ID: 1119615957

View in Genome Browser
Species Human (GRCh38)
Location 14:76099366-76099388
Sequence CACTCAACACAGGTAGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119615950_1119615957 21 Left 1119615950 14:76099322-76099344 CCCGACTCCGCTCCGGCCTCACT No data
Right 1119615957 14:76099366-76099388 CACTCAACACAGGTAGAACAAGG No data
1119615953_1119615957 9 Left 1119615953 14:76099334-76099356 CCGGCCTCACTCTGCTCAACACC No data
Right 1119615957 14:76099366-76099388 CACTCAACACAGGTAGAACAAGG No data
1119615949_1119615957 22 Left 1119615949 14:76099321-76099343 CCCCGACTCCGCTCCGGCCTCAC No data
Right 1119615957 14:76099366-76099388 CACTCAACACAGGTAGAACAAGG No data
1119615954_1119615957 5 Left 1119615954 14:76099338-76099360 CCTCACTCTGCTCAACACCAATA No data
Right 1119615957 14:76099366-76099388 CACTCAACACAGGTAGAACAAGG No data
1119615948_1119615957 27 Left 1119615948 14:76099316-76099338 CCTATCCCCGACTCCGCTCCGGC No data
Right 1119615957 14:76099366-76099388 CACTCAACACAGGTAGAACAAGG No data
1119615952_1119615957 14 Left 1119615952 14:76099329-76099351 CCGCTCCGGCCTCACTCTGCTCA No data
Right 1119615957 14:76099366-76099388 CACTCAACACAGGTAGAACAAGG No data
1119615951_1119615957 20 Left 1119615951 14:76099323-76099345 CCGACTCCGCTCCGGCCTCACTC No data
Right 1119615957 14:76099366-76099388 CACTCAACACAGGTAGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119615957 Original CRISPR CACTCAACACAGGTAGAACA AGG Intergenic
No off target data available for this crispr