ID: 1119613065

View in Genome Browser
Species Human (GRCh38)
Location 14:76080168-76080190
Sequence CAGCGATGACAGCCAGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 215}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119613065_1119613070 5 Left 1119613065 14:76080168-76080190 CCTTGGCCTGGCTGTCATCGCTG 0: 1
1: 0
2: 2
3: 22
4: 215
Right 1119613070 14:76080196-76080218 GTCCCACTCAGGCGGTTCACCGG 0: 1
1: 0
2: 0
3: 1
4: 60
1119613065_1119613068 -6 Left 1119613065 14:76080168-76080190 CCTTGGCCTGGCTGTCATCGCTG 0: 1
1: 0
2: 2
3: 22
4: 215
Right 1119613068 14:76080185-76080207 TCGCTGGCTCTGTCCCACTCAGG 0: 1
1: 0
2: 0
3: 16
4: 167
1119613065_1119613071 6 Left 1119613065 14:76080168-76080190 CCTTGGCCTGGCTGTCATCGCTG 0: 1
1: 0
2: 2
3: 22
4: 215
Right 1119613071 14:76080197-76080219 TCCCACTCAGGCGGTTCACCGGG 0: 1
1: 0
2: 1
3: 3
4: 86
1119613065_1119613069 -3 Left 1119613065 14:76080168-76080190 CCTTGGCCTGGCTGTCATCGCTG 0: 1
1: 0
2: 2
3: 22
4: 215
Right 1119613069 14:76080188-76080210 CTGGCTCTGTCCCACTCAGGCGG 0: 1
1: 0
2: 1
3: 35
4: 219
1119613065_1119613075 16 Left 1119613065 14:76080168-76080190 CCTTGGCCTGGCTGTCATCGCTG 0: 1
1: 0
2: 2
3: 22
4: 215
Right 1119613075 14:76080207-76080229 GCGGTTCACCGGGTTCTGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 36
1119613065_1119613076 23 Left 1119613065 14:76080168-76080190 CCTTGGCCTGGCTGTCATCGCTG 0: 1
1: 0
2: 2
3: 22
4: 215
Right 1119613076 14:76080214-76080236 ACCGGGTTCTGCTGGGCACCAGG 0: 1
1: 0
2: 2
3: 9
4: 149
1119613065_1119613074 15 Left 1119613065 14:76080168-76080190 CCTTGGCCTGGCTGTCATCGCTG 0: 1
1: 0
2: 2
3: 22
4: 215
Right 1119613074 14:76080206-76080228 GGCGGTTCACCGGGTTCTGCTGG 0: 1
1: 0
2: 1
3: 3
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119613065 Original CRISPR CAGCGATGACAGCCAGGCCA AGG (reversed) Intronic
901238413 1:7679678-7679700 CGGCGATGACATCAAGGCCTGGG + Intronic
901835665 1:11922581-11922603 CAGGGCTGAGAGCAAGGCCAAGG + Intronic
902153143 1:14461175-14461197 AAGAGATGACAGCCAGGAAAGGG - Intergenic
902372386 1:16014752-16014774 CAGAGATGGAAGCCAGGGCATGG - Exonic
903288482 1:22292006-22292028 GAGTGATGACTGCCAGGCCCAGG - Intergenic
904917761 1:33982727-33982749 CAGAGATGACCGCAAGGGCATGG + Intronic
906031031 1:42720244-42720266 CAGTGATGCCAGCCTGGCCCAGG - Intergenic
906565704 1:46799552-46799574 CAGCAATGACAGAAAGGCAATGG + Intronic
907481571 1:54748595-54748617 CATCGATGAGAACCAGGCCAAGG + Intergenic
910813188 1:91258760-91258782 CAACAATGACAGCCAAGCCAAGG + Intergenic
912967488 1:114248990-114249012 TAGAGATGAAACCCAGGCCAAGG + Intergenic
914171990 1:145233562-145233584 CAACGAAGACAGAAAGGCCAGGG - Intergenic
915371817 1:155357650-155357672 CAGCAAAAACAGCCAGCCCATGG - Exonic
916859458 1:168787155-168787177 CAGCAATGTCATCCAGGCCCTGG - Intergenic
917402062 1:174660692-174660714 CAGAGAGAACAGCCAGGGCAAGG - Intronic
917525644 1:175786030-175786052 CTGCCATGACAGCTGGGCCAGGG + Intergenic
919043491 1:192422750-192422772 CAGCGATGAATGCCAAACCAAGG + Intergenic
920242145 1:204560875-204560897 CAGGGATAACAGTGAGGCCATGG + Intergenic
921186858 1:212677961-212677983 CAGGGATGAGAGCCAGGTTAGGG + Intergenic
922788243 1:228294333-228294355 CATCCACCACAGCCAGGCCACGG - Exonic
923682176 1:236127202-236127224 CAGCAAGGGCAGCAAGGCCAAGG - Intergenic
923718360 1:236446220-236446242 AAGCAATCATAGCCAGGCCAAGG - Intronic
1067829936 10:49605770-49605792 CACCGAGGACAGGCTGGCCAAGG + Intergenic
1067844802 10:49711033-49711055 CATCCATGACGGCCATGCCATGG - Intergenic
1068193900 10:53690662-53690684 CAGCGATGACATGCAGGCCAGGG - Intergenic
1068660537 10:59618733-59618755 CAGCACAGACAGCCAGGTCATGG - Intergenic
1069069305 10:63977228-63977250 CAGAGATGACAGCCTGGGGAAGG - Intergenic
1069741822 10:70689767-70689789 CAGAGAAGCCAGCCAGGCCCTGG + Intronic
1069844481 10:71361741-71361763 CCGCGCTGGCAGGCAGGCCAGGG + Intronic
1073218558 10:101850901-101850923 CAACTGTGACAGCCTGGCCAGGG - Intronic
1075730144 10:124631130-124631152 GAGCGGGGACAGCAAGGCCAAGG - Intronic
1076125604 10:127971530-127971552 CTGCGAGGACAGCAAGGCCAGGG - Intronic
1076808603 10:132873687-132873709 CAGGGATGACAACCAGGCAGAGG + Intronic
1076833262 10:133007467-133007489 CAGTGGTGACAGCCAGTCCCTGG + Intergenic
1077374442 11:2198944-2198966 GAGCTATGCCAGCCAGGCCCTGG - Intergenic
1080030323 11:27653853-27653875 CAGTCATGACAGCCCAGCCATGG - Intergenic
1080456749 11:32426339-32426361 CAGCAATGACACCCTGGCAATGG + Intronic
1080706122 11:34695659-34695681 CAGTAATGCCATCCAGGCCAGGG + Intergenic
1083010118 11:59388798-59388820 CAGCTACCACAGCCAGGACAGGG - Intergenic
1083724176 11:64619754-64619776 CTGCCAGGACTGCCAGGCCAAGG - Intronic
1085434855 11:76491544-76491566 CAGCTCTGACAGCCATGCCAGGG + Intronic
1088619944 11:111671555-111671577 CTCCAATCACAGCCAGGCCAAGG - Intronic
1090919573 11:131196039-131196061 CAGGGAACACAGCCAGGACAGGG + Intergenic
1091269054 11:134292893-134292915 CAGAGAAGTGAGCCAGGCCAAGG - Intronic
1091384467 12:84060-84082 CAGTGAGGACAGCTATGCCAGGG - Intronic
1091408623 12:224490-224512 AAGCGATGAAAGCCAGGCCAGGG + Exonic
1095939656 12:47717728-47717750 GAGTGAAGACAGCCAGGCTAGGG - Intronic
1096879698 12:54657839-54657861 CAGGGGAGACCGCCAGGCCAGGG - Intergenic
1101440912 12:104703779-104703801 CAGCGTTGACAGCAAGGCAAAGG - Intronic
1103599296 12:122043986-122044008 CAGCGACGGCACCGAGGCCAAGG + Exonic
1104747328 12:131218890-131218912 CAGCGATGACCCCCAGGCAGCGG + Intergenic
1105313495 13:19235337-19235359 AAGGTAGGACAGCCAGGCCATGG - Intergenic
1106680443 13:32001691-32001713 CAGCCAGAACAACCAGGCCATGG - Intergenic
1109687353 13:65838787-65838809 CAGCACTCACAGCCAGGCCATGG - Intergenic
1113076115 13:106469444-106469466 CAGCGATCAAAGCCAGGCCTTGG + Intergenic
1118914839 14:70094145-70094167 CATCTCTGACAGCCAGTCCATGG + Intronic
1119442316 14:74636777-74636799 CAGCCTTGAGAGCCAGCCCAGGG + Intergenic
1119613065 14:76080168-76080190 CAGCGATGACAGCCAGGCCAAGG - Intronic
1119824625 14:77647190-77647212 CAGCAAGGACAGCCAGGCCCTGG - Intergenic
1122107699 14:99470917-99470939 AGGGAATGACAGCCAGGCCAGGG - Intronic
1122296601 14:100709433-100709455 CAGCAAGGAAGGCCAGGCCAGGG - Intergenic
1122690220 14:103528753-103528775 CAGCAGTGACAGCCAGGCCTTGG + Intergenic
1123033740 14:105463376-105463398 CGGAGAGGACAGCCGGGCCAGGG - Intronic
1123404468 15:20011674-20011696 CAGTGTTCACAGCCACGCCACGG + Intergenic
1123513801 15:21018321-21018343 CAGTGTTCACAGCCACGCCACGG + Intergenic
1124005528 15:25792774-25792796 CAGCGATGAGAGCCCTGCCCTGG - Intronic
1124368881 15:29092011-29092033 CTGAGAGGACAGCCAAGCCACGG + Intronic
1128727468 15:69998778-69998800 CAGCACTCACGGCCAGGCCAGGG + Intergenic
1129268463 15:74407378-74407400 CAGGGACCAGAGCCAGGCCAGGG - Intergenic
1129326255 15:74801692-74801714 CAGAGATGTCTGCGAGGCCATGG + Exonic
1129443644 15:75600763-75600785 CAGCCACGACAGCCAAACCAGGG + Intronic
1130155017 15:81342910-81342932 GAGCGAGGACAGACTGGCCAAGG + Intronic
1131225329 15:90620141-90620163 CATCGGTGACATCCTGGCCAGGG + Intronic
1131225734 15:90623271-90623293 CAGAGGTGGCAGCCAGGGCATGG - Intronic
1131829254 15:96343907-96343929 CCGCAAAGACTGCCAGGCCAAGG + Intergenic
1132537304 16:488860-488882 CCGTGATGACAGACTGGCCATGG - Exonic
1132617217 16:847663-847685 CGGCTATGACGGCCAGTCCAGGG + Intergenic
1133029673 16:3004428-3004450 CAGCGGTGGCAGCTCGGCCAGGG - Intergenic
1133353249 16:5116944-5116966 CAGCCATGACTGCCAGACCTGGG - Intergenic
1133883130 16:9801818-9801840 CTAAGATGACAGTCAGGCCATGG - Intronic
1136127339 16:28193693-28193715 CAGGGATGTGAGCAAGGCCAAGG - Intronic
1137720038 16:50622421-50622443 CAGTGCTGAGAGCCAGGCCCAGG + Intronic
1138742703 16:59329379-59329401 CAGGGATGACAGCCTTGCCAGGG + Intergenic
1142141977 16:88476523-88476545 CAGAGAGGGCAGCCAGGGCAGGG + Intronic
1142202905 16:88769678-88769700 AAGCAGTGACAGCCAGGCCCGGG - Intronic
1142513101 17:410357-410379 CAGCGCGGACCGCCAGGCCAGGG - Exonic
1143363241 17:6388286-6388308 AAGCAATGACAGCCGGGACAAGG + Intergenic
1144211232 17:13017445-13017467 AAGTGCTGACAGCCAGGCCGGGG + Intronic
1144685605 17:17224047-17224069 CATCAAGGACAGCCTGGCCAGGG - Exonic
1144724521 17:17495151-17495173 CAGCGCCGGCAGCCAGGCCAAGG - Exonic
1144725115 17:17497960-17497982 CAGGAATCAGAGCCAGGCCAGGG - Intergenic
1148593162 17:48831446-48831468 CGGCGATGACATCCAGGCGAGGG - Intronic
1148972934 17:51500110-51500132 CTGCAAGGGCAGCCAGGCCAAGG - Intergenic
1149914981 17:60600413-60600435 CAGCGAGTACAGCCCCGCCATGG - Exonic
1151732064 17:75917563-75917585 CAGTGCTGAGAGCCTGGCCAGGG + Intronic
1151876563 17:76870440-76870462 CAGCGTTCCCAGTCAGGCCAGGG - Intronic
1152183575 17:78840486-78840508 CGGCGAGGACAGCCCGGCCCCGG + Exonic
1152419504 17:80184475-80184497 CAGACAAGCCAGCCAGGCCACGG - Intronic
1158341737 18:56473503-56473525 AAGCCATCACAGCAAGGCCAAGG + Intergenic
1158490513 18:57905935-57905957 CATCTTTGACAGCCAGGGCAGGG + Intergenic
1158680761 18:59564816-59564838 AAGTGATGACAGCCTGGCCTTGG + Intronic
1160350534 18:78174559-78174581 CAGCGCGGACAGCCATGCCCAGG - Intergenic
1160679838 19:407614-407636 CGCCCAGGACAGCCAGGCCAAGG - Exonic
1161653588 19:5499399-5499421 CAGCGATGACAGCCCAGCAATGG + Intergenic
1161977652 19:7615353-7615375 CCGCGGTGGCAGACAGGCCAAGG - Intronic
1163160603 19:15461743-15461765 CAGCGATGAAAGCTTGCCCAAGG - Intronic
1163434220 19:17285614-17285636 CAGCGAGGGCAGTCGGGCCATGG + Intronic
1164136537 19:22422005-22422027 CTGCGCTGACAGCCAGGCTCCGG - Intronic
1165079434 19:33299107-33299129 CAGCAGTGACAGCCAAGCAAGGG - Intergenic
1166871206 19:45872239-45872261 CACCGCTGACACCCAGGCCTGGG - Exonic
1168109583 19:54184545-54184567 CAAGGGTGACAGCCAGCCCAAGG - Intronic
1168511480 19:56977218-56977240 CAGTGAGGACAGCATGGCCAGGG + Intergenic
924978576 2:199464-199486 CAGCGAGGACAGCAAGGTGACGG + Intergenic
925185395 2:1843197-1843219 CTGTGAGGACAGCCAGGCCCAGG - Intronic
925310385 2:2877596-2877618 CAGCGCTGACAGCAAGGCTGAGG + Intergenic
926290290 2:11523751-11523773 CAGTGATCATAGACAGGCCATGG + Intergenic
929263644 2:39894506-39894528 CAGGGATGACAGGCTTGCCATGG - Intergenic
931069312 2:58626612-58626634 CAGTGATCACAGGCAGGCCCAGG - Intergenic
932015643 2:68023927-68023949 CCTCCAGGACAGCCAGGCCAGGG + Intergenic
936046887 2:109195325-109195347 GAGGGGTGACAGCCAGGACAAGG + Intronic
936450743 2:112632181-112632203 CAGCGGGGAAAGGCAGGCCAGGG + Intergenic
937359820 2:121221080-121221102 CAGTGATGACAGACAGCCTAAGG + Exonic
941308294 2:163897894-163897916 CTGCTGTGACAGCCAGGACAGGG + Intergenic
941384850 2:164841088-164841110 CGGCGAGGACAGCGAGGCCTCGG - Intronic
942596653 2:177597838-177597860 TGGTGCTGACAGCCAGGCCATGG - Intergenic
944943099 2:204651917-204651939 CAGCCATGGCTGCGAGGCCAAGG - Intronic
948164572 2:235851213-235851235 CAGCACTGACAGCCTGGACAGGG - Intronic
948791004 2:240376845-240376867 CAGGTATGCCAGCCATGCCAGGG - Intergenic
948928980 2:241118775-241118797 CAGGGCAGACAGCCTGGCCAAGG + Intronic
1171360706 20:24584662-24584684 CAGGAAGGGCAGCCAGGCCAAGG - Intronic
1172306127 20:33882133-33882155 CAAAGATGAGGGCCAGGCCAGGG - Intergenic
1172606884 20:36220031-36220053 CGGCGTTGACAGCCAGGCTAGGG + Intronic
1173513832 20:43650940-43650962 CAGAGTTGCCAGCCAGGGCAGGG + Intergenic
1174295014 20:49539657-49539679 CACCCATGAAAGCCAGGCCCAGG - Exonic
1175476226 20:59276636-59276658 CAGAGATGAGAGCCAGCTCATGG + Intergenic
1176385095 21:6135148-6135170 TAGGGATGAGAGCCTGGCCACGG - Intergenic
1178495209 21:33080509-33080531 CAGAAATGACAGCCAGGCACTGG + Intergenic
1179025456 21:37675550-37675572 CTGCGATGACACCCAGTCCCTGG + Intronic
1179354862 21:40649755-40649777 CAGCTATGCCAGCAAGCCCAGGG + Intronic
1179491950 21:41746541-41746563 CAGAGGTGACAGACAGGACAGGG - Intronic
1179576590 21:42312188-42312210 CAGCAATCACAGCCGGGCAAGGG + Exonic
1179738378 21:43403104-43403126 TAGGGATGAGAGCCTGGCCACGG + Intergenic
1179892909 21:44345954-44345976 CAGCGATGGATGCCACGCCAGGG - Intergenic
1180141157 21:45893972-45893994 CAGAGGTGGCAGCAAGGCCAGGG + Intronic
1180609238 22:17085073-17085095 CCGCGACGCCAGCCGGGCCATGG + Exonic
1180818322 22:18807157-18807179 CACCGATGACAGCCAAGCACAGG - Intergenic
1180824425 22:18852899-18852921 CAGAGATGGAAGCCAGGACAAGG + Intronic
1180980225 22:19874927-19874949 CAGCGCTGACAGCCATGGCCGGG - Intergenic
1181124852 22:20696054-20696076 CAGAGATGGAAGCCAGGACAGGG + Intergenic
1181188309 22:21121649-21121671 CAGAGATGGAAGCCAGGACAAGG - Intergenic
1181204546 22:21241612-21241634 CACCGATGACAGCCAAGCACAGG - Intergenic
1181210889 22:21288844-21288866 CAGAGATGGAAGCCAGGACAAGG + Intergenic
1181398619 22:22638044-22638066 CAGAGATGGAAGCCAGGACAAGG - Intergenic
1181501352 22:23317400-23317422 CAGAGATGGAAGCCAGGACAAGG - Exonic
1181650801 22:24258016-24258038 CAGAGATGGAAGCCAGGACAAGG + Intergenic
1181706580 22:24652723-24652745 CAGAGATGGAAGCCAGGACAAGG - Intergenic
1183290684 22:36999998-37000020 CAGGGATGACAGACAGGGGATGG + Intronic
1183387840 22:37525304-37525326 CAGCGATGGGAGCCAGGTCTGGG - Intergenic
1183420514 22:37709131-37709153 CTGCCGTGACATCCAGGCCAGGG - Intronic
1183746604 22:39695321-39695343 CAGCTGTGACGGGCAGGCCATGG + Intergenic
1185250507 22:49799327-49799349 CAGAGGGGACCGCCAGGCCAAGG + Intronic
1203216058 22_KI270731v1_random:6586-6608 CAGAGATGGAAGCCAGGACAAGG - Intergenic
1203222380 22_KI270731v1_random:53803-53825 CACCGATGACAGCCAAGCACAGG + Intergenic
1203268451 22_KI270734v1_random:33011-33033 CACCGATGACAGCCAAGCACAGG - Intergenic
1203274565 22_KI270734v1_random:78804-78826 CAGAGATGGAAGCCAGGACAGGG + Intergenic
953847452 3:46439041-46439063 CAGTGATGGCAACAAGGCCAGGG + Intronic
956274844 3:67487681-67487703 CAGCAATGATAGCCAAGACATGG + Intronic
961817046 3:129556439-129556461 CAGCGGAGTCAGCCGGGCCATGG + Intronic
962298055 3:134211887-134211909 CAGCACTGACAGAGAGGCCATGG + Intronic
962313799 3:134345413-134345435 CAGCAGAGTCAGCCAGGCCAGGG - Intergenic
964957273 3:162376471-162376493 CACCGATTACAGCCAGGCTCAGG - Intergenic
965310031 3:167116202-167116224 CACTCCTGACAGCCAGGCCAGGG - Intergenic
967918768 3:194599002-194599024 CAGCCTTGGCAGCCAGGCCAGGG + Intronic
967939788 3:194756948-194756970 CAGGGATGCCAGCAAGGCCAGGG - Intergenic
968460915 4:724309-724331 CGGCCATGCCAGCCAGGTCAGGG + Intronic
968612414 4:1563320-1563342 TAGCAGAGACAGCCAGGCCAAGG - Intergenic
968878074 4:3284739-3284761 CAGAGGTAGCAGCCAGGCCACGG + Intergenic
968949196 4:3681682-3681704 CACCGATCACAGGCAGGCCCAGG - Intergenic
969480403 4:7443902-7443924 CAGCAGCGGCAGCCAGGCCAGGG - Intronic
974281965 4:59807060-59807082 CAGCTGTGAAAACCAGGCCATGG + Intergenic
977282872 4:95064244-95064266 CAGGGATGACTACCAGTCCATGG - Intronic
977583163 4:98746846-98746868 CAGCCATGAGAGGCAAGCCAAGG + Intergenic
982055253 4:151542663-151542685 GAGTAATGACAGCCAGGCAAGGG - Intronic
982238437 4:153274133-153274155 CTGAGATGAAAGCCATGCCATGG - Intronic
984761320 4:183365214-183365236 CAGTGCTGACAGCCAGGCACAGG + Intergenic
987042172 5:14073167-14073189 CAGAGATTTCAGCCAGTCCAGGG + Intergenic
996308694 5:122078547-122078569 AGGCGAAGGCAGCCAGGCCATGG + Intergenic
997283709 5:132663909-132663931 CAGACAGGACAGCCTGGCCAGGG + Intergenic
998893432 5:146771188-146771210 CACTGATGAGAGCCAGACCATGG - Intronic
1002441828 5:179268325-179268347 GAGAAATGAAAGCCAGGCCAAGG + Intronic
1003038319 6:2664326-2664348 CAGGGATGACAGGACGGCCAGGG + Exonic
1005466100 6:26115580-26115602 CAGCGACGAAGGCCAGGCCGTGG + Intronic
1006133008 6:31879928-31879950 CAGAGATCCCAGCCAGGCCCTGG - Exonic
1007004689 6:38349750-38349772 CATCTATGAGAGGCAGGCCAAGG + Intronic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1007924417 6:45640120-45640142 CAGCAATGACAGCTAGCCCTGGG - Intronic
1013489412 6:110630656-110630678 CACTGATGACAGCCTGGCCTTGG + Intronic
1019105043 6:169660836-169660858 GAGAGCTCACAGCCAGGCCAGGG - Intronic
1019105062 6:169660900-169660922 GAGAGCTCACAGCCAGGCCAGGG - Intronic
1019105081 6:169660964-169660986 GAGAGCTCACAGCCAGGCCAAGG - Intronic
1019105099 6:169661028-169661050 GAGAGCTCACAGCCAGGCCAGGG - Intronic
1019276207 7:177303-177325 CCGTGATGTCAGCCAGGCCTCGG - Intergenic
1019294970 7:269263-269285 CAGCGAAGCAAGCCGGGCCATGG - Intergenic
1019318184 7:401174-401196 CAGTGAGGACAGCAAGTCCAAGG + Intergenic
1019509179 7:1408761-1408783 CAGTGTTGACACCCAGGCCATGG + Intergenic
1019900959 7:4020277-4020299 CAGCCATGTCCCCCAGGCCATGG - Intronic
1023843924 7:44110758-44110780 CAGCAATGACAGCCAGACATGGG + Exonic
1025002406 7:55327700-55327722 CATCGTTGATTGCCAGGCCAAGG + Intergenic
1025019898 7:55472790-55472812 CAACGAAGACAGAAAGGCCAGGG + Exonic
1026878523 7:73893695-73893717 CAGCGATGAGATCAAGGCAATGG - Intergenic
1033014806 7:137661396-137661418 AAGGGATGACAGCCAGGAAAGGG + Intronic
1035439529 7:158884696-158884718 CTCCGATGACGGCCAGTCCATGG + Intronic
1037720539 8:21439793-21439815 CAGCCATGGCAGCCAGGCCTGGG + Intergenic
1038114111 8:24533610-24533632 CAGCTATGAAGGCCAGGCCTAGG - Intergenic
1038428293 8:27479616-27479638 CAGAGCTGCCAGCCAGCCCACGG + Intronic
1039407426 8:37325404-37325426 CCGTTTTGACAGCCAGGCCAGGG - Intergenic
1043484101 8:80681963-80681985 CAGCATTGTCAGCCAGGGCAGGG - Intronic
1044528180 8:93276068-93276090 GAATGATGACAGCCATGCCAAGG + Intergenic
1046580059 8:116081156-116081178 AAGAGATGAAAGCCAGACCAAGG - Intergenic
1047645677 8:126867391-126867413 AAGTGATGAGAACCAGGCCAGGG - Intergenic
1049189621 8:141279655-141279677 CAGGGAGGGCAGCCTGGCCAGGG - Intronic
1050698938 9:8314895-8314917 CGGCGAGGACAGCCAGGGGAGGG - Exonic
1052684313 9:31735009-31735031 AAACAATGATAGCCAGGCCAGGG - Intergenic
1056535052 9:87519653-87519675 CAGGGATGGCAGCCAGGCCCAGG + Intronic
1057999125 9:99847580-99847602 CAGTGCTGACAGGCAGGCTAAGG - Exonic
1059284599 9:113161786-113161808 CAGAGAGGACAGCGAGGCCCAGG + Intronic
1060071044 9:120547709-120547731 CAGCCATGACAGTAAGGTCATGG + Intronic
1061876476 9:133546588-133546610 CACCCATGCCAGCCAGGCCAGGG + Intronic
1062106311 9:134756845-134756867 CAGGGATGACAGTGATGCCAGGG - Intronic
1062214617 9:135382505-135382527 CAGGTAGCACAGCCAGGCCAGGG + Intergenic
1062399381 9:136365769-136365791 CTGCGGTGAGGGCCAGGCCAGGG + Intronic
1188464744 X:30467223-30467245 CAAAGATGACAGCCAGTCCATGG - Intergenic
1189355637 X:40308098-40308120 CAGCCAGGACTGTCAGGCCAGGG + Intergenic
1190477485 X:50842302-50842324 CAGCGCAAACAGCCAGGGCATGG + Intergenic
1190495304 X:51022927-51022949 CAGAAATCACACCCAGGCCATGG + Intergenic
1198802970 X:140466478-140466500 CAGCAATGACAGCAAGAACAAGG + Intergenic
1199592179 X:149477569-149477591 CAGTGATGTCAGGCAGGGCATGG + Intergenic
1199724249 X:150566086-150566108 CAGCGATGTCACCAAGGGCAAGG + Intergenic
1199987174 X:152961092-152961114 CAGAGATCACAGCAAGGCAATGG - Intronic
1200081188 X:153577270-153577292 CATAAAGGACAGCCAGGCCACGG - Intronic