGACAGGGAGG + Intergenic