ID: 1119613106

View in Genome Browser
Species Human (GRCh38)
Location 14:76080355-76080377
Sequence CTTTGTGCACATTTGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 241}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119613099_1119613106 -10 Left 1119613099 14:76080342-76080364 CCAGCCCCACACTCTTTGTGCAC 0: 1
1: 0
2: 2
3: 29
4: 223
Right 1119613106 14:76080355-76080377 CTTTGTGCACATTTGGAGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 241
1119613095_1119613106 21 Left 1119613095 14:76080311-76080333 CCGAGCTGACCTCTGATCTGTCA 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1119613106 14:76080355-76080377 CTTTGTGCACATTTGGAGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 241
1119613093_1119613106 28 Left 1119613093 14:76080304-76080326 CCAAGGCCCGAGCTGACCTCTGA 0: 1
1: 0
2: 3
3: 22
4: 210
Right 1119613106 14:76080355-76080377 CTTTGTGCACATTTGGAGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 241
1119613098_1119613106 12 Left 1119613098 14:76080320-76080342 CCTCTGATCTGTCACAGATGGGC 0: 1
1: 0
2: 1
3: 7
4: 115
Right 1119613106 14:76080355-76080377 CTTTGTGCACATTTGGAGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 241
1119613094_1119613106 22 Left 1119613094 14:76080310-76080332 CCCGAGCTGACCTCTGATCTGTC 0: 1
1: 0
2: 4
3: 20
4: 181
Right 1119613106 14:76080355-76080377 CTTTGTGCACATTTGGAGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119613106 Original CRISPR CTTTGTGCACATTTGGAGGA GGG Intronic
900139721 1:1134629-1134651 GTGTTTGCACATTTGGAGGCCGG + Intergenic
901460295 1:9387243-9387265 CTTTGTGCACTGTTGGTGTAAGG - Intergenic
901558766 1:10052939-10052961 CTGTGTCCTCACTTGGAGGAAGG + Intronic
903677837 1:25075824-25075846 ATATGTGCACATTTGGGGGTGGG - Intergenic
904207701 1:28865488-28865510 CTTTGGGCACATTAGGGGGAAGG + Intergenic
906377474 1:45306810-45306832 CTTTGTGCACATTTACATTAAGG + Intergenic
906562971 1:46772993-46773015 CTTTGTGCACATTTACATTAAGG + Intronic
906813811 1:48856731-48856753 CTTTGTGAATATTTGCAGTACGG + Intronic
908748177 1:67395664-67395686 CTTTGTGGCCAGTTGGAGCAGGG - Exonic
909202283 1:72705678-72705700 CTTTCTGCACATAAAGAGGATGG - Intergenic
910145090 1:84071053-84071075 CTTTGTGCACATTTACATTAAGG - Intergenic
910340349 1:86180203-86180225 CTTTGCACCCATTAGGAGGAGGG - Intergenic
910451677 1:87353009-87353031 CTTTGTGCCTTTTAGGAGGAAGG + Intergenic
911048120 1:93645411-93645433 CTTTGTGCACATTTACATTAAGG + Intronic
911374316 1:97032397-97032419 ATTTGTGCACATATGTAGAAGGG + Intergenic
911508662 1:98784828-98784850 CATTGTGATCATTTGGAGAAGGG - Intergenic
912939983 1:114036332-114036354 CTATTTGGAGATTTGGAGGAAGG + Intergenic
913038511 1:114999636-114999658 CTTTGTGTATATTTTGATGATGG + Intergenic
913050018 1:115109460-115109482 CTGTGTCCAAATGTGGAGGAAGG + Intergenic
914244692 1:145876869-145876891 CTTTGTGGCCATTTGCAGCATGG - Exonic
916459112 1:165004127-165004149 CTTTTTGCACAAATGGAAGAGGG + Intergenic
916993978 1:170275740-170275762 CTATTTACACATTTGGAGGGAGG - Intergenic
917670745 1:177270996-177271018 CTGTGTCCACATGTGGAGGGAGG + Intronic
918575827 1:186058747-186058769 CTTTGAGCACATTTAGGTGAAGG - Intronic
919607289 1:199700217-199700239 ATTTGTTCATTTTTGGAGGAAGG + Intergenic
920062350 1:203236190-203236212 CTTTGTGGGCATCTGGAGGGGGG + Intronic
921179252 1:212618839-212618861 GCCTGTCCACATTTGGAGGAGGG - Intronic
921540925 1:216414763-216414785 ATTTGTGGCCATTTGGAAGATGG + Intronic
921812149 1:219527327-219527349 CTTTTTTCCCATTTGGAAGAAGG + Intergenic
923706181 1:236346625-236346647 CTTTGCACACACTTGGGGGAGGG + Intergenic
923836735 1:237618970-237618992 CTTCTTGGACATCTGGAGGAGGG - Intronic
1062886588 10:1021138-1021160 GTGTGTGCACATCTGCAGGAAGG - Intronic
1064273949 10:13890284-13890306 TTTGCTGCACATTTGAAGGACGG + Intronic
1067773578 10:49144986-49145008 CTGTGTTCACTTTTGCAGGATGG - Intergenic
1068667790 10:59695835-59695857 CTTTAGGTACATATGGAGGAAGG + Intronic
1068818816 10:61349358-61349380 CTTGGAACACATTTGGAAGATGG + Intergenic
1069330027 10:67280645-67280667 CTATGTGCACACTGGGAGAATGG - Intronic
1069546613 10:69333729-69333751 CATTGTGCAGATTTGGATGGAGG + Intronic
1069795031 10:71046498-71046520 TTTTGTGCACATAACGAGGAGGG - Intergenic
1071898215 10:90087692-90087714 CTTTGTGCACATTTACATTAGGG + Intergenic
1072091354 10:92130746-92130768 CTTGGTGCAGATTTGAAGTAGGG - Intronic
1072129827 10:92483636-92483658 CTTTCTGGACACTAGGAGGAAGG + Intronic
1073420479 10:103420216-103420238 CTGTGTGACCATCTGGAGGAAGG + Intronic
1075488986 10:122850014-122850036 CCTTGTGCTCATGTGGAGGACGG - Intronic
1075494981 10:122912168-122912190 CCTTGTGCTCATGCGGAGGATGG + Intronic
1078434412 11:11312627-11312649 CTTTGTGAAGATTAAGAGGAGGG - Intronic
1080528010 11:33146316-33146338 CTTTGTGTACATGTGCAGTAGGG - Intronic
1081573606 11:44306235-44306257 CTTTTAGCACATTTGGGGAAAGG + Intronic
1082169807 11:48989936-48989958 GTTTGTGTATATTTGGAGGCCGG - Intergenic
1082241186 11:49872621-49872643 GTTTGTGTATATTTGGAGGCCGG - Intergenic
1082771427 11:57210796-57210818 CTGTCTGCACCGTTGGAGGATGG - Intergenic
1085652765 11:78283312-78283334 CTTTGTGCACAAATGGAAAAAGG - Intronic
1086232453 11:84586862-84586884 CTTTGTACTTTTTTGGAGGATGG - Intronic
1086692348 11:89802493-89802515 GTTTGTGTATATTTGGAGGCCGG - Intronic
1086713451 11:90037166-90037188 GTTTGTGTATATTTGGAGGCCGG + Intronic
1088359858 11:108978747-108978769 CTTGGTGCTCACTGGGAGGATGG + Intergenic
1090655432 11:128840087-128840109 CTTTGTGGACATCTGGACAACGG - Exonic
1090943169 11:131406832-131406854 ATTTGTGCACTCTGGGAGGAGGG - Intronic
1095547509 12:43388908-43388930 CTGTGTTCTCATATGGAGGAAGG + Intronic
1096008368 12:48190714-48190736 CTTTGTACCTATTTGGAGCATGG + Intergenic
1097996082 12:65888990-65889012 CTGTGTCCACACTAGGAGGAAGG + Intronic
1098553106 12:71786195-71786217 CTTTGTTAACATTTGTAGGCCGG - Exonic
1098942987 12:76559239-76559261 CTTTGTTCCCTTTTGGAGTAGGG - Intronic
1099221310 12:79918339-79918361 TGTTGTGCACACATGGAGGAGGG - Intronic
1100030627 12:90186005-90186027 TTTGGTGAACGTTTGGAGGATGG + Intergenic
1100064483 12:90625360-90625382 CTGTGTGCCTATTTGGATGATGG + Intergenic
1100193110 12:92214135-92214157 CGCCTTGCACATTTGGAGGAAGG + Intergenic
1101362567 12:104041747-104041769 GTTAGTCCACATTTGGGGGAAGG + Intronic
1101650645 12:106674212-106674234 CTTTGTGGATATCTGGGGGAAGG - Intronic
1101695204 12:107119095-107119117 CTCTGTTCACATATGGAGGTGGG - Intergenic
1102666259 12:114576012-114576034 CTTTCAGGGCATTTGGAGGAAGG - Intergenic
1103953826 12:124566147-124566169 CTTTTTGCAGATTTGGAGGAAGG - Intronic
1104764941 12:131323856-131323878 CTTTGTGCACATTTACATTAAGG - Intergenic
1107191852 13:37597635-37597657 GCATGTGCTCATTTGGAGGATGG + Intronic
1107529682 13:41271289-41271311 CTTTGTGCACATTTACATTAAGG - Intergenic
1108721235 13:53134896-53134918 ATTTGAGCACATTCAGAGGAGGG + Intergenic
1109401279 13:61831965-61831987 CTTTATTCACATTTGTAAGATGG - Intergenic
1113767650 13:112890999-112891021 GTTTGTGCAGATTTGGGGGCTGG + Intergenic
1114575854 14:23712746-23712768 CTTTTGCCACATTTGGAGAAAGG - Intergenic
1115570909 14:34665402-34665424 CTTTGTGCACATTTAGAAAAAGG + Intergenic
1116471221 14:45287675-45287697 GTTTGTGCACATTTATAGGAGGG - Intergenic
1118871429 14:69746246-69746268 CTTTGTGCACATTTATATTAAGG - Intronic
1119613106 14:76080355-76080377 CTTTGTGCACATTTGGAGGAGGG + Intronic
1121595505 14:95158651-95158673 CTGTGTGCACATTGTGAGGTAGG + Intergenic
1122114837 14:99522460-99522482 CTTTGTAAACATTTGTTGGATGG + Intronic
1124875742 15:33591661-33591683 CTTTGAGCAGGTTTGGAGTAAGG - Intronic
1128794675 15:70456892-70456914 CTTCGTGCACAATTTGGGGAGGG + Intergenic
1129611362 15:77061095-77061117 ATTTGTGCATATGTAGAGGAAGG - Intronic
1129641445 15:77382758-77382780 TTTTATGCACATTTGGAATATGG + Intronic
1130107558 15:80940484-80940506 CTTTGAGCAGCTTAGGAGGAAGG - Intronic
1130389776 15:83445727-83445749 CTCTGTGCCCTTTGGGAGGAGGG - Intergenic
1132025257 15:98399648-98399670 CTGTGTGCTCACATGGAGGAAGG - Intergenic
1132287198 15:100671821-100671843 ATTTGTGCACATTTGCAAAAGGG + Intergenic
1135225316 16:20650806-20650828 CTTTGTGCACATTTACATTAAGG + Intronic
1135914080 16:26588249-26588271 ATTTATGCACACTTGGTGGAAGG - Intergenic
1138317170 16:56080376-56080398 CTTTGTTCTCATTTGGCAGAAGG + Intergenic
1141404822 16:83783273-83783295 CTTTGTTCAGATTTTGAAGAAGG - Exonic
1141843671 16:86592085-86592107 CTTTGTGCACATTTATGGGTGGG + Intergenic
1146240843 17:31223672-31223694 TTTTGAGAACATTGGGAGGAAGG - Intronic
1146479296 17:33191761-33191783 CCTTGTTCACATTGGTAGGAAGG + Intronic
1147159719 17:38562952-38562974 CATTGTGCACAGCTGGGGGATGG - Intronic
1147210244 17:38869117-38869139 CTTTGTGCTCAGCGGGAGGAGGG - Intergenic
1148592606 17:48827943-48827965 CTTTCTGAAAATTTGGAGGCTGG + Intergenic
1149257487 17:54843061-54843083 CTTTGTGAACCTTTGGAGACTGG + Intergenic
1151666900 17:75550241-75550263 CTGTGTGTACCTTTGCAGGAAGG + Intronic
1152702188 17:81824640-81824662 CTTTGTTCACATCTGAAGGGAGG - Exonic
1153513334 18:5879329-5879351 ATTTGTTCACATTTCCAGGATGG + Intergenic
1153780003 18:8486065-8486087 CTTTTAGCACTTCTGGAGGAAGG + Intergenic
1153981107 18:10311404-10311426 GTTTGTGCACATGTAGAGGATGG - Intergenic
1156376492 18:36519467-36519489 ATTTGGGTAGATTTGGAGGAGGG + Intronic
1157076410 18:44472409-44472431 CTTGGGACACCTTTGGAGGAAGG - Intergenic
1159031963 18:63240439-63240461 ATTTTTGAACATTTGAAGGAAGG - Intronic
1161609893 19:5236746-5236768 CTTTGTCTAGTTTTGGAGGAGGG - Intronic
1161634196 19:5377060-5377082 CTGTGAGAACATGTGGAGGAAGG + Intergenic
1161775475 19:6259833-6259855 CATTGAGCCCTTTTGGAGGATGG - Intronic
1163189561 19:15666657-15666679 CTTTGTGAACAGTTTCAGGAAGG + Intergenic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
1168174751 19:54617328-54617350 CTTTGTGCACATTTACATCAAGG + Intronic
1168659713 19:58156102-58156124 CTTTCTGCACTTTGGGAGGCTGG + Intergenic
926124895 2:10265890-10265912 CTTTGTCAACAGTTTGAGGAAGG + Intergenic
926394420 2:12426435-12426457 CTTTGTGGACACTTGGAGGGCGG + Intergenic
927238855 2:20902328-20902350 CTTTGTGTGTATTTGGGGGATGG - Intergenic
928726235 2:34177073-34177095 AATTGTGCACATCTGTAGGAAGG + Intergenic
930465289 2:51740370-51740392 CTTTGTGTACATTTGCATGCAGG - Intergenic
932218080 2:69979564-69979586 CTTTGTGCCCAGTTTGAGGGGGG - Intergenic
932299962 2:70659705-70659727 CTTTCTGCAGTTTGGGAGGAAGG + Exonic
934681615 2:96287718-96287740 CTTGGTGCACATTGAGAAGAGGG - Intronic
935238594 2:101158692-101158714 CTTTGCGCCCATTGGGTGGAAGG - Intronic
935308061 2:101757086-101757108 CTGTGTGTACCTTTGGAGTAAGG + Intronic
935341607 2:102064194-102064216 CTTTGTTCCCACTTGGAGTAGGG + Intergenic
937579637 2:123468545-123468567 CTTTGTGCACATTTACATTAAGG + Intergenic
939354812 2:141087496-141087518 CTGTGTGAATATTTGGAGGTTGG - Intronic
939577745 2:143916536-143916558 CTTTATCCCCCTTTGGAGGAAGG + Intergenic
944470348 2:200046033-200046055 CTTTGTGCAGATTTGGGATATGG - Intergenic
944658381 2:201899484-201899506 CTGTGTGGATATTTGGAAGAGGG - Intergenic
945178487 2:207067358-207067380 CTTAGCCCACATTTGCAGGATGG - Intergenic
946059061 2:216926210-216926232 CAGTGTGCAGAGTTGGAGGAAGG + Intergenic
949029900 2:241789057-241789079 CTTTGTGCACATTTACATTAAGG + Intronic
1170365337 20:15591936-15591958 CTTAGTGAACATTTGAAAGATGG + Intronic
1170860295 20:20096681-20096703 CTTTCTGCACATATGGTAGATGG + Intronic
1172189441 20:33053415-33053437 CTCTGGGCACACTTGGGGGAGGG - Intergenic
1172219942 20:33266965-33266987 CTATGTGCTCATGTGGTGGAAGG - Intergenic
1172928741 20:38566098-38566120 CTTTGAGATCATTTGTAGGATGG + Intronic
1173000326 20:39101086-39101108 ATTTGGGTACAATTGGAGGAGGG - Intergenic
1173117392 20:40258496-40258518 CTTTGTGAACATTTGATTGAAGG - Intergenic
1173408046 20:42784220-42784242 TTTTGTTCATACTTGGAGGAGGG + Intronic
1175515668 20:59568384-59568406 CTCTGTGCCCAGGTGGAGGAGGG + Intergenic
1175968148 20:62670094-62670116 CTTTGTCCAACTTTGGAAGAAGG + Intronic
1176185448 20:63775881-63775903 CTCTATGCACAGGTGGAGGAGGG - Exonic
1178214987 21:30585581-30585603 CATTGTGTACATTTAGAAGAGGG + Intergenic
1179645880 21:42775830-42775852 CTGGGTGCTCATGTGGAGGAAGG + Intergenic
1182091281 22:27596638-27596660 CTTCGTGGAAATTAGGAGGATGG - Intergenic
1182180832 22:28346722-28346744 CAATGTGTACATTTAGAGGAAGG + Intronic
1183674217 22:39290786-39290808 CCTTGGGCACCTTTGGAGGGAGG - Intergenic
949444358 3:4117694-4117716 ATTTGTGAAAATTTGGAGCACGG + Intronic
949914404 3:8947134-8947156 CTTTGTGCACCTTTGGATTAGGG - Intronic
951300767 3:20994006-20994028 CTTTGTGCACATTTGCATTAAGG - Intergenic
951702662 3:25511791-25511813 CTCTGTGCACAACTTGAGGATGG + Intronic
955153453 3:56391971-56391993 CTTTGTACACATTAGGTGTATGG - Intronic
956644683 3:71444276-71444298 CTGAGTGCACCTTTGTAGGAGGG - Intronic
956958653 3:74372207-74372229 CATTTTGCTAATTTGGAGGAGGG - Intronic
959582461 3:107995742-107995764 TTTTATGCCCATTTGGAAGAGGG - Intergenic
959621883 3:108407606-108407628 CTTTGTGCAGATTGACAGGAGGG - Intronic
959970639 3:112405789-112405811 CTTTGTGCACATTTAGATTAAGG - Intergenic
960469135 3:118039021-118039043 CTTTTTTCACATTTGGGAGATGG - Intergenic
961562400 3:127739832-127739854 CTGCATGCACACTTGGAGGATGG - Intronic
962577858 3:136771102-136771124 CTGTGTCCTCATATGGAGGAAGG - Intergenic
964988963 3:162782391-162782413 CTTTGTTAACAATTGGAAGAAGG + Intergenic
965794807 3:172428632-172428654 CTTTGTCCTCATTTGGTGGAGGG + Intergenic
967887508 3:194343081-194343103 CTCTTTGCACAGTTGGTGGAGGG + Intronic
968236236 3:197031354-197031376 CTTTGTGCAAACTAGGAAGAAGG - Intergenic
969031398 4:4217892-4217914 CTTTGTGGAAAGCTGGAGGAGGG + Intronic
969345009 4:6564620-6564642 CTTTGTGCACATTGGCATCACGG - Intergenic
969409603 4:7019495-7019517 CTTTATGGGCATGTGGAGGAGGG + Intronic
970853471 4:20629411-20629433 CTTTGTGCACATTTACATTAAGG - Intergenic
971133222 4:23836772-23836794 CTTTGTGCACAGTTGGCAAAAGG + Intronic
971955455 4:33411595-33411617 CTTTGTGCACATTTACATTAAGG + Intergenic
976820773 4:89204310-89204332 CTTTAAGCACATTTGGAGTAAGG + Intergenic
978042390 4:104084091-104084113 TTGTGTGCAGATTTGGGGGATGG + Intergenic
978494967 4:109348807-109348829 CTTTGTGCTCACATGGTGGAAGG - Intergenic
978616663 4:110603795-110603817 TTAAGTGCAGATTTGGAGGAAGG - Intergenic
979621623 4:122804809-122804831 CTTTCTGTACACTGGGAGGAAGG - Intergenic
980071793 4:128251673-128251695 CTTTGTGCACATTTACATTAAGG - Intergenic
981671060 4:147287476-147287498 ATTTGTCCAGATATGGAGGAGGG + Intergenic
984050649 4:174860861-174860883 CATGGTTGACATTTGGAGGAAGG + Intronic
987082771 5:14440760-14440782 CTTTGTGTACATCTGGAGGGAGG - Intronic
987417144 5:17674247-17674269 CTCTGTCCTCATGTGGAGGAAGG + Intergenic
989135312 5:38148272-38148294 CTTTGTGCACTATTGAAGGCAGG + Intergenic
990186088 5:53211723-53211745 CTTTGTGCACATTTACATTAGGG - Intergenic
990408989 5:55521583-55521605 CTCTGTGTACCTTTTGAGGATGG + Intronic
990832836 5:59979521-59979543 CTTTGTCCACATTCCCAGGAGGG - Intronic
991482969 5:67103258-67103280 ATTTCTGCACATTTGGGAGAAGG + Intronic
992833149 5:80615031-80615053 CTTTGTGCAGATTTTGATGGCGG + Intergenic
994275194 5:97828709-97828731 TTTTGAGCCCATTTGAAGGAAGG + Intergenic
995813554 5:116138586-116138608 ATTTGTGCATCTTTTGAGGAAGG + Intronic
996345112 5:122478972-122478994 CTTTGTGGGGACTTGGAGGAGGG - Intergenic
997621875 5:135304470-135304492 TTTTGTGCATGTTTGGAGGCTGG + Intronic
998492645 5:142560390-142560412 CTTTGTGCAAATGTCGAGGGAGG + Intergenic
1001162490 5:169333044-169333066 CTTTGTACACATTTGTAGAAGGG + Intergenic
1002088444 5:176790680-176790702 CTTTGTGAAGGTTTGGAGGTGGG + Intergenic
1002889977 6:1324012-1324034 CTCTGTGCCCAGCTGGAGGATGG + Intergenic
1006237705 6:32650015-32650037 CTTTGTCCACCTTTTGATGAGGG - Intergenic
1006681581 6:35800597-35800619 CTTTGTGCACATTTACATTAAGG + Intergenic
1007901155 6:45414235-45414257 TTTTGTGCACATTTACAAGAGGG - Intronic
1009286122 6:61820082-61820104 CTTTGTGCATATTGAGAGCAAGG - Intronic
1009815362 6:68726335-68726357 CTGTGTGCACATCTTGAGAAAGG - Intronic
1011087098 6:83553308-83553330 CTTTGAGCTCAGTTGAAGGATGG + Exonic
1011796956 6:90966444-90966466 CTTTGTGCACATTCTGAGATAGG + Intergenic
1012269578 6:97192127-97192149 GTCTGTGCATATGTGGAGGAGGG + Intronic
1014145319 6:117990956-117990978 CTTTTTTCATATTTGGTGGATGG - Intronic
1014732211 6:125046036-125046058 CTTTGAGGACACTTGAAGGAGGG + Intronic
1015881590 6:137875393-137875415 TTTTGTGAACATTTGGATAAGGG + Intronic
1016738187 6:147502952-147502974 CTTTTTGCAGCTTTGGAGCAAGG - Intergenic
1021468219 7:20969866-20969888 CTTTGTTCTCACATGGAGGAAGG - Intergenic
1023734621 7:43223895-43223917 ATTTTTGCAGATTTGAAGGAGGG - Intronic
1024025350 7:45405432-45405454 CTTTATGGATATTTGGAGGCAGG + Intergenic
1025039525 7:55629054-55629076 CTTTGTGCACATTTACATTAAGG - Intergenic
1026141321 7:67709409-67709431 CTACGTGCACACTAGGAGGATGG + Intergenic
1027517287 7:79157696-79157718 CTTTGTGCACATTTACATTAAGG + Intronic
1029841161 7:103364753-103364775 CTTTGTGGTCATTTGGAGATAGG + Intronic
1031934756 7:127725314-127725336 CTTTGTGCAAATTTAGAGAAGGG + Intronic
1032162293 7:129520158-129520180 CTATGTCCTCATATGGAGGAAGG + Intergenic
1033302930 7:140202207-140202229 CTTTGAGCCCAATTGGAGGAGGG - Intergenic
1033479730 7:141727855-141727877 CCTGGTACACATTTGGAGGAAGG + Intronic
1036760244 8:11503720-11503742 CTATGTGCAGGTGTGGAGGATGG + Intronic
1036769676 8:11570430-11570452 CTTTGTGAACATTTTGGGGTGGG - Intergenic
1037412484 8:18613288-18613310 CCATCTGCACATTGGGAGGAGGG + Intronic
1038358614 8:26854932-26854954 CTGTGTGCTCACTTGGTGGAAGG - Intronic
1038620138 8:29134861-29134883 CTCTATGCAGATTTGGGGGAAGG + Intronic
1039954187 8:42194855-42194877 CAATGTGCATATTTGCAGGAAGG + Intronic
1040385719 8:46913785-46913807 CTTTGTCCTCATGTGCAGGAGGG - Intergenic
1040399516 8:47034319-47034341 TGTTGTGCACCTTTGGAGCAGGG - Intergenic
1041556776 8:59165943-59165965 CTTTGTGACCAGTTGGATGAAGG + Intergenic
1041652211 8:60312339-60312361 CTTTGTGCACATTTACATTAAGG - Intergenic
1042711151 8:71718934-71718956 CTTTGTTTGCTTTTGGAGGAGGG + Intergenic
1043810818 8:84737802-84737824 CTGTGTGCTCATTTGGCAGAAGG - Intronic
1045431005 8:102114953-102114975 CTTTGTGCATATGCTGAGGATGG - Intronic
1045447362 8:102281204-102281226 CATTGTCAACATTTGGAGTAAGG - Intronic
1046885582 8:119363444-119363466 CTTTGTTCACATTTGCAGTCTGG + Intergenic
1047712938 8:127570011-127570033 CTGTCTCCACACTTGGAGGAGGG + Intergenic
1048876813 8:138843134-138843156 CTATGTGCACAGTGGGAGAAAGG - Intronic
1050990153 9:12139883-12139905 CTTTGTGCACATTTACATTAAGG + Intergenic
1051875837 9:21792343-21792365 CCTTGTGCACAGTGGTAGGAAGG + Intergenic
1053337895 9:37293562-37293584 TTTTGTGGACAGTTGGAGGTGGG + Intronic
1055638513 9:78300440-78300462 CTTTGTGGACATGGGAAGGAAGG + Intronic
1055694425 9:78868390-78868412 CTTTGAGCACACCTGGAGGATGG - Intergenic
1055697058 9:78896576-78896598 CTTTATGCACATCTGTAGAAGGG + Intergenic
1055715832 9:79117048-79117070 GATAGTGCACATTTTGAGGATGG - Intergenic
1056640810 9:88368851-88368873 CCGTGTGCACATTAGGAAGATGG + Intergenic
1057443073 9:95095943-95095965 CTTTCTGCATTTTGGGAGGAGGG + Intergenic
1058583841 9:106485956-106485978 CTTTGGGCACACTTCTAGGATGG - Intergenic
1060381021 9:123172461-123172483 TTTTGTGATCATTTGGAGGAAGG - Intronic
1062041249 9:134405259-134405281 CTTTGGGCTCACCTGGAGGACGG - Intronic
1189080889 X:37971681-37971703 CTTTGTGCACATTTACATTAAGG - Intronic
1189550971 X:42093632-42093654 CTATGTGCACATTTGCATTAAGG - Intergenic
1189691564 X:43622859-43622881 CTTTGTGCACATTTATATGAAGG - Intergenic
1192175333 X:68881406-68881428 CTGCGTGCACATTTGGAAGAAGG + Intergenic
1193431029 X:81405909-81405931 CTGTGTGCAAATTTTGAAGAAGG - Intergenic
1194147776 X:90283511-90283533 CTTTGTGCACATTTACATTAAGG + Intergenic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1196740663 X:119022810-119022832 TTTTGTACAGATTTGGAGGATGG - Intergenic
1197042775 X:121959295-121959317 CTTTGTGCACATTTACATTAAGG + Intergenic
1200494163 Y:3860270-3860292 CTTTGTGCACATTTACATTAAGG + Intergenic
1201964052 Y:19711930-19711952 TTTTGGGCCTATTTGGAGGATGG - Intronic