ID: 1119613644

View in Genome Browser
Species Human (GRCh38)
Location 14:76084043-76084065
Sequence CAGCGGAGGGAGGAGGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 961
Summary {0: 1, 1: 1, 2: 7, 3: 85, 4: 867}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119613631_1119613644 26 Left 1119613631 14:76083994-76084016 CCTTAGTGACGCAGCACTGCCAC 0: 1
1: 0
2: 1
3: 5
4: 70
Right 1119613644 14:76084043-76084065 CAGCGGAGGGAGGAGGCGGCGGG 0: 1
1: 1
2: 7
3: 85
4: 867
1119613635_1119613644 4 Left 1119613635 14:76084016-76084038 CCTGCATCATAGGCTTCCAGGCA 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1119613644 14:76084043-76084065 CAGCGGAGGGAGGAGGCGGCGGG 0: 1
1: 1
2: 7
3: 85
4: 867
1119613633_1119613644 7 Left 1119613633 14:76084013-76084035 CCACCTGCATCATAGGCTTCCAG 0: 1
1: 0
2: 1
3: 14
4: 191
Right 1119613644 14:76084043-76084065 CAGCGGAGGGAGGAGGCGGCGGG 0: 1
1: 1
2: 7
3: 85
4: 867

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119613644 Original CRISPR CAGCGGAGGGAGGAGGCGGC GGG Intronic
900103732 1:973590-973612 CTGCGGTGGGAGGTGGCGGGTGG - Exonic
900113895 1:1020580-1020602 GCGAGGAGGGAGGCGGCGGCGGG - Intronic
900125199 1:1065837-1065859 AAGCAGAGAGAGAAGGCGGCAGG + Intergenic
900204929 1:1427684-1427706 CAGCAGCGGGCGGAGGCGCCGGG - Exonic
900227703 1:1540650-1540672 GGGAGGAGGGAGGAGGAGGCAGG - Intergenic
900313098 1:2043859-2043881 CAGGGGAGGAAAGAGGAGGCTGG - Intergenic
900384047 1:2401300-2401322 GGAAGGAGGGAGGAGGCGGCAGG - Intronic
900427672 1:2587855-2587877 CAGCAGGGAGAGGAGGTGGCAGG - Intronic
900793079 1:4692223-4692245 CAGCGGCGGGAGGCAGCAGCAGG - Intronic
900936044 1:5766790-5766812 CAGGTGCGGGAAGAGGCGGCAGG - Intergenic
901063081 1:6482449-6482471 GACAGGAGGGAGGAGGAGGCCGG + Intronic
901120013 1:6883505-6883527 CAGTGGAGGGAGGAGGCATAAGG + Intronic
901197891 1:7450437-7450459 CAGAGGTGGGTGGAGGTGGCAGG - Intronic
901441061 1:9278783-9278805 TGGAGGAGGGAGGAGGCTGCTGG - Intergenic
901513446 1:9729894-9729916 CTGGGGAGGGAGGACCCGGCGGG + Exonic
901628393 1:10636214-10636236 GAGCCGAGGGAGGAGGCAGGAGG + Intergenic
901644011 1:10706958-10706980 GAGAGGATGGAGGAGGAGGCCGG + Intronic
902219884 1:14958097-14958119 CAGGGGAGGGAGCAGGCAGAGGG - Intronic
902517945 1:16999969-16999991 CAGGGGAGGAAGGAAGCTGCAGG + Intronic
902603259 1:17554351-17554373 GAGCAGAGAGAGGATGCGGCTGG + Intronic
902829696 1:19004087-19004109 CCGGGGAGGGATGAGGAGGCTGG - Intergenic
902870784 1:19312434-19312456 CAGCGGCCGGAGGAGAGGGCTGG - Exonic
903179730 1:21599109-21599131 CAAAGAAAGGAGGAGGCGGCAGG + Intronic
903302740 1:22390773-22390795 TAGGGGAGGGAGGTGGAGGCTGG - Intergenic
903455626 1:23484617-23484639 CAGAGGAGGGAGGAAGAGGGAGG - Intergenic
903476236 1:23620800-23620822 CTGCGGAGGCAGGAGGAGGAAGG - Intronic
903603065 1:24556162-24556184 CAGAGCAGGTAGGAGGCGCCTGG + Exonic
903907406 1:26696491-26696513 CAGCAGCGGGAGGAGGCGGGGGG + Exonic
903907728 1:26697546-26697568 CAGCTGAGTGGGGAGGGGGCTGG + Intronic
903925133 1:26826622-26826644 CTGCGGCGGGAGGCCGCGGCGGG + Intergenic
903925139 1:26826635-26826657 CCGCGGCGGGCGGTGGCGGCGGG + Intergenic
904045103 1:27603965-27603987 CAGCGGAGAGAGCAGAAGGCAGG - Intronic
904260177 1:29283580-29283602 CAGAGGAGGGAGGAGCCTGGAGG - Intronic
904493921 1:30876482-30876504 CAGGGGAGGGATGAGGAGGATGG - Intronic
904586601 1:31584277-31584299 CAGGGGAGGGAAGAGGCAGTAGG - Intronic
904672917 1:32179684-32179706 CTGAGGCGGGAGCAGGCGGCTGG + Intronic
904772256 1:32886782-32886804 GAGCGGATGGAGGCGGGGGCTGG + Intronic
905066977 1:35192479-35192501 CTGCCGCGGGCGGAGGCGGCGGG + Exonic
905226439 1:36482078-36482100 GTGGGGAGGGAGGAGGGGGCTGG + Intronic
905289615 1:36912422-36912444 CAGCAGAGGGGGGAGGAGGGGGG - Intronic
905463071 1:38134002-38134024 CCGAGGAGGGAGGCGGCGGCCGG + Intergenic
905520502 1:38595811-38595833 ATGCAGAGGAAGGAGGCGGCTGG + Intergenic
905632167 1:39524913-39524935 CAGGGAAGGGAGGAGGCGAAAGG + Intronic
905948370 1:41923473-41923495 CAGAGGCTGGAGGAGGTGGCGGG + Intronic
905960119 1:42035997-42036019 CGGCGGTGGGCGGAGGAGGCGGG - Intergenic
905995282 1:42376008-42376030 CAGCGCAGGGAGGGTGGGGCAGG + Intergenic
906653845 1:47533645-47533667 AGGCGGAGGGAGGAGGCAGGGGG + Intergenic
906792833 1:48673927-48673949 CAGGGGAGGAAGGAAGCAGCAGG - Intronic
907046254 1:51302088-51302110 CAGTGGAGGGAGGTGGAGGGAGG - Intronic
907243813 1:53094718-53094740 CCGGGGAGGGCGGAGCCGGCAGG - Intronic
907864836 1:58389766-58389788 CAGGGGAGAGAGGAGAGGGCAGG + Intronic
908627825 1:66066269-66066291 TAGGGGATGGAGGAGGCTGCGGG - Intronic
908738960 1:67307812-67307834 CAGAGGCGGGAGGCGGAGGCGGG + Exonic
909460687 1:75909642-75909664 CAGCGGGGGGAGGGGGTGGGAGG - Intronic
912197752 1:107419222-107419244 GAGAGGAGGGAGGAGGTAGCGGG - Intronic
913141193 1:115942933-115942955 CAGCCAAGGGAGGAGGGTGCTGG - Intergenic
914918396 1:151831828-151831850 CAGGGGAGGGAGGAGGGCGGAGG + Exonic
914920953 1:151847205-151847227 CAGGGGAGGCAGGAGGCAGGAGG + Intergenic
914920962 1:151847232-151847254 CAGGGGAGGCAGGAGGCAGGAGG + Intergenic
914920978 1:151847279-151847301 CAGGGGAGGCAGGAGGCAGGAGG + Exonic
914920987 1:151847306-151847328 CAGGGGAGGCAGGAGGCAGGAGG + Exonic
914993103 1:152515480-152515502 CAGCAGGAGGAGGAGGAGGCGGG - Exonic
915326226 1:155082451-155082473 CCGCGGAGGGGGCAGGCGGGCGG - Intronic
915328395 1:155093123-155093145 CAGAAGAGGGAGGAGGTGGGAGG + Intergenic
915341666 1:155179787-155179809 CAGCGGCGGGAGGAGGTGAGGGG + Exonic
915583763 1:156831983-156832005 CACCTGAGGGAAGAGGCAGCTGG + Intronic
916233382 1:162561790-162561812 CAGCCCAGCGAGGAGACGGCGGG + Intronic
916961440 1:169893704-169893726 CCGGGCGGGGAGGAGGCGGCGGG - Intronic
918015941 1:180632424-180632446 CAGCGGAGCCGGGAGGCGGCCGG - Intronic
918617093 1:186557481-186557503 GAGTGGAGGGAGGAGGAGGGAGG - Intergenic
919486974 1:198157467-198157489 CAGCGGTGGGAGGGGGCGGCAGG + Intronic
919748681 1:201023685-201023707 CTGCGGCGGGAGGTGGCTGCCGG - Exonic
919790720 1:201289093-201289115 CAGCAGAGGGGGCAGGAGGCTGG + Intronic
920173299 1:204084693-204084715 GAGAGGAGGGAGGAAGGGGCTGG - Intronic
920546199 1:206820797-206820819 CGGGGTGGGGAGGAGGCGGCAGG - Intronic
921089696 1:211830773-211830795 GGGCGGCGGGAGGAAGCGGCGGG + Intergenic
921167667 1:212518571-212518593 TAGCTGAGGGAGGAGGGGGCAGG + Intergenic
921919258 1:220647890-220647912 CAGAGGAGGGCGGAGGTCGCGGG + Intronic
922060802 1:222089401-222089423 CAGTGGAGTGAGGAGGCTGAGGG + Intergenic
922675825 1:227548230-227548252 CATCAGAAGGAGGAGGTGGCAGG + Intergenic
922723277 1:227909778-227909800 GAGGGGAGGGAGGAGGCAGGAGG + Intergenic
922866286 1:228863944-228863966 CAGCGCAGGGAGCAGGCTCCTGG - Intergenic
924383417 1:243483194-243483216 GAGCCCGGGGAGGAGGCGGCGGG + Intronic
1062782318 10:225447-225469 AAGCTGAGGCAGGAGGAGGCTGG - Intronic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1064252612 10:13718354-13718376 CAGCAGAGATAGGAGGCGGTGGG + Intronic
1064913305 10:20427310-20427332 AAGCAGTGGGAGGAGGCTGCAGG + Intergenic
1065099672 10:22321049-22321071 CGGCGGGGGGAGGGGGCGGGCGG + Intronic
1065373877 10:25016990-25017012 CAGCAGGCGGAGGAGGCCGCGGG - Intronic
1065712869 10:28533649-28533671 CGGCGGCGGGGGGCGGCGGCGGG + Intronic
1066671434 10:37844592-37844614 CAACGTAGGGAGAAGGCAGCTGG + Intronic
1067031755 10:42882791-42882813 CAGCTGAGTGAGGAGGCAGGAGG + Intergenic
1067091364 10:43267130-43267152 ACGCGGAGGGAGGAGGGTGCGGG + Intergenic
1068783444 10:60944766-60944788 CCGCCCAGGGAGGAGGAGGCTGG - Intronic
1069651429 10:70052810-70052832 TAGCGGGGGGAGGAGGAGGAGGG - Exonic
1070112031 10:73495820-73495842 CAGCCCCGGGAGGGGGCGGCGGG + Exonic
1070750759 10:78962742-78962764 GAGGGGAGGGAGGGGGTGGCCGG - Intergenic
1070781138 10:79138054-79138076 CAGCGGGAGGGGCAGGCGGCGGG + Intronic
1070997300 10:80796975-80796997 GAGTGGAGGGAGGATGAGGCTGG + Intergenic
1071847517 10:89535668-89535690 CGGCGAGGTGAGGAGGCGGCGGG - Intronic
1072216404 10:93290992-93291014 CAGCAGAGGGAGGAGAGGGTGGG + Intergenic
1073035686 10:100562850-100562872 GGGTGGCGGGAGGAGGCGGCCGG + Intergenic
1073136878 10:101225047-101225069 CAGAGAAGGAAGGAGACGGCAGG - Intergenic
1074153045 10:110775581-110775603 CTGCTGAGAGAGGAGGCAGCAGG - Intronic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074765057 10:116694533-116694555 AAGGGGAGGGAGGAGGTGGAGGG - Intronic
1074772052 10:116741256-116741278 CAGCAGAGGGTGGGGGCCGCAGG + Intronic
1074792754 10:116907711-116907733 CAGCGGAGGGAGGGGAAGGCAGG + Intronic
1075081475 10:119386816-119386838 CAGAGGAGGGAGGAGGTGGCGGG + Intronic
1075125088 10:119693080-119693102 CAGATGAGGGAGGAGAGGGCAGG - Intergenic
1075207937 10:120462829-120462851 CACCGCAGGGTGGAGGCAGCAGG + Intronic
1075702435 10:124478126-124478148 CAGAGGAGGCAGGAGGAGGGAGG + Intronic
1075724602 10:124604904-124604926 CAGGGTAGAGAGGAGGCGGGTGG + Intronic
1076413161 10:130265879-130265901 CAGAGGAGGGAGGTGGAGGGAGG + Intergenic
1076674327 10:132140371-132140393 GGGCAGCGGGAGGAGGCGGCGGG + Intronic
1076674328 10:132140374-132140396 CAGCGGGAGGAGGCGGCGGGAGG + Intronic
1076724842 10:132408493-132408515 GAGGGGCGGGAGGAGGAGGCTGG + Intronic
1076793182 10:132787236-132787258 CCGCGGAGGAAGGCGGCGCCCGG + Intergenic
1076795869 10:132798315-132798337 CAGAGGTGGGCCGAGGCGGCTGG + Intergenic
1076825338 10:132964450-132964472 GAGCGCAGGGAGGCGGCCGCAGG - Intergenic
1076865630 10:133164982-133165004 CAGAGCAGGGTGGAGGCTGCAGG + Intronic
1076868231 10:133179864-133179886 CAGCGGAGGGAACAGGCTGGAGG - Intronic
1076917864 10:133433361-133433383 CAGCGGAGGCAGGTAGAGGCGGG - Intergenic
1076937862 10:133577438-133577460 CAGCGGAGGCAGGTAGAGGCGGG - Intergenic
1077017379 11:403050-403072 CAGGGCGGGGAGGAGTCGGCGGG - Intronic
1077029729 11:459638-459660 CAGACGTGGGAGGAGGAGGCAGG - Intronic
1077056382 11:595884-595906 CAGCAGAGGGGGGCGGCGGGTGG - Intronic
1077093496 11:789871-789893 CGGGAGAGGGAGGCGGCGGCCGG - Intronic
1077320080 11:1937172-1937194 CAGGAGAGGGAGGAGGCTCCGGG - Intronic
1077364036 11:2154385-2154407 CAGAGGAGGCAGGAGCCAGCAGG - Intronic
1077365069 11:2158348-2158370 AAGAGGAGGGAGGCGGTGGCTGG - Intronic
1077494329 11:2879128-2879150 CAGCAGAGGGATGAAACGGCAGG + Intergenic
1077545002 11:3165341-3165363 CGGCGGAGGGAGGAGGCCCAGGG + Exonic
1078930029 11:15905680-15905702 CAGAGGAGGGAGGTGGCTGGTGG - Intergenic
1079441588 11:20520271-20520293 CTGGGGAGGGAGGATGCGGTGGG + Intergenic
1079642977 11:22829844-22829866 CAGTGGAGGGCGGTGGGGGCGGG - Exonic
1079645902 11:22863621-22863643 TGGCGGAGGGAGGTGGCGGAGGG + Intergenic
1080804128 11:35636324-35636346 CAGCAGAGAGAGGAGGGGGTGGG + Intergenic
1081164016 11:39786183-39786205 CAGAGGAGGGCTGAGGTGGCAGG + Intergenic
1081406556 11:42705435-42705457 CAGCGGCGGGATGGGGCGGTGGG - Intergenic
1081569033 11:44278336-44278358 CAGGGGAGGGAGTAGAGGGCAGG - Intronic
1081737499 11:45414119-45414141 CTGAGGAGGTAGGAGGCTGCAGG + Intergenic
1081747701 11:45484530-45484552 CAGCGGCGGGAGGAAGTGGAGGG + Intergenic
1082813965 11:57496162-57496184 CAGCTGTGAGAGGAGGGGGCAGG + Exonic
1082830674 11:57614669-57614691 CACCTGAGGCAGGAGGTGGCAGG - Exonic
1083598572 11:63932220-63932242 CAGCGGAGGAGGGAGGAGCCAGG + Intergenic
1083605298 11:63975041-63975063 CGGCGCAGCGAGGAGGCGACAGG - Intronic
1083658914 11:64243134-64243156 CAGCTGAGGGAGGGGGTGTCAGG + Intronic
1083693460 11:64426289-64426311 CAGCTGAGGGAGGCTGAGGCAGG - Intergenic
1083821348 11:65172993-65173015 CTGCGGAGGGAGTAGGTGCCTGG - Exonic
1083857824 11:65401692-65401714 AAGCTGGGGGAGGAGGTGGCTGG - Intronic
1083932185 11:65852152-65852174 CAGGGGAGGGAGGCAGTGGCTGG - Intronic
1084460273 11:69293208-69293230 CAGCGGAGGGGAGAGAGGGCCGG - Intergenic
1084640676 11:70424001-70424023 CAGGGGAGGGAGCAGTCGGGTGG + Intronic
1084665341 11:70573313-70573335 CAGCGGTGGGGGGGGGGGGCGGG + Intronic
1084699894 11:70779783-70779805 CAGCAGAAGGAGGGGGTGGCAGG - Intronic
1085395781 11:76206505-76206527 CCGGGGAGAGCGGAGGCGGCGGG + Exonic
1085399148 11:76225209-76225231 CAGCTGAGGGCGGGGACGGCCGG + Intergenic
1085445688 11:76599274-76599296 CAGCTGGGGGAGGGGGCCGCAGG - Intergenic
1085446826 11:76606385-76606407 CAGCCAAGGGAGGGGGCGGATGG - Intergenic
1085539616 11:77254319-77254341 CAGCTGGGGGATGAGGTGGCAGG + Intronic
1086329932 11:85743884-85743906 CAGCTGAGGGAGGAGGGAGCAGG - Intronic
1088415952 11:109589212-109589234 TAAAGGAGAGAGGAGGCGGCAGG + Intergenic
1089432439 11:118435715-118435737 CAGTAGAGCGAGGAGGTGGCAGG + Intergenic
1089556979 11:119320353-119320375 GAGCGGGGGGAGGGGGCGACGGG + Intronic
1089624676 11:119743487-119743509 CAGGTGAGGGAGGAGGGGGAAGG - Intergenic
1089660654 11:119983092-119983114 AACAGGAGGGAGGAGGGGGCTGG - Intergenic
1089742105 11:120591566-120591588 CAGAGGAGGCAGAAGGCAGCTGG - Intronic
1089966365 11:122656988-122657010 CAGCATAGGGTGGCGGCGGCCGG + Intronic
1090401749 11:126453681-126453703 CTGGGAAGGGAGGAGGCGGAGGG - Intronic
1090473944 11:127003399-127003421 CGGGGGAGGGAGGAGGAGGGAGG + Intronic
1090902562 11:131045880-131045902 CAGGGAAGGAAGGAGGTGGCGGG + Intergenic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1091458706 12:627993-628015 CAGGGCGGGGAGGATGCGGCAGG - Intronic
1091567884 12:1661849-1661871 CGGGGCAGGGAGGAGGCGGGAGG + Intergenic
1091769611 12:3142397-3142419 CAGGGAAGGGAGGAGGCGAGAGG - Intronic
1091885394 12:4013530-4013552 AAGTGGAGGGAGAAAGCGGCTGG - Intergenic
1092162623 12:6324299-6324321 AAGAGGCTGGAGGAGGCGGCGGG - Intronic
1092188423 12:6499106-6499128 CATCCCAGGCAGGAGGCGGCAGG + Intronic
1092228995 12:6766615-6766637 CGGCGGAGGGTGGCCGCGGCCGG - Exonic
1092810399 12:12266962-12266984 GCGCCGGGGGAGGAGGCGGCGGG - Intronic
1093125441 12:15322758-15322780 GAGCAGAGGCAGGAGGCGGCGGG - Exonic
1094353302 12:29550467-29550489 CAGAGGAGCGAGGAGGTGGCAGG + Intronic
1094466113 12:30755022-30755044 CACCGGAAGGAGGCGGTGGCGGG - Intergenic
1095349041 12:41188330-41188352 CAGTGGAGGGAGGTGGCGGGTGG - Intergenic
1096085644 12:48863412-48863434 CAAAGGAGGGAGGAGGTGGGGGG + Intronic
1096647602 12:53047231-53047253 CAGTGGCGGGAGCGGGCGGCCGG - Intronic
1096797807 12:54089633-54089655 AAAGGGAGTGAGGAGGCGGCTGG + Intergenic
1097046254 12:56189538-56189560 CGGCGGCGGGAGGCGGCGGGAGG - Exonic
1097046255 12:56189541-56189563 CCGCGGCGGCGGGAGGCGGCGGG - Exonic
1097222934 12:57461237-57461259 CAGTAGAGGGAGAAGGCGGGCGG + Intronic
1097748709 12:63328810-63328832 TAGGGGAGGGAGGAGAAGGCTGG + Intergenic
1097946761 12:65377419-65377441 CGGGGGACGGAGGAGGGGGCAGG - Intronic
1098161056 12:67648681-67648703 CGGCGGAGGGCGGCGGGGGCGGG + Intronic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098394420 12:70003088-70003110 CAGAGGAGAGAGGAGGAGGGAGG + Intergenic
1098394423 12:70003098-70003120 AGGAGGAGGGAGGAGGAGGCAGG + Intergenic
1099064935 12:77963997-77964019 AAGAGGAGGGAGGAGGAGGGAGG - Intronic
1101032123 12:100671064-100671086 AAGCAGGGGGAGGAGGTGGCAGG + Intergenic
1101542421 12:105676991-105677013 CAGGGGAGGCAGGAGGGGCCAGG + Intergenic
1102468164 12:113142640-113142662 CAGCGGTGGCAGGAGTGGGCAGG + Intergenic
1102645826 12:114403265-114403287 CGGAGGAGGCAGGAGGAGGCAGG + Intronic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1102865188 12:116368639-116368661 CGGCGGGGGGAGGAGGGGTCAGG - Intergenic
1103039715 12:117685132-117685154 CAGGGGATGGTGGAGGAGGCTGG - Intronic
1103080099 12:118016939-118016961 CCGCGCGGGGAGGAGGTGGCTGG + Intronic
1103363991 12:120369274-120369296 CGGCGGGGGGAGGAGCCGGCAGG - Intergenic
1103413720 12:120730458-120730480 CTGTGTAGGGAGGAGGAGGCTGG + Intronic
1103527885 12:121579688-121579710 CGGTGGAGGGAGGAGGCAGGGGG - Intronic
1103741652 12:123095499-123095521 AGGCGGGGGGAGGAGGGGGCAGG - Intronic
1103932244 12:124457056-124457078 CAGGGGAGGGCGGGGGTGGCTGG - Intronic
1103972120 12:124678892-124678914 CAGGGGAGGGAGGAAGAGGAGGG - Intergenic
1104809536 12:131611993-131612015 CAGCGGAGTGGGGAAGGGGCAGG - Intergenic
1104843161 12:131834272-131834294 GGGAGGAGGGAGGAGGCGGGAGG - Intronic
1104903543 12:132201805-132201827 CAGCAGAGGGAAGAGACGCCTGG - Intronic
1104965849 12:132508517-132508539 TAGCAGAGGCAGGAGCCGGCTGG + Intronic
1104982328 12:132579047-132579069 CAGAGGAGGGAAGGGGAGGCGGG - Intronic
1104983047 12:132582520-132582542 CACCGCAGGGAGGAGTCGCCGGG - Intronic
1105612269 13:21978743-21978765 CAGCCGAGTGTGGAGGCAGCAGG - Intergenic
1106183369 13:27386951-27386973 GACTGGAGGGAGGAGGCAGCTGG + Intergenic
1106232584 13:27832660-27832682 CAGGGGCTGGAGGAGGTGGCGGG + Intergenic
1106333016 13:28756483-28756505 CAGCAGAGGAAAGAGGAGGCTGG + Intergenic
1106447671 13:29850666-29850688 CCGCGGAGGGAGGACGAGGACGG - Exonic
1106615464 13:31323103-31323125 CAGGGGACGGAGGAGGGGGTTGG + Intronic
1107133292 13:36919584-36919606 CAGCGGACAGAGGGGGCGGCGGG - Intronic
1108407958 13:50124153-50124175 CTGGGGAAGGAGGAGCCGGCGGG + Intronic
1108531470 13:51330999-51331021 CAGAGGTGGGAGGAGGTGGGAGG - Intergenic
1110119372 13:71864817-71864839 GCGCGCACGGAGGAGGCGGCGGG - Intronic
1110318571 13:74135476-74135498 CGGGAGAGGGAGGAGGCGGCCGG + Intergenic
1113343991 13:109455834-109455856 CATCGGAGGGAGAAGAAGGCAGG - Intergenic
1113433122 13:110267260-110267282 CAGTGGAGGGAGGAGGGGCAGGG + Intronic
1113464819 13:110505790-110505812 CAGCGGAGGGAGGCCACTGCTGG + Intronic
1113514842 13:110886184-110886206 CAGCCCAGGGAAGAGGCAGCGGG + Intronic
1113618008 13:111694748-111694770 CAGCGGAGAGAGGAGAGGGAGGG - Intergenic
1113618019 13:111694807-111694829 CAGCGGAGAGAGGAGAGGGAGGG - Intergenic
1113623541 13:111780009-111780031 CAGCGGAGAGAGGAGAGGGAGGG - Intergenic
1113623552 13:111780068-111780090 CAGCGGAGAGAGGAGAGGGAGGG - Intergenic
1113768352 13:112894345-112894367 CAGCCCTGGGAGGAGGCGTCAGG + Intergenic
1113779747 13:112969226-112969248 CTGGGCAGGGAGGCGGCGGCTGG + Exonic
1113861393 13:113490079-113490101 CAGCGCAGGAGGGAGGCTGCTGG - Intronic
1113890138 13:113731336-113731358 GAGAGAAGGTAGGAGGCGGCCGG + Exonic
1113982526 13:114288433-114288455 CAGTGGAGGAAGGAAGCGCCAGG + Intronic
1114265745 14:21071582-21071604 CTGGGGAGGGAGGCGGCGGGCGG - Intronic
1114612894 14:24053821-24053843 GTGGGGAGGGAGGAGGTGGCTGG + Intronic
1115119970 14:29927537-29927559 CAGCGGAGGGCGGGGGCTGGCGG + Exonic
1115922722 14:38394484-38394506 CAGTGGAGAGAAGAGGTGGCAGG + Intergenic
1116498923 14:45596805-45596827 CAGGGGAGGGGGGAGGGGGGAGG - Intergenic
1117551647 14:56843108-56843130 CAGCTGAGGGAGGCTGAGGCAGG - Intergenic
1118473172 14:66093881-66093903 CAGCGGGGCGAGGAGGCAGGGGG + Intergenic
1119441463 14:74631371-74631393 CTGGGGAGGGAGGAGGCCCCAGG + Intergenic
1119613644 14:76084043-76084065 CAGCGGAGGGAGGAGGCGGCGGG + Intronic
1119693087 14:76692041-76692063 AAGCGGAGGCAGGAACCGGCAGG + Intergenic
1119704715 14:76776446-76776468 CTGCGGAGGGAGGAGGTGGGTGG + Intronic
1119745374 14:77040144-77040166 TAACGGAGGGAGGAGGAGGAGGG - Intergenic
1119778147 14:77260760-77260782 CTGCGCAGGGAGGAAGCAGCGGG + Intergenic
1119785499 14:77310650-77310672 CAGGGAAGGCAGGAGGAGGCAGG - Intronic
1119821117 14:77616773-77616795 CAGCGAAGGGAAAAAGCGGCGGG + Exonic
1120167970 14:81220675-81220697 GAGCGGAGAGAGGAGGAGGAGGG + Exonic
1120723898 14:87916655-87916677 CAGTGGAGGAAGGAGCAGGCGGG + Intronic
1120856749 14:89219149-89219171 CAGGGGAGGGAGGTGGTGGGAGG + Intronic
1120881379 14:89417288-89417310 GAGCGGAGGGCGGAGGGAGCCGG + Intronic
1121368078 14:93332820-93332842 CAGCGGCGGGAGGAGCCTCCGGG - Exonic
1121417479 14:93788956-93788978 CAGCGGCGGGAGGCGCCGGCAGG + Intergenic
1121950031 14:98163628-98163650 CAGGGCAGGGAGGAGGGGACAGG - Intergenic
1122445038 14:101761839-101761861 CTGCGGGGGCAGGCGGCGGCAGG + Exonic
1122558187 14:102592608-102592630 GAGCGGAGAGGGGAGGAGGCAGG - Intergenic
1122789936 14:104179871-104179893 CTGCGGGGGGAGGATGCGGAGGG + Intronic
1122799702 14:104223414-104223436 CAGAGAAAGGAGGAGGCAGCTGG - Intergenic
1122975178 14:105168128-105168150 GAGCGGAGGGAGGCGCGGGCCGG + Intronic
1123018056 14:105384856-105384878 CTGCAGGGGGAGGAGGCGGTGGG - Intronic
1123964091 15:25438548-25438570 CGGTGGCGGGCGGAGGCGGCGGG - Exonic
1123986584 15:25651700-25651722 CAGCTGAGGGAGGCTGAGGCAGG - Intergenic
1124051284 15:26199343-26199365 CAGCAGAGGAAGGGGGAGGCAGG - Intergenic
1124497676 15:30196262-30196284 CTTGGGTGGGAGGAGGCGGCGGG + Intergenic
1124612265 15:31216323-31216345 GAGCGGTGGGAGGAGGAGGAGGG + Intergenic
1124745910 15:32342429-32342451 CTTGGGTGGGAGGAGGCGGCGGG - Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125685080 15:41559185-41559207 GAGGGCGGGGAGGAGGCGGCGGG - Exonic
1125968715 15:43894676-43894698 CAGGGGAGGGAGGCAGCGGAGGG + Intronic
1125999543 15:44195645-44195667 AGCCGGAGCGAGGAGGCGGCAGG + Intergenic
1126096359 15:45093627-45093649 CATTTGAGGGAGGAGGAGGCTGG - Exonic
1126321938 15:47434384-47434406 AAGCGGAGGGAGGAGGATCCTGG + Intronic
1127515512 15:59689369-59689391 CAGCCGGCGGTGGAGGCGGCGGG + Exonic
1127849919 15:62903338-62903360 CTGCGGAAGGAGGAAGCAGCAGG - Intergenic
1127976706 15:64002871-64002893 CAGCAGAGGGAGGAGGAGAGAGG + Intronic
1128740978 15:70083532-70083554 GAGGGGAGGGAGGAGGGGGAAGG - Intronic
1129264221 15:74385439-74385461 CAGGCGAGGGAGGCAGCGGCTGG - Intergenic
1129680752 15:77657231-77657253 CAGGGGAGGGAGGAGGAGCCAGG - Intronic
1129704501 15:77786586-77786608 CAGAGGAGGGAGGGGATGGCAGG + Intronic
1130224407 15:82046264-82046286 CGGGGGCGGGAGGAGGCCGCGGG + Intergenic
1130519974 15:84654748-84654770 CAGAGAAGAGAGGAAGCGGCCGG + Intergenic
1131096064 15:89655055-89655077 CAGCTGGGGCTGGAGGCGGCGGG + Intronic
1131145043 15:90005358-90005380 CAGGTGAGGCAGGAGGGGGCTGG + Intronic
1131272727 15:90956945-90956967 CAGCGGTGCGGGGAGGCGACTGG - Intronic
1132186679 15:99806946-99806968 CAGCTGAGGGAGGAAGGGGCGGG - Intergenic
1132230573 15:100181037-100181059 AAGAGGAGGGAGGAGAGGGCAGG - Intronic
1132429008 15:101745765-101745787 CAGCTGAGGGAGGAAGGGGCGGG + Intergenic
1132514585 16:360206-360228 AAGCAGAGGGAGGCGGCGGAGGG - Intergenic
1132519746 16:381719-381741 CGGCGGAGGCAGGCGGGGGCCGG + Exonic
1132579814 16:679815-679837 CAGGGGCGGGAGGCGGCGGCTGG + Intronic
1132710256 16:1263192-1263214 CTGCGCAGGGAGGAGAGGGCTGG + Intergenic
1132860908 16:2071303-2071325 CAAGGGAGGGAGGAGGCTGTGGG + Intronic
1132983739 16:2752825-2752847 AGGCGGCGGGCGGAGGCGGCGGG + Exonic
1133014643 16:2933778-2933800 TACCGGCGGGAGAAGGCGGCTGG + Exonic
1133015366 16:2937183-2937205 TACCGGCGGGAGAAGGCGGCCGG + Exonic
1133031357 16:3012776-3012798 CAGCGGATGGATGAGGGGCCTGG - Exonic
1133103747 16:3494134-3494156 CAGGGGAGGGAGGAGGTTGAGGG + Intronic
1133162702 16:3922509-3922531 CAGGGCAGGGAGGAAGCCGCTGG + Intergenic
1133520183 16:6549264-6549286 GAGAGGAGGGAGGAGGAGGAGGG + Intronic
1133520278 16:6549518-6549540 GAGAGGAGGGAGGAGGAGGAGGG + Intronic
1133807426 16:9136101-9136123 AAGCGGAGGGAGGAGCAGGCAGG + Intergenic
1133924577 16:10182568-10182590 CTGAAGAGGGAGGAAGCGGCAGG - Intronic
1134469761 16:14513594-14513616 CAGGGGAGGGAGCAGGAAGCTGG - Intronic
1135183081 16:20291920-20291942 CAGGGGAGAGAGGAGGGGGAGGG + Intergenic
1136024739 16:27462251-27462273 CAGCAGGGTGTGGAGGCGGCTGG - Intronic
1136267198 16:29128746-29128768 CAGTGGAGGGGGAAGGAGGCTGG + Intergenic
1136343878 16:29663150-29663172 CAGCTGTGGGAGCAGGCGGGTGG + Intronic
1136532858 16:30881672-30881694 GAGCGGAGGGAGGGAGGGGCAGG - Intronic
1136573060 16:31108393-31108415 CGGCGGAGGGCGCAGGCGGCTGG + Intronic
1136612281 16:31373400-31373422 CTGGGGAAGGAGGAGGAGGCAGG + Intronic
1137592303 16:49700937-49700959 CAGAGGAGGGAGGAGAAGGGAGG + Intronic
1137617146 16:49855133-49855155 CAGGGGCGGGAGGGGGCGCCAGG + Intronic
1137744775 16:50812580-50812602 CACCTGAGGCAGGAGGTGGCAGG - Intergenic
1138454935 16:57115764-57115786 CAGTGCAGGGAGGGGGCTGCTGG - Intronic
1138537225 16:57666591-57666613 AAGCTGGGGCAGGAGGCGGCAGG + Intergenic
1139652469 16:68369395-68369417 CAGAGGAGGGAGGTGGGGACAGG + Intronic
1139960132 16:70712706-70712728 CTTCTGAGGGAGGAGGTGGCAGG + Intronic
1139970811 16:70773552-70773574 CTGAGGAGGGAAGAGGGGGCTGG + Intronic
1141054641 16:80804086-80804108 CGGCGGCGGGCGGCGGCGGCGGG - Intronic
1141096164 16:81164678-81164700 GAGCTGAGGGAGGAGGCAGCGGG + Intergenic
1141099340 16:81185592-81185614 CAGCAGAGTCAGGCGGCGGCAGG + Intergenic
1141149827 16:81556266-81556288 CTGCAGAAGGAGGTGGCGGCGGG + Intronic
1141461150 16:84179524-84179546 CTGCGGAGGGAGGAAGAGGAAGG - Exonic
1141608501 16:85169023-85169045 ACGCGGGGGGAGGCGGCGGCGGG + Intergenic
1141623731 16:85250442-85250464 CAGCTGGGGGCGGAGGCGCCAGG + Intergenic
1141741515 16:85896310-85896332 CAGGGAAGGGATGAGGAGGCCGG + Intergenic
1141903707 16:87008899-87008921 CACGGGAGGGAGGAGCCGGGTGG + Intergenic
1141985152 16:87575170-87575192 CAGTGCAGGGAGGAGGGAGCAGG - Intergenic
1142070490 16:88089069-88089091 CAGTGGAGGGGGAAGGAGGCTGG + Intronic
1142135732 16:88451247-88451269 CAGCGAAGGGGGCAGGCGGCAGG - Intergenic
1142141460 16:88474529-88474551 CAGGGATGGGAGGAGGCGGGTGG - Intronic
1142189387 16:88710841-88710863 CCGCGCAGGGAGGTGGAGGCGGG + Intronic
1142190698 16:88716062-88716084 CTGCGGAGGGAGCAGGGTGCGGG - Exonic
1142211905 16:88812379-88812401 CAGCCCAGGGCGGAGGCGGCGGG + Intergenic
1142215897 16:88829668-88829690 CAGAGGTGGGAGCAGGCGCCTGG - Intronic
1142252626 16:88999667-88999689 GGGCGGAGGGAGGGGGCGGGGGG + Intergenic
1142421314 16:89972302-89972324 CAGCGGAGGGCGGACCGGGCGGG + Exonic
1142424556 16:89994429-89994451 CAGGGGTGGCAGGAGCCGGCGGG - Intergenic
1142539545 17:647523-647545 CAGCGGATGGGGGAGGAGGAAGG - Intronic
1142581974 17:948843-948865 CCGCGGGGAGAGGAGGAGGCAGG - Intronic
1142581988 17:948880-948902 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142581996 17:948899-948921 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142582004 17:948918-948940 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142582012 17:948937-948959 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142582020 17:948956-948978 CCGCGGGGAGAGGAGGAGGCAGG - Intronic
1142582060 17:949050-949072 CCGCGGGGAGAGGAGGAGGCAGG - Intronic
1142582091 17:949126-949148 CAGCGGGGAGAGGAGGAGGCAGG - Intronic
1142582119 17:949202-949224 CAGCGGGGAGAGGAGGAGGCAGG - Intronic
1142582147 17:949278-949300 CAGCGGGGAGAGGAGGAGGCAGG - Intronic
1142582175 17:949354-949376 CAGCGGGGAGAGGAGGAGGCAGG - Intronic
1142582203 17:949430-949452 CAGCGGGGAGAGGAGGAGGCAGG - Intronic
1142582230 17:949506-949528 CCGCGGGGAGAGGAGGAGGCAGG - Intronic
1142582245 17:949544-949566 CAGCGGGGAGAGGAGGAGGCAGG - Intronic
1142582266 17:949601-949623 CCGCGGGGAGAGGAGGAGGCAGG - Intronic
1142582281 17:949639-949661 CAACGGGGAGAGGAGGAGGCAGG - Intronic
1142582302 17:949696-949718 CAGCAGGGAGAGGAGGAGGCAGG - Intronic
1142586873 17:979479-979501 CTGCGGGGGGACGCGGCGGCCGG - Exonic
1142610979 17:1109130-1109152 GGGAGGAGGGAGGAGGCGGGCGG + Intronic
1142894165 17:2963794-2963816 CAGGGGAGGGAGGGGGCCGGTGG - Intronic
1142941748 17:3385881-3385903 GAGGGGAGGGAGGAGGCAGCCGG - Intergenic
1143029792 17:3961541-3961563 CAGGGGAGGGAGGCAGCGGCTGG - Intronic
1143103174 17:4515035-4515057 CAGCCCAGGGAGGGGGCGGGAGG + Intronic
1143183394 17:4997559-4997581 GAGCCGCGGGAGGAGCCGGCGGG + Intronic
1143283873 17:5774682-5774704 CAGCAGTGGGAGGTGGAGGCTGG - Intronic
1143377366 17:6474605-6474627 CTGCGGAGGGAGGAGGACGCAGG + Intronic
1143483410 17:7239487-7239509 AGGAGGAGGGAGCAGGCGGCCGG - Exonic
1143483835 17:7242143-7242165 CAGCGCAGGGATCAGGCTGCTGG - Intronic
1143651068 17:8264625-8264647 GAGCGGAGGAAGGAGGCAGGGGG - Intronic
1143948590 17:10615701-10615723 CAGCCTAGGAAGGAGGAGGCAGG + Intergenic
1143951769 17:10638305-10638327 GAGCGGCTGGAGGAGGCGGGAGG - Exonic
1145063133 17:19744771-19744793 CAGAGGGCGGAAGAGGCGGCGGG + Intronic
1145255146 17:21318263-21318285 CAGCGCAGGCAGCAGGCAGCAGG + Intergenic
1145321460 17:21769692-21769714 CAGCGCAGGCAGCAGGCAGCAGG - Intergenic
1145900484 17:28487715-28487737 CTGCTGGGGGAGGAGGGGGCTGG + Intronic
1145936901 17:28719568-28719590 CAGCGGACGGCGTAGCCGGCTGG - Exonic
1146178124 17:30679636-30679658 CAGAGGAGGGAGGAGGATGGAGG + Intergenic
1146371626 17:32268127-32268149 CAGAGTAGGGAGGAGGCAGGAGG - Intronic
1147258832 17:39197204-39197226 CTGCGGAGCGGGGAGGGGGCGGG - Intronic
1147264361 17:39225836-39225858 CAGCGGACGGCGGAGCCGGCTGG - Exonic
1147911342 17:43858034-43858056 CAGCAGAGGGAGGAGGGGCCAGG - Intronic
1148027046 17:44595566-44595588 CAGCAGAGGGAGGTGGTGCCTGG + Intergenic
1148122659 17:45222004-45222026 CAGCGGCTGGCGGTGGCGGCGGG - Exonic
1148139138 17:45316414-45316436 GGGCGGAGGGAGGATGCTGCGGG + Intronic
1148211795 17:45813214-45813236 AAGGGCAGGGAGGAGGCAGCAGG - Intronic
1148272102 17:46269418-46269440 CAGCTGAGGGAGGCTGAGGCAGG + Intergenic
1148467390 17:47873050-47873072 CAGAGGAGGGAGCAGGAGCCAGG + Intergenic
1148551127 17:48551319-48551341 TGGGGGAGTGAGGAGGCGGCGGG - Intronic
1148698655 17:49575740-49575762 CAGCGCGGGGAGCGGGCGGCCGG + Intergenic
1148767833 17:50049525-50049547 CAGCGGAGGGCGGAGGGGGGGGG + Intergenic
1148846678 17:50533783-50533805 CAGAGGAGGGAGGAAGCTGAGGG - Intronic
1148862196 17:50610204-50610226 CACAGGAGGGAAGAGGTGGCAGG - Intronic
1149677251 17:58477047-58477069 CAGCGCTGGGAGGAGGTGGCTGG - Intronic
1150055269 17:62008681-62008703 CCTCGGGGGGAGGGGGCGGCGGG - Intronic
1150168408 17:62966388-62966410 GCGCGGAGGGCGGTGGCGGCGGG - Intergenic
1151345844 17:73500702-73500724 CAGAGGATGGAGGAGACGGAAGG - Intronic
1151350536 17:73529245-73529267 CAGCTGAGGGAGGACCAGGCTGG + Intronic
1151599576 17:75097988-75098010 CAGCTGAATGAGGAGGTGGCGGG - Intronic
1151996239 17:77611092-77611114 CGGTGGAGGGAGGATGGGGCAGG - Intergenic
1152078905 17:78174583-78174605 GAGAGGAGGGAGCATGCGGCAGG + Exonic
1152295769 17:79466192-79466214 TAGAGGAGGGAGGAGGCCGCTGG - Intronic
1152605630 17:81288284-81288306 CGGCAGAGTGAGGAGGTGGCGGG - Intronic
1152613946 17:81329472-81329494 CAGAGGAGGGAGGAGGGAGGAGG + Intronic
1152629235 17:81402561-81402583 CAGCAGAGGGAGGGGCGGGCTGG - Intronic
1152635225 17:81428150-81428172 CAGGGGTGGGAGGAAGGGGCAGG - Intronic
1152640763 17:81448289-81448311 CAGGGGAGGGGGCAGGAGGCTGG + Intronic
1152683855 17:81684141-81684163 CAGCGCCGGGCGGAGGCTGCGGG - Intronic
1152703959 17:81833350-81833372 TGGCGGAGGGCGGGGGCGGCCGG + Intergenic
1152781824 17:82230183-82230205 CAGCGTGGTGTGGAGGCGGCTGG + Intronic
1152970647 18:158425-158447 GAGAGGAGGGAGGAGGGGGAAGG - Intronic
1153512260 18:5868871-5868893 CAGGGGTGGGTGGAGGAGGCAGG - Intergenic
1154356597 18:13626489-13626511 CAGCGGATGGAGGGAGAGGCAGG + Intronic
1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG + Intronic
1155519614 18:26656141-26656163 CGGCGGAGGCCAGAGGCGGCCGG + Intronic
1156448482 18:37253690-37253712 CGGAGGCCGGAGGAGGCGGCGGG + Intronic
1156482379 18:37444401-37444423 CAACCGTGGGAGGAGGCAGCGGG + Intronic
1157665950 18:49487089-49487111 CCGAGGAGGGAGGAGGCAGGAGG + Intronic
1157830150 18:50850167-50850189 CAGCTGAGGGAGGCTGAGGCAGG + Intergenic
1158451434 18:57569564-57569586 CACCGGAGACAGGAGGTGGCGGG + Intronic
1159670148 18:71212523-71212545 CGGCGGGGGGCGGGGGCGGCGGG + Intergenic
1159910161 18:74138364-74138386 AGGCGGGGGGAGGAGGCAGCAGG - Intronic
1159954270 18:74508181-74508203 CAGAGGATGGAGGAGGCGTGGGG + Intronic
1160008930 18:75089094-75089116 CAGCGGCAGGAGGAGGCAGCTGG + Intergenic
1160340330 18:78084099-78084121 CCACGGAAGGTGGAGGCGGCTGG - Intergenic
1160448626 18:78946975-78946997 AAGAGGAGGGAGGAGGAGGAGGG + Intergenic
1160526186 18:79539526-79539548 CAGCTGCTGGAGGAGGGGGCAGG - Intergenic
1160769041 19:822121-822143 CGGCGGTGGGAGGCGGCGCCAGG - Intergenic
1160812351 19:1018268-1018290 CTGGGGAGAGAGGAGGCGGCAGG - Intronic
1160818048 19:1045234-1045256 CAGGCGAGGGAGGGGGCGGGGGG + Intronic
1160871700 19:1280755-1280777 GAGCGGGGGGCGGCGGCGGCTGG - Intergenic
1160882053 19:1325364-1325386 CCGCGGCGGGGGGCGGCGGCCGG + Intergenic
1161022103 19:2015459-2015481 GAGCGGGCGGAGGAGGCGGCGGG - Exonic
1161195589 19:2984377-2984399 CGGCGGAGGGAGGGGCCGGGAGG - Intronic
1161243272 19:3234825-3234847 CAGGTGAGGGATGAGGGGGCTGG - Intronic
1161269575 19:3382416-3382438 CATCTGAGGGAGGAGGCTGGTGG + Intronic
1161487991 19:4546142-4546164 GAGGGGAGGGAGGAGGCTGGAGG - Intronic
1161495060 19:4581868-4581890 GAGCGGAGGGCGGAGCCGGTGGG + Intergenic
1161756427 19:6137453-6137475 CAGCAGAGTGAGGAGGGGGAGGG + Intronic
1161768310 19:6218620-6218642 CAGCTGCAGGAGGAGGAGGCGGG - Intronic
1161800405 19:6414365-6414387 CCGCGGAGGGCGGAGGCGCTAGG + Intronic
1161925235 19:7294471-7294493 CAGGGGAGGGAGGTGCCGCCCGG + Intergenic
1161972441 19:7590304-7590326 CAGGTGTGGGAGGAGGCGGGAGG + Intergenic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162658988 19:12154977-12154999 AGGCGGAGGGAGGCGGAGGCAGG + Intronic
1162698459 19:12495686-12495708 CTGCGGCGGGAGGAGGCCGAGGG - Intronic
1162927794 19:13938747-13938769 TTGCGGGGGGAGGAGGGGGCGGG - Intronic
1163479157 19:17544463-17544485 CAGTGGAGGGAGGAGGTGGATGG + Intronic
1163581479 19:18141911-18141933 CAGCGAAGGTAGGAGTGGGCTGG - Exonic
1163630776 19:18417081-18417103 CGGGGGAGGGCGGAGGCGGAGGG - Intergenic
1163647119 19:18495750-18495772 CAGTGGAGGGATGGGGAGGCAGG + Intronic
1163651656 19:18521557-18521579 CGGCGGGGCGAGGAGGCGGTGGG - Intronic
1163696853 19:18768580-18768602 ACGCGGGTGGAGGAGGCGGCGGG - Exonic
1164570072 19:29367858-29367880 AAGCAGAAGGAGGAGGCGGGAGG - Intergenic
1164578111 19:29417876-29417898 CAGCGGCTGGAGGAGGCGAGGGG - Intergenic
1164684714 19:30159087-30159109 CAGAGGAGGGAGGGGGCGCATGG - Intergenic
1165336365 19:35172885-35172907 CAGCGCTGGGAGGAGACAGCTGG - Intergenic
1165613043 19:37173419-37173441 CAGAGGAGGGAGGAGAAGTCCGG + Intronic
1165702711 19:37950702-37950724 CAGCGGAGGGAGCAGCAGACGGG - Intronic
1165730618 19:38142539-38142561 CAGGGGAGGAAGGAGGCAGAGGG - Intronic
1165907469 19:39202855-39202877 CAGGGGAGGTGGGAGGGGGCAGG + Exonic
1165940761 19:39413687-39413709 CAGGGGAGGGCGGAGGCTGGGGG - Intronic
1166066166 19:40360316-40360338 GAGCCCAGGGAGGAGGCTGCTGG - Intronic
1166079334 19:40434000-40434022 CTGGGGAGGGAGGAGGCGCCAGG + Intergenic
1166107287 19:40603722-40603744 GAGGGGAGGGAGGAGGCAGGCGG - Intronic
1166131695 19:40749614-40749636 CAGCGGGTGGAGGAGGCAGTGGG + Exonic
1166213850 19:41323492-41323514 CAGGGGAGGGAGGAGACCCCAGG + Exonic
1166303092 19:41923003-41923025 CAGCCTAGGGAAGAGGCGGGAGG + Intronic
1166310395 19:41959162-41959184 GGGAGGAGGGAGGAGGGGGCCGG + Intronic
1166765657 19:45251284-45251306 CGGCGGAGGGAGGCGGTGGAGGG - Exonic
1167080834 19:47275181-47275203 CAGGAGAGGGAGGCAGCGGCGGG - Exonic
1167291937 19:48629355-48629377 CAGCGGAGGCAGCAGGTGGTCGG - Exonic
1167455284 19:49594564-49594586 GAGAGGAGAGAGGAGGCGGAGGG - Exonic
1167527607 19:49994706-49994728 CAGCGGAGGGGGGTGGGGGCCGG + Intronic
1167611925 19:50511840-50511862 CAGTGGTGGGAGGAGGGGACAGG + Intronic
1167648547 19:50718308-50718330 CGGGGCAGGGAGGAGGCAGCCGG - Intronic
1167668319 19:50835855-50835877 CAACAGAGGGAGGCGGCTGCAGG - Intronic
1167767145 19:51490927-51490949 GAGCTGAGGGAGGAGGCGCTTGG - Exonic
1168339316 19:55614478-55614500 CAGCGGCGGGAGGTGGGGGCCGG - Exonic
1168720067 19:58549989-58550011 CAGCTGATGCAGGGGGCGGCAGG - Exonic
925023303 2:588318-588340 CAGCAGAAGGTGGAGGGGGCGGG + Intergenic
925130091 2:1488519-1488541 CAGGTCAGGGAGGAGGCTGCCGG - Intronic
925189121 2:1868766-1868788 CACCGCAGGGAGGAGGGGGGAGG - Intronic
925926662 2:8676144-8676166 CAGCGGAGGCAGGAAGAGGCCGG + Intergenic
926156008 2:10454397-10454419 CAGCCGAGGGAGCAGGGGCCTGG + Intergenic
926270994 2:11365785-11365807 GGGCTGAGGGAGGAGGGGGCAGG - Intergenic
926282993 2:11465705-11465727 CGGCGCGGGGAGGAGGGGGCCGG + Intronic
927053695 2:19351808-19351830 CAGGGGCGGGAGGAGGAGGTGGG + Exonic
927904593 2:26847877-26847899 GAGCGGACGGAGGGCGCGGCCGG - Intronic
928115499 2:28542930-28542952 CAGTGGAAGGAGGGGGTGGCAGG - Intronic
928245450 2:29622716-29622738 CAGAGGAGGGGTGAGGGGGCTGG - Intronic
928551854 2:32380478-32380500 CAGCTGAGGGAGGCTGAGGCGGG + Intronic
929075702 2:38077149-38077171 CAGCCGAGGGTGGTGGCGGCCGG - Intronic
929429043 2:41871353-41871375 CACTGGAGGGAGGAGGGGGCTGG - Intergenic
929469996 2:42182300-42182322 CAGTGGAGGGGGGAGGGGGGAGG - Intronic
929537442 2:42792544-42792566 CAGCGCTGCGAGGAGGCGCCCGG - Exonic
929562510 2:42964603-42964625 CAGAGCTGGGTGGAGGCGGCTGG + Intergenic
929778787 2:44944326-44944348 CTGCGGAGGGAAGAAGCGCCCGG + Intronic
930136250 2:47906137-47906159 CAGCGGGGGGAGTGGGCGGGCGG + Intergenic
930730670 2:54724895-54724917 CAGCGGATGATGGTGGCGGCCGG + Exonic
931253489 2:60552385-60552407 GGGCCGGGGGAGGAGGCGGCCGG - Intronic
932086532 2:68767537-68767559 CAGCTGAGGAAGGAGCCGACTGG - Intronic
932419018 2:71590557-71590579 CAGGTCAGGGAGGAGGCTGCAGG - Intronic
932621832 2:73269341-73269363 CAGGGCAAGGAGCAGGCGGCCGG - Exonic
933422140 2:82062223-82062245 CAGGTGAGGGAGAAGGCGGAAGG - Intergenic
933772587 2:85753748-85753770 CCGCGGACAAAGGAGGCGGCCGG + Intronic
934657755 2:96124868-96124890 CAGCTGAGGGAAGAGGCTCCTGG - Intronic
934695857 2:96399772-96399794 CAGTGGAGGATGGAGGCAGCAGG - Intergenic
934731777 2:96663385-96663407 CAGTGGAGGGAGGAGGGGGCAGG + Intergenic
934935037 2:98459270-98459292 CAGGGTAGGGAGGAGTGGGCGGG - Intronic
934949160 2:98564542-98564564 CAGCAGAGGAAGGGGGCGGTGGG + Intronic
935590598 2:104843421-104843443 CAGCGGCTGGAGGAGGCCTCGGG + Intergenic
936060616 2:109293470-109293492 CAGTGGAGAGAGAAGGGGGCAGG - Intronic
936267663 2:111022754-111022776 CAGCAGAGGGAGGCGAGGGCAGG + Intronic
936327980 2:111522087-111522109 CAGAGCAGGGAGGAGCAGGCTGG + Intergenic
937208609 2:120252947-120252969 GTGCGGACGGCGGAGGCGGCGGG + Exonic
937249210 2:120512622-120512644 CAGCAGAGGGAGGAAGCTGAGGG - Intergenic
937863859 2:126733318-126733340 GAGGGCAGGGAGGAGGGGGCAGG + Intergenic
939629393 2:144515895-144515917 CGGCGCGGGGAGGGGGCGGCTGG - Intronic
940775122 2:157876466-157876488 GAGGGGAGAGAGGAGGCGGCGGG + Intergenic
941112088 2:161427111-161427133 CCTCGGCGGGAGTAGGCGGCGGG - Intronic
941773184 2:169364311-169364333 CTGGGGAGGGAGGGGGCGACCGG + Intergenic
943645820 2:190407789-190407811 CCCGGGAGGGAGGAGCCGGCGGG - Intergenic
944894570 2:204150963-204150985 CAGCAGAGGGAAGCTGCGGCAGG + Intergenic
945259640 2:207831729-207831751 CACTGGAAGGAGGAGGGGGCTGG - Intronic
945293212 2:208145771-208145793 CACCGGGGGGATGAGGCAGCAGG + Exonic
945844368 2:214926746-214926768 CAGTGGAGGGGGGCGGGGGCAGG + Intergenic
946187845 2:217991181-217991203 CAGAGGAGGGAGGAGGGCCCAGG + Intronic
946370311 2:219277766-219277788 CTGCGGAGGGTGGAGGGGACAGG - Intronic
946391308 2:219418416-219418438 GGGCGCACGGAGGAGGCGGCGGG - Exonic
946394084 2:219434742-219434764 CCGTGGAGGGAGGGGGCAGCAGG - Intergenic
948091913 2:235302132-235302154 AAGAGGAGGGAGGAGGGGGGAGG - Intergenic
948229268 2:236337618-236337640 CAGTGGAGCGAGGAGGAGCCTGG - Intronic
948487241 2:238288717-238288739 CAGCTGTGGGCGGCGGCGGCGGG - Intronic
948585427 2:239016021-239016043 CAGGGGACGGGGGAGGCTGCCGG - Intergenic
948585772 2:239018834-239018856 CAGCGTGGGAAGGAGGCAGCAGG - Intergenic
948588263 2:239034818-239034840 CAGAGGAGGCAGGAGGCTGGGGG - Intergenic
948588968 2:239037519-239037541 AGTCGGAGAGAGGAGGCGGCTGG - Intergenic
948645321 2:239400691-239400713 CCGCGGCGGGCGGCGGCGGCCGG + Exonic
948763606 2:240208290-240208312 CTGCGGAGGATGGAGGCTGCTGG + Intergenic
948781157 2:240322762-240322784 CAGCTGTGGAAGGAGGAGGCTGG + Intergenic
1168760676 20:347734-347756 CGGCGGAGGGAGGAGGCGAGGGG - Intronic
1168995487 20:2129811-2129833 CAGAGGAGGAGGGAGCCGGCTGG + Intronic
1169381741 20:5113260-5113282 CAGCGGAGGTAGCCGGCGGCAGG - Intergenic
1170823238 20:19771865-19771887 AAGAGGAGGCAGGAGGAGGCAGG - Intergenic
1171371059 20:24662120-24662142 CAGCGGTGGTACGAGGTGGCTGG + Intronic
1172093335 20:32448505-32448527 CAGTGGATGGAGGAAGGGGCTGG + Intronic
1172245554 20:33443244-33443266 CAGCCGAGGGCGCAGGGGGCTGG - Intronic
1172510657 20:35498632-35498654 CAGCGGAGAGAGCAGTCAGCAGG - Exonic
1172626504 20:36350424-36350446 CAGCGGAGTCAGGATGGGGCAGG - Intronic
1172778607 20:37422768-37422790 CAGAGGAGGAAGGAGGAGGGAGG - Intergenic
1173000001 20:39098827-39098849 GAGCAGAGGGAGGTGGAGGCAGG - Intergenic
1173249939 20:41358970-41358992 AAGGGGAAGGAGGAGGCTGCAGG + Exonic
1173564080 20:44026906-44026928 CAAGGTGGGGAGGAGGCGGCAGG - Intronic
1173617809 20:44414273-44414295 CAGAGGAGGGGGCAGGGGGCAGG + Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173941347 20:46913795-46913817 CAGTGGAGGGAGGAGCAGGTTGG + Intronic
1174406901 20:50308817-50308839 TGGCGGGGGGAGGAGGGGGCAGG - Intergenic
1174417098 20:50374732-50374754 GAGAGCAGGGAGGAGGCAGCAGG - Intergenic
1174494656 20:50931070-50931092 GGGCGGAGGGAGGAGACGGAGGG + Exonic
1175081557 20:56424878-56424900 TAGATGAGGGAGGAGGTGGCTGG + Intronic
1175470316 20:59222715-59222737 CCGCGGAGCGAGGAGGGAGCCGG - Intronic
1175601343 20:60276267-60276289 CAGGGTAGGGAGGAGGGAGCTGG - Intergenic
1175665720 20:60858061-60858083 CAGCCGAGGGAGGAGACAGGAGG - Intergenic
1175872547 20:62215278-62215300 TAGCGGAGGGAGGAGGGCGTGGG + Exonic
1175938222 20:62525024-62525046 CAGCCGGGGTAGGAGGCCGCAGG - Intergenic
1176090536 20:63316482-63316504 CAGGGGAGGGAGGAAGGGGCAGG - Intronic
1176120823 20:63453778-63453800 CAGCAGAGGGAGGAGCCGCTGGG + Intronic
1176121039 20:63454724-63454746 CAGGGGAGGGAGAGGGCGGCAGG + Intronic
1176131773 20:63499322-63499344 CAGGGCAGGGAGGCGGCGGGAGG + Intergenic
1176173710 20:63707992-63708014 AAGCGGAGCGCGGAGGCCGCTGG - Exonic
1176201725 20:63863945-63863967 CACCTGTGGGAGGAGGTGGCCGG + Intergenic
1176255049 20:64147300-64147322 CATCTGAGGGAGGCTGCGGCTGG - Intergenic
1176857030 21:13981518-13981540 CAGCGGGGGGGGGGGGGGGCAGG - Intergenic
1177157478 21:17513408-17513430 CGGCGGGGGGTGGAGGCGGAGGG + Intronic
1177716541 21:24846562-24846584 CAGCGGAGGGGGGAGCCGGAAGG + Intergenic
1178457855 21:32772203-32772225 CAGATGAGGGAGGAGGAGGAGGG + Intergenic
1178506948 21:33170207-33170229 CAGCAGAGGGAGGAGGAGGCAGG - Exonic
1178824553 21:36004811-36004833 CGGGGGGGGGAGGAGGCGGGGGG + Intergenic
1179179283 21:39031606-39031628 CAGTGGAGGTAGGAGGTGCCGGG - Intergenic
1179213727 21:39349105-39349127 ACGCGGGGGGAGGAGGAGGCGGG - Exonic
1179353852 21:40640291-40640313 CAGCGGAGGGAGAACAGGGCAGG + Intronic
1179727792 21:43350136-43350158 GAGAGGAGGGGGGAGGGGGCGGG - Intergenic
1179884820 21:44309372-44309394 CAGGGGTGAGAGGAGGGGGCGGG + Intronic
1179974676 21:44857704-44857726 CAGCAGAGGGGTGAGGCTGCGGG - Intronic
1179997072 21:44978872-44978894 CAGCGCGGTGGGGAGGCGGCAGG + Intergenic
1180728893 22:17966419-17966441 CAGAGGAGTGAGGAGGTGGAGGG - Intronic
1180999767 22:19982540-19982562 CAGGTGAGGGAGGAGGCCCCAGG - Intronic
1181116661 22:20635868-20635890 CAGTGGTGGGAAGAGGGGGCTGG + Intergenic
1181179374 22:21056041-21056063 CAGAAGAGGGAGGAGTCAGCAGG - Intronic
1181349447 22:22244729-22244751 CAGAGCAGGGAGGAGGATGCTGG + Exonic
1181431095 22:22882387-22882409 CAGTAGAGGGAGGAGGAGCCTGG - Intronic
1181465960 22:23110764-23110786 CAGCAGAGGGAGGAAGCAGCTGG + Intronic
1181513253 22:23398163-23398185 CAGAGGACGGAGGAGGCAACAGG + Intergenic
1181534223 22:23533421-23533443 CAGGTGAGGGAGGCAGCGGCAGG + Intergenic
1181902672 22:26169291-26169313 CGGCGGCCAGAGGAGGCGGCTGG + Intergenic
1182037973 22:27214247-27214269 GAGGGGACGGAGGAGGCAGCCGG - Intergenic
1182358678 22:29734340-29734362 CAGCGGAGGTTGGAGCCCGCAGG + Intronic
1182419142 22:30240344-30240366 CAGCGAAGGGTGGAGGAGGGTGG - Intergenic
1182848080 22:33447766-33447788 CAGCACAGGGAGGAGGAGGAAGG + Intronic
1183093619 22:35540067-35540089 CTCGGGAGGGAGGCGGCGGCTGG + Intergenic
1183264624 22:36817588-36817610 CGACGCAGGGAGGAGGTGGCAGG + Intronic
1183472427 22:38016728-38016750 CCGCGGGGGGAGGGGGCGGGAGG + Intronic
1183524803 22:38316891-38316913 CAGCGGGGGGAAGCGGAGGCAGG + Intronic
1183618533 22:38959468-38959490 GTGGGGAGGGAGGAGGAGGCAGG + Intronic
1183676514 22:39301805-39301827 CACCTGAGGAAGGGGGCGGCAGG - Intergenic
1184015499 22:41782939-41782961 CAGAGGAGGGAAGAGGCGGGTGG - Intronic
1184039158 22:41933191-41933213 GGGCTGAGGGAGGAGACGGCCGG - Intergenic
1184265117 22:43342610-43342632 CCGGGGAAGGAGGAGGAGGCCGG - Intronic
1184410995 22:44326395-44326417 CAGCAGAGGGAGGGGATGGCCGG - Intergenic
1184461687 22:44641318-44641340 CAGCGGAGGCAGCAGACAGCAGG + Intergenic
1184652596 22:45925962-45925984 CAGGGGAGGGAGGAGGGGGAGGG - Intronic
1184704624 22:46202145-46202167 CAGAGGAGGCAGGAGGGGGCTGG - Intronic
1185191376 22:49438623-49438645 CAGTGGAGGGAGGAGGGGGTTGG + Intronic
1185282997 22:49983643-49983665 CGGGGGCGGGAGGAGGGGGCGGG - Intergenic
1185296855 22:50058711-50058733 CGGCGGGGTGAGGAGGCCGCGGG + Intergenic
1185336163 22:50271734-50271756 CAGCTAAAGGAGGAGGAGGCCGG + Intergenic
1185400406 22:50612793-50612815 GAGCAGAGGGAGGAGGTGGGTGG - Intronic
949105412 3:196866-196888 CAGCGGCGGGAGGGGACGGGCGG + Exonic
949533377 3:4978437-4978459 CAGAGGAGGGAGGGAGCGCCGGG + Intergenic
950158535 3:10742214-10742236 CAGCGGGAGGAGGAGGAGGAAGG - Intergenic
950193275 3:10992579-10992601 CTGCGGAGGGAGCGCGCGGCGGG + Intergenic
950426683 3:12928149-12928171 CAGCAGAGGTGGGAGGGGGCCGG + Intronic
950458658 3:13107851-13107873 CTGGGGAGGGAGCAGGCCGCTGG - Intergenic
950469337 3:13174838-13174860 CAGTGGTGGGAGGAGGTGGGGGG - Intergenic
950503594 3:13379345-13379367 CAGCGGTGGGAGGTGATGGCAGG - Intronic
950546040 3:13638636-13638658 CAGAGGAGGGAGGAGGGAGGAGG - Intergenic
950649111 3:14396298-14396320 CAGGGCAGGCAGGAGGCAGCCGG + Intergenic
952217254 3:31289901-31289923 CAGCAGAGGCAGGAGTTGGCAGG - Intergenic
952761376 3:36917437-36917459 CAGCAGGGGAAGGAGGAGGCAGG + Intronic
952880216 3:37980711-37980733 CAGTGCATGGAGGAGGCAGCAGG - Intronic
952886004 3:38011264-38011286 CAGCAGCGGGAGGAGGCGGCAGG - Exonic
952889192 3:38029646-38029668 CCGCGGTGGGAGGAGGCCGGGGG + Intronic
953030642 3:39177720-39177742 GGGCGGAGGGGGGAGGGGGCGGG + Intergenic
953886703 3:46718080-46718102 CAGCGGAGTGAGGAGAGGGAGGG - Exonic
953908897 3:46882214-46882236 CGGGGGAGGGAAGAGGCGCCCGG + Intronic
953912187 3:46898827-46898849 CAGCGGCGGTGGCAGGCGGCGGG - Exonic
953975667 3:47380365-47380387 AAGCGGAGTGAGGAGGCCCCGGG - Intergenic
953999254 3:47543006-47543028 CAGCGAAGGGAGGAGGGAGCCGG + Intergenic
954539501 3:51384464-51384486 CCGGGGAGGCAGGAGGAGGCTGG + Intergenic
954812113 3:53255049-53255071 CTGGGGCGGGAGGAGGCGGAGGG - Intronic
955059280 3:55482313-55482335 CGGCGGAGCGAGTAGGTGGCGGG + Intronic
955077269 3:55625453-55625475 AAGAAGAGGGAGGAGGAGGCTGG + Intronic
955234964 3:57131135-57131157 CAGCTGAGGTAGGAGGGGGTGGG - Intronic
956527340 3:70179456-70179478 CAGCTGAGGGAGCAGGGCGCTGG - Intergenic
956779444 3:72592619-72592641 CAGGGGATGGAGGAGACAGCTGG + Intergenic
957637691 3:82807952-82807974 CAGGCGATGGAGGAGGTGGCAGG - Intergenic
960628321 3:119702966-119702988 AGGAGGAGGGAGGAGGCCGCGGG - Intergenic
960896696 3:122514201-122514223 AAGCGGGGGGTGGAGACGGCCGG - Intronic
961010678 3:123433746-123433768 GAGGGAAGGGAGGAGGCTGCTGG - Intronic
961021173 3:123508326-123508348 AAAGCGAGGGAGGAGGCGGCTGG + Intronic
961175021 3:124827991-124828013 CAGCGAAGGGAGCTGGCGGCGGG - Intronic
961432763 3:126894683-126894705 CAGCAGACGGAGCAGGAGGCTGG + Intronic
961453776 3:127014458-127014480 CAGCTGAGGGAGGCAGAGGCTGG - Exonic
961487497 3:127227240-127227262 GAGGGGGAGGAGGAGGCGGCTGG - Intergenic
961825065 3:129595030-129595052 AAGCTGAGGGAGGAGTTGGCGGG - Intronic
962108469 3:132417560-132417582 AGGCAGAGGGAGGAGGCGGAGGG + Exonic
963748754 3:149152473-149152495 CAGTGGAGGTAGGAGGGGGAAGG + Intronic
965207912 3:165745291-165745313 CAGCGGAGAGAGCAGGTGACAGG - Intergenic
966435126 3:179875497-179875519 CAGGTGAGGCAGGTGGCGGCAGG + Intronic
968048126 3:195635385-195635407 CAGGGGACGGGGGAGGCCGCTGG - Intergenic
968048198 3:195635539-195635561 CAGCGGACGGGGGAGACCGCGGG - Intergenic
968075884 3:195815992-195816014 CTGCGTAGGGAGAAGGAGGCCGG - Intergenic
968099206 3:195954081-195954103 CAGCGGACGGGGGAGACCGCGGG + Intergenic
968099276 3:195954235-195954257 CAGGGGACGGGGGAGGCCGCTGG + Intergenic
968306413 3:197654382-197654404 CAGCGGACGGGGGAGACCGCGGG + Intergenic
968306485 3:197654536-197654558 CAGGGGACGGGGGAGGCCGCTGG + Intergenic
968460821 4:723919-723941 CAGCAGAGGGAGGAGGCGTGTGG + Intronic
968472823 4:789856-789878 CAGAGGAGGCTGGAGGCAGCAGG + Intronic
968490291 4:886484-886506 CAGCAGAGGGAGGAGGCATGTGG - Intronic
968517946 4:1022703-1022725 CAGCGGAGGGCGGAGGGTGGAGG + Intronic
968582424 4:1401311-1401333 CAGCGGAGGGAGGAGGGAGGAGG + Intergenic
968584703 4:1410757-1410779 CAGGGGAGGAAGAGGGCGGCAGG + Intergenic
968596611 4:1489338-1489360 CTGGGGAGGTGGGAGGCGGCAGG - Intergenic
968648207 4:1750172-1750194 CTGCAGAGAGAGGAGGGGGCGGG + Intergenic
968808520 4:2789801-2789823 CAGGAGAGGGAGGATGAGGCAGG + Intergenic
968882073 4:3306251-3306273 AAGCGGAAGGAGGAGCTGGCTGG + Intronic
969066065 4:4482275-4482297 CACAGGAGGGAGGCAGCGGCTGG - Intronic
969391514 4:6894584-6894606 TAGGGGAGGGAGGAGGAGACAGG + Intergenic
969652016 4:8473645-8473667 GTAAGGAGGGAGGAGGCGGCAGG + Intronic
970411173 4:15809245-15809267 CAGCTGAGGGAGGTGGTGGAGGG + Intronic
970824327 4:20253788-20253810 CCGGCGAGGAAGGAGGCGGCGGG + Exonic
972351998 4:38244559-38244581 CAAGGGAAGGAGGAGGGGGCCGG - Intergenic
972414368 4:38824076-38824098 CAGGGGGGGGCGGGGGCGGCGGG - Exonic
973532148 4:51844301-51844323 GTGCGGAGAGAGGAGGGGGCGGG + Intronic
975118420 4:70704680-70704702 GAGGGGCTGGAGGAGGCGGCCGG + Intronic
975387123 4:73770491-73770513 CAGCAGAGGGAAGAAGCAGCTGG + Intergenic
975947398 4:79724139-79724161 CAGCAGAGGGGAGAAGCGGCTGG - Intergenic
977257706 4:94758456-94758478 GAGCGGAGGGATGGGGCGGGAGG + Intronic
977693755 4:99946185-99946207 CAGCGGAACGCGGAGCCGGCGGG + Intronic
979468996 4:121072615-121072637 CAGAGGAGGGAGGGGGCGGGCGG - Intronic
981288525 4:143047161-143047183 CAGGGAAGGGTGGAGGTGGCTGG + Intergenic
981633962 4:146854024-146854046 CAGGGGAGGGATGAGGGAGCTGG - Intronic
983577145 4:169271434-169271456 CGGGGGGAGGAGGAGGCGGCGGG - Intergenic
985279028 4:188269032-188269054 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279044 4:188269082-188269104 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279060 4:188269132-188269154 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279076 4:188269182-188269204 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279092 4:188269232-188269254 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279108 4:188269282-188269304 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279124 4:188269332-188269354 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279140 4:188269382-188269404 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279156 4:188269432-188269454 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279172 4:188269482-188269504 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279188 4:188269532-188269554 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279204 4:188269582-188269604 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279220 4:188269632-188269654 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279236 4:188269682-188269704 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279252 4:188269732-188269754 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985279268 4:188269782-188269804 GGGAGGAGGGAGGAGGCGGGTGG - Intergenic
985472254 5:53541-53563 CGGCGGCGGGAGGAGGGGGCGGG + Intergenic
985504690 5:272032-272054 CAGCGGACGGGGGAGACCGCGGG - Intronic
985548791 5:523047-523069 CGGAGAAGGGAGGAGGCGGGAGG + Intronic
985620438 5:952210-952232 CAGGGGAGGGAGGTGGGGGGTGG - Intergenic
985688570 5:1294772-1294794 TGGCGGAAGGAGGGGGCGGCGGG + Exonic
985743423 5:1633563-1633585 CAGCGGACGGGGGAGACCGCGGG + Intergenic
985743465 5:1633656-1633678 CAGGGGACGGGGGAGGCCGCTGG + Intergenic
985883331 5:2657229-2657251 GAGCGGAGGCAGGAGCCGGTGGG + Intergenic
985887263 5:2689147-2689169 CAGCACAGGAAGGAGGTGGCTGG + Intergenic
985903307 5:2813818-2813840 CAGGGGAGGTAGGAGCAGGCTGG + Intergenic
986183932 5:5418915-5418937 GATCGGAGGAAGAAGGCGGCAGG - Intergenic
986733123 5:10649627-10649649 GAGCGTGGGGAAGAGGCGGCTGG + Exonic
986856640 5:11876197-11876219 GAGAGGAGGGAGGAGGCAGGAGG + Intronic
987312026 5:16690447-16690469 CTGCCCAGGGAGGAGGCTGCTGG + Intronic
992097968 5:73380464-73380486 CAGCGGAGTGAAGAGCTGGCAGG - Intergenic
992550148 5:77852015-77852037 CGGCGGCGCGAGGAGGCTGCGGG - Intronic
992831643 5:80598990-80599012 AAGCAGAGAGAGGAGACGGCAGG - Intergenic
992950365 5:81852004-81852026 CCGCGGCGGGAGGCGGCCGCAGG - Intergenic
993168366 5:84384622-84384644 CAGCGGAGGGCTGAGCCCGCCGG - Exonic
995402343 5:111757281-111757303 AAGAGGAGGGAGGAGGGGGAAGG + Intronic
996630797 5:125629809-125629831 CAGCCCAGGGAAGAGGAGGCTGG + Intergenic
997284302 5:132667527-132667549 CAGGGGAGAGGGCAGGCGGCGGG - Intergenic
997606576 5:135179313-135179335 CAGAGGAGCCAGGAGGGGGCTGG + Intronic
997639203 5:135437580-135437602 CAGGGGAGGGAAGAGGGGGGAGG - Intergenic
997801239 5:136864762-136864784 CAGTGGAGGGAGGAGGCTGATGG + Intergenic
998028014 5:138837501-138837523 GAGGGGAGGGAGGAGGGGGAGGG - Intronic
998192758 5:140041850-140041872 CAGGAGAGGAAGGAGGGGGCGGG + Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
999182669 5:149681103-149681125 CAGGGGAGGGAGGAGGGAGGAGG - Intergenic
999310291 5:150547387-150547409 CAGGGGAGGGGGTTGGCGGCTGG + Intronic
999316699 5:150588671-150588693 CAGGGGAGAGAAGAGGAGGCTGG + Intergenic
1000041247 5:157486676-157486698 CAGCAGAGGGAGGAGGGAGTGGG - Intronic
1000550634 5:162658459-162658481 CAGTGGAGGGAGCAGGTGGGAGG + Intergenic
1001064996 5:168529377-168529399 CAGCGGAGGCGGGCGGCGGGCGG - Exonic
1001141351 5:169146584-169146606 CAGTGGAGGCAGGAGGAGCCGGG - Intronic
1001315096 5:170636345-170636367 CAGTGGAGGCAGGAGGCAGAAGG + Intronic
1001928869 5:175658620-175658642 CAGCGGAGAGCGGGGGCTGCTGG + Intronic
1001949755 5:175808034-175808056 GAGCTGGGGGAGGAGGCGACAGG + Intronic
1002067326 5:176658400-176658422 GAGCCCAGGGAGGGGGCGGCAGG - Exonic
1002147656 5:177197930-177197952 CAGAGAAGGGAGGATGCTGCAGG + Intronic
1002168650 5:177363092-177363114 CAGCCGGGGGAGGAGGAGCCCGG + Intronic
1002897770 6:1389472-1389494 GCGCGGAGCGAGGAGGGGGCAGG + Intergenic
1003163026 6:3652090-3652112 CAGGGGAGGGAGAATGCTGCTGG - Intergenic
1004396346 6:15248834-15248856 CGGCGGGGGGAGGAGGGAGCTGG + Intronic
1005083485 6:21980766-21980788 CAGAGCAGGAAGGAGGAGGCTGG - Intergenic
1005083491 6:21980792-21980814 CAGAGCAGGGAGGAGGAGGTGGG - Intergenic
1005083585 6:21981319-21981341 CAGCTCAGGAAGGAGGAGGCAGG - Intergenic
1005083640 6:21981642-21981664 CAGCACAGGAAGGAGGAGGCAGG - Intergenic
1005083659 6:21981720-21981742 CAGAGTAGGAAGGAGGCGGCAGG - Intergenic
1005083678 6:21981824-21981846 CAGTGCAGGAAGGAGGAGGCAGG - Intergenic
1005303736 6:24494899-24494921 AAGAGGAGCGAGGAGGCGCCGGG - Intronic
1005816087 6:29553908-29553930 CAGCGGAGGCCGGAGGAGGGCGG + Intergenic
1006180714 6:32151945-32151967 CAGCGGCGGGGGGGGGGGGCGGG + Exonic
1006333979 6:33411006-33411028 CGGCAGGAGGAGGAGGCGGCGGG - Exonic
1006368921 6:33632684-33632706 CAGCAGAGGGAGCAGGAGGATGG - Intronic
1006578651 6:35064018-35064040 CTGGTGAGGGAGGAGGCTGCTGG + Intronic
1006682198 6:35805326-35805348 CCGCGGACGGAGGAGGGGGCGGG + Exonic
1006693134 6:35907840-35907862 CAGCAGAGGGATGAGGTGGGAGG + Intronic
1007399172 6:41594002-41594024 CAGCTGAGAGAGGAGGGTGCAGG + Intronic
1007752180 6:44077163-44077185 CAGGGAAGGGAGGAGGCGGTCGG + Intergenic
1008013137 6:46490501-46490523 CGGCCGAGGGATCAGGCGGCTGG + Intronic
1008292612 6:49736329-49736351 CTGTGGAAGGAGTAGGCGGCTGG - Intronic
1008360604 6:50613251-50613273 CAGTGGGGAGAGGAGGTGGCAGG - Intergenic
1009952466 6:70413377-70413399 GAGGGGAGGGAAGAGGCGGGAGG + Exonic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010732338 6:79404446-79404468 CAGCAGAGGGAAGAAGTGGCTGG + Intergenic
1011470376 6:87701990-87702012 GAGCGGACGGCGGGGGCGGCCGG - Exonic
1011811237 6:91134509-91134531 AAGAGGAGGGAGGAGCCTGCAGG - Intergenic
1012306833 6:97669188-97669210 TGGGGGAGGGAGGAGGCGGGCGG - Intergenic
1013226839 6:108125290-108125312 CAGCAGAGGCAGAAGGCAGCAGG - Intronic
1013619457 6:111873468-111873490 GAGGGGAGCGAGGAGGGGGCGGG + Intergenic
1013926037 6:115473689-115473711 CAGGGGTGGGAGGAGGAGGAAGG + Intergenic
1014246859 6:119078663-119078685 CTGCGGAGGGAGGAGGAGACGGG + Exonic
1017067969 6:150547723-150547745 AAAGGGAGGGAGGAGGGGGCTGG + Intergenic
1017515798 6:155154736-155154758 CTGGGGAGGGAGGAGGTGGTTGG + Intronic
1017702893 6:157093067-157093089 CAGCGAAGGGAGAAGGCAGCGGG - Intronic
1018347820 6:162921219-162921241 GTGGGGAGGGAAGAGGCGGCCGG + Intronic
1018842130 6:167524986-167525008 CAGGGGAAGGAGGGGGCAGCAGG - Intergenic
1018900743 6:168050579-168050601 CAGCGGTCGGAGGAGGCAGGAGG + Intergenic
1019192287 6:170259342-170259364 CAGGGCAGGGAGGAGGTGCCAGG - Intergenic
1019270999 7:149205-149227 CGGCGCAATGAGGAGGCGGCCGG - Intergenic
1019318982 7:406343-406365 CAGAGGAGGGAAGAGCCAGCCGG + Intergenic
1019339997 7:504460-504482 CTGCTGAGGCAGGAGGGGGCTGG - Intronic
1019459329 7:1148081-1148103 CAGCGGGGAGAGGCGGCGCCTGG - Intergenic
1019508355 7:1404804-1404826 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019508370 7:1404838-1404860 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019508385 7:1404872-1404894 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019508400 7:1404906-1404928 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1020112052 7:5452690-5452712 GAGCGGGGAGAGGAGGCGGGAGG - Intronic
1022230799 7:28410260-28410282 CAGCGGAGGCAGGAGGCGGCCGG - Intronic
1022443691 7:30453039-30453061 CACTGGAGGGAGGGGGTGGCAGG + Exonic
1022633761 7:32111467-32111489 CAGGGGTGGGATGAGGTGGCAGG + Intronic
1023529346 7:41136716-41136738 CAGAGGGGGGCCGAGGCGGCGGG + Intergenic
1023792389 7:43763208-43763230 CAGAGCTGGGAGGAGGGGGCTGG + Intronic
1024019547 7:45353358-45353380 CAGGGGAGGGAAGAGGAGGAAGG + Intergenic
1025069799 7:55887893-55887915 CGGCGGCGGCGGGAGGCGGCAGG + Intronic
1025198743 7:56949553-56949575 AAGGGGAGGGAGGAGGAGGGGGG - Intergenic
1027051836 7:75025596-75025618 CAGAGGAGGGAGGAGGACGGCGG - Intergenic
1027121080 7:75520869-75520891 CAGCTGAGGGAGGCTGAGGCAGG + Intergenic
1029184740 7:98730463-98730485 CAGCAGAGGAATGAGGCAGCAGG + Intergenic
1029306908 7:99626273-99626295 CAGAGGAGTAAGGAGGAGGCAGG + Intronic
1029412850 7:100426865-100426887 CAGGGAAGGGAGGAGGGGGAGGG - Intronic
1029412873 7:100426927-100426949 AAGGGGAGGGAGGAGGGGGAGGG - Intronic
1029524271 7:101085609-101085631 GAGCGGAGGGAGTAGGGGGAGGG + Intronic
1029545215 7:101206911-101206933 GAGAGGAGGGAAGAGGCTGCAGG + Intronic
1030172393 7:106616486-106616508 AAGAGGAGGGAGGAGGAGGAGGG + Intergenic
1030176356 7:106659939-106659961 CTGCGGAGGGAGGGGACAGCTGG - Exonic
1031870086 7:127081619-127081641 AAGGGGAGGGAGGAGGCAGAGGG + Intronic
1031923508 7:127618174-127618196 CAGAGGAGAGAGGAGGAGGGAGG + Intergenic
1032306222 7:130734155-130734177 CGGCGGCGGCAGCAGGCGGCAGG - Intergenic
1032868802 7:135957808-135957830 CAAGGGAGGGAGGAGGTGCCAGG - Intronic
1033155262 7:138951225-138951247 CTCCAGAGGGAGGATGCGGCTGG - Intronic
1033325117 7:140371285-140371307 CAGCTGAGGGAGGCTGAGGCAGG - Intronic
1033454645 7:141491862-141491884 CAGGGGAGAGATGAGGAGGCAGG - Intergenic
1034073903 7:148213738-148213760 CAGGGGAGGGAGGAGGAGTCAGG - Intronic
1034257258 7:149731436-149731458 CTCCGGCAGGAGGAGGCGGCTGG - Intronic
1035004446 7:155644762-155644784 CAGAGAAGGGAGGGGGCTGCAGG - Exonic
1035174643 7:157041692-157041714 AAGCGGAGGGAGGTGACTGCAGG + Intergenic
1035281209 7:157779547-157779569 CGACGGAGGGTGGGGGCGGCAGG + Intronic
1035593476 8:836216-836238 CACTGGAAGCAGGAGGCGGCCGG - Intergenic
1035725559 8:1823467-1823489 CACCTGAGGGAGGGGGCGTCGGG - Intergenic
1036163066 8:6406823-6406845 CGGGGGAGGAAGGAGGCGGCAGG - Intronic
1036165217 8:6426345-6426367 CTGGGGTGGGAGGAGGGGGCAGG - Intronic
1036203661 8:6789909-6789931 AGGCGGAGGGTGGTGGCGGCGGG + Intergenic
1036621229 8:10425433-10425455 CTGCGAAGGGAGGAGGAGGAGGG + Intronic
1036645410 8:10609140-10609162 CAGCTGGGCGAGGAGGCGGAGGG - Exonic
1036646879 8:10616585-10616607 CACCTGAGGGAGGAGCGGGCGGG + Exonic
1036752298 8:11451042-11451064 CAGAAGAGGGAGGAAGCTGCTGG - Intronic
1037577344 8:20220053-20220075 GAGAAGAGGGAAGAGGCGGCTGG - Intronic
1037681549 8:21101861-21101883 CAGGGGAGGGAGTGGGAGGCAGG - Intergenic
1037769141 8:21788930-21788952 CCGCGAAGGGAGAAGGGGGCGGG - Intronic
1037769212 8:21789162-21789184 GAGCCGAGGGAGCCGGCGGCTGG - Intronic
1037769241 8:21789283-21789305 CTGCGGGGGGAGGAGGAGGAGGG - Intronic
1037804867 8:22053592-22053614 TGGGGGAGGGAGGAGGCAGCAGG + Intronic
1037807376 8:22066331-22066353 GAGCGCGGGGAGGTGGCGGCGGG + Intronic
1038151074 8:24942570-24942592 CGGGGGAGGGAGGAGGCGCCGGG - Intergenic
1038205309 8:25459212-25459234 CGGCGGGCGGAGGAGGCGGGTGG + Exonic
1038748918 8:30278341-30278363 CAGCTGAGGGAGGCTGAGGCAGG + Intergenic
1039064884 8:33599419-33599441 AGGCGGAGGGAGGGAGCGGCGGG - Intronic
1039547667 8:38421453-38421475 CAGCGGAGGGGGGAGGCTGCTGG + Intronic
1039561072 8:38513077-38513099 CAGCGCAGGGTGGAGGCTGAGGG - Intronic
1041279818 8:56198390-56198412 CAGGGGAGGAAGGAGGTGACGGG + Intronic
1043988605 8:86724034-86724056 GACCGGAGGGAGGAGGCTGAGGG + Intronic
1045335158 8:101195180-101195202 CAGCTGAGGGAGGAGTAGGAAGG - Intronic
1045673946 8:104588550-104588572 CGGCGGAGCGAGGGGGTGGCGGG - Intronic
1046103897 8:109644670-109644692 CGGCGGCGCGAGGAGCCGGCGGG - Exonic
1047347186 8:124039741-124039763 CAGAGGAGGGTGGATGTGGCTGG + Intronic
1047499381 8:125430148-125430170 GAGCGGAGGGAGGAGACTGGGGG - Intergenic
1048480406 8:134785491-134785513 TGGCGGAGGGGGGAGGGGGCGGG - Intergenic
1048866223 8:138763727-138763749 CAGCGGAGGGAATAGGAGGCAGG - Intronic
1049109800 8:140635655-140635677 CGGCGGGCGGAGGCGGCGGCGGG + Intergenic
1049164362 8:141117210-141117232 GGGCAGAGGGAGGAGGCAGCAGG - Intergenic
1049236135 8:141513311-141513333 CAGCGGAGGGAGCTGGAGCCTGG + Intergenic
1049239242 8:141528586-141528608 CAGAGGAGGGAGGAGGGAGCAGG + Intergenic
1049243510 8:141550367-141550389 CAGCAGAGGGAGCAGGGGCCAGG + Intergenic
1049361296 8:142213627-142213649 GAGCAGAGGAAGGAGGCAGCTGG + Intronic
1049392705 8:142380356-142380378 CAGAGCAGGGAGGACGCAGCTGG + Intronic
1049536559 8:143185360-143185382 CAGCAGACGCAGGAGGCGGGAGG - Intergenic
1049540807 8:143207987-143208009 GAGGGGAGGGAGGAGGCCACGGG - Intergenic
1049570699 8:143369064-143369086 CGGCGGCGGGAGGAGGGGCCCGG + Intronic
1049602902 8:143516109-143516131 CAACCGAGGCAGGGGGCGGCTGG + Intronic
1049606557 8:143532318-143532340 CGGGGGAGGGAGGCGGCAGCAGG + Intronic
1049614087 8:143568789-143568811 GCGCGGAGCGAGGAAGCGGCGGG + Intronic
1049620474 8:143596151-143596173 CAGAGGAGGCGGGAGGCAGCGGG + Intronic
1049657442 8:143805018-143805040 CAGGGGAGGGTGGAGGAGGCAGG + Intronic
1049778022 8:144415379-144415401 CAGCTGCTGGAGGAGGCGGTGGG - Exonic
1050552254 9:6758393-6758415 CAGGGGAGGGATGCGGGGGCCGG + Intronic
1050758353 9:9035562-9035584 CAGAGGAGAGAGGAAGCGGGTGG - Intronic
1052903858 9:33817399-33817421 AAGCGGAGGAAGGCGGCGGAGGG - Intergenic
1053042343 9:34885367-34885389 CATCAGAAGGAGGAGGTGGCAGG - Intergenic
1053158975 9:35800481-35800503 CAGGTGATGGAGGAGGAGGCAGG + Exonic
1053198322 9:36136615-36136637 CAGCTGAGGGCGGAGGCGCCCGG - Intronic
1053361896 9:37493979-37494001 CAGAGGAGGGAGAAGGCCTCAGG + Intronic
1053503199 9:38620039-38620061 CCGCGGTGGGAGGGGGCCGCAGG - Intergenic
1054157703 9:61652014-61652036 AAAGGGAGTGAGGAGGCGGCTGG - Intergenic
1054175699 9:61874092-61874114 AAAGGGAGTGAGGAGGCGGCTGG + Intergenic
1054477477 9:65583019-65583041 AAAGGGAGTGAGGAGGCGGCTGG - Intergenic
1054661840 9:67706718-67706740 AAAGGGAGTGAGGAGGCGGCTGG - Intergenic
1054906904 9:70420247-70420269 GAGAGGAGGAGGGAGGCGGCGGG - Intergenic
1054999065 9:71427751-71427773 TAGTAGAGGGAGGAGGAGGCAGG + Intronic
1055131378 9:72778910-72778932 AAGCAGAGGGGGGAGGCTGCAGG - Intronic
1056126279 9:83538573-83538595 CAGCTGAAGGAGGAGGCGGAGGG + Intergenic
1057259863 9:93577255-93577277 CTTCGCAGGGGGGAGGCGGCGGG - Intronic
1058706165 9:107639578-107639600 CAGGGGAGGGAGGAGGGTTCAGG - Intergenic
1059439634 9:114299742-114299764 GAGCTGTGGGAGGAGGCTGCAGG + Intronic
1060188467 9:121577849-121577871 CAGCAGAGGGAGCAGGCACCAGG + Intronic
1060198711 9:121639580-121639602 CTGCGGAGGGAGGTGGAAGCTGG + Intronic
1060247275 9:121957381-121957403 CAGAGGAGGAAAGAGGGGGCGGG - Intronic
1060407195 9:123378633-123378655 GAGCGTGGGGAGGAGGCGGCTGG + Exonic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061128116 9:128689452-128689474 GAGCGCCGGGAGGAGGCGGCCGG + Intronic
1061185820 9:129052597-129052619 CAGCGGAGGTAGAAGGAGGAGGG + Intronic
1061281692 9:129601367-129601389 GAGAGGAGGGAGGAGGCAGAGGG + Intergenic
1061283506 9:129610181-129610203 CAGGGGAGGGGGGAGGAGGGGGG + Intronic
1061396337 9:130345864-130345886 CAGGGTAGGGCGGAGGGGGCAGG + Intronic
1061498256 9:130987931-130987953 GAGCGGAGGCAGGAAGCGGAGGG + Intergenic
1061730368 9:132609371-132609393 CAGCTGGGGCAGGAGGCGGCAGG + Intronic
1061806250 9:133139290-133139312 CTGCGGAGAGGGGAGGAGGCAGG + Intronic
1061909298 9:133714344-133714366 CAGGGGAGGGTGGAGGAGGCAGG + Intronic
1061920895 9:133781770-133781792 CAGCAGAGGGATGAGGAGGGGGG + Intronic
1061940278 9:133880244-133880266 CACCGGAGGAAAGAGCCGGCAGG + Intronic
1062022279 9:134325357-134325379 GTGCGGAGGGAGGGCGCGGCGGG + Intronic
1062051075 9:134447420-134447442 CAGAGGGAGGAGGATGCGGCTGG + Intergenic
1062080848 9:134622617-134622639 AAGAGGAGGGAGGAGGGGGGAGG - Intergenic
1062080879 9:134622716-134622738 AAGAGGAGGGAGGAGGGGGGAGG - Intergenic
1062080910 9:134622817-134622839 AAGAGGAGGGAGGAGGGGGGAGG - Intergenic
1062110314 9:134778663-134778685 CAGCACAGGGCGGAGGCAGCCGG - Intronic
1062117672 9:134818049-134818071 CACCTGAGGGAGGAGGCGGGTGG + Intronic
1062202105 9:135308991-135309013 CGGAGGAGGAAGGAAGCGGCAGG - Intergenic
1062214545 9:135382191-135382213 CAGCGGATGGAGGAGGAGAGGGG - Intergenic
1062460566 9:136660991-136661013 CAGGTGGGGGAGGAGGGGGCAGG + Intronic
1062467561 9:136687799-136687821 CAGCGGGGGGAGGGGGCACCGGG - Intergenic
1062469617 9:136696842-136696864 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469627 9:136696860-136696882 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469659 9:136696922-136696944 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469682 9:136696967-136696989 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469692 9:136696985-136697007 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062480592 9:136749111-136749133 GAGGGGAGGCAGGAGGCAGCAGG - Intergenic
1062722289 9:138050744-138050766 CAGCTGAGGGAAGAGGGGACAGG - Intronic
1185550471 X:979915-979937 AAGAAGAGGGAAGAGGCGGCCGG + Intergenic
1185581336 X:1213178-1213200 GAGGGGAGGGAGGAGGGGGTGGG - Intergenic
1185581507 X:1213604-1213626 GAGGGGAGGGAGGAGGGGGTGGG - Intergenic
1186452540 X:9685462-9685484 AAGCAGAGGGAGGAAGCTGCAGG - Intronic
1186705898 X:12138830-12138852 CAGCGGGTGGCGGCGGCGGCCGG - Exonic
1189322142 X:40093403-40093425 AAGAGGAGGGAGGAGGAGACTGG + Intronic
1189446192 X:41084532-41084554 CAGCGGAAGGAGGGGGCGTGGGG - Intergenic
1190385515 X:49879573-49879595 GAGGGGAAGGCGGAGGCGGCGGG + Intergenic
1190737069 X:53262600-53262622 CAGGGGAGAGAGGAGGCAGGGGG + Intronic
1190988656 X:55522926-55522948 CAGCCAAGGGAGGAGGGTGCAGG + Intergenic
1192125608 X:68498589-68498611 CGGCGGAGGGAGCAGGAGGTTGG + Exonic
1192800666 X:74462055-74462077 CACTGGAGGGAAGAGGAGGCAGG - Intronic
1195275327 X:103275796-103275818 GTGGGGAGGGAGGAGGTGGCAGG - Intronic
1195923093 X:110002356-110002378 CAGGCCAGGGAGGAGGCGGAAGG + Intergenic
1195923107 X:110002394-110002416 CGGAGGAGGGAGGAGGAGGGAGG + Intergenic
1195923271 X:110002924-110002946 CAGCGGAGGGAGGAAGCCAGAGG - Intronic
1197761099 X:130028910-130028932 CAGAGGAGGCAGGAGGGGGGTGG + Intronic
1197892340 X:131279559-131279581 CTGCGGAGTGGGGAGGGGGCGGG - Intronic
1198100440 X:133417353-133417375 CTGGGGAGGGCGGGGGCGGCGGG - Intergenic
1198111154 X:133503638-133503660 CAGTGGAGAGAGGAGGCATCAGG - Intergenic
1199846448 X:151695393-151695415 GAAGGGAGGGAGGAGACGGCTGG + Intronic
1200292796 X:154887777-154887799 CAGCGGAGGAAGGAGACGAAAGG - Exonic
1200339641 X:155383517-155383539 CAGCGGAGGAAGGAGACGAAAGG - Intergenic
1200346829 X:155457176-155457198 CAGCGGAGGAAGGAGACGAAAGG + Exonic