ID: 1119617459

View in Genome Browser
Species Human (GRCh38)
Location 14:76108109-76108131
Sequence GGAAGTGTTAAGTAGAGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119617459_1119617470 24 Left 1119617459 14:76108109-76108131 CCGGGACTCTACTTAACACTTCC No data
Right 1119617470 14:76108156-76108178 GGGCAGGGAGACAGGTTTGAGGG No data
1119617459_1119617471 28 Left 1119617459 14:76108109-76108131 CCGGGACTCTACTTAACACTTCC No data
Right 1119617471 14:76108160-76108182 AGGGAGACAGGTTTGAGGGCAGG No data
1119617459_1119617462 3 Left 1119617459 14:76108109-76108131 CCGGGACTCTACTTAACACTTCC No data
Right 1119617462 14:76108135-76108157 TTCTTCCTGAGCCAGCTGCAGGG No data
1119617459_1119617469 23 Left 1119617459 14:76108109-76108131 CCGGGACTCTACTTAACACTTCC No data
Right 1119617469 14:76108155-76108177 GGGGCAGGGAGACAGGTTTGAGG No data
1119617459_1119617466 9 Left 1119617459 14:76108109-76108131 CCGGGACTCTACTTAACACTTCC No data
Right 1119617466 14:76108141-76108163 CTGAGCCAGCTGCAGGGGCAGGG No data
1119617459_1119617465 8 Left 1119617459 14:76108109-76108131 CCGGGACTCTACTTAACACTTCC No data
Right 1119617465 14:76108140-76108162 CCTGAGCCAGCTGCAGGGGCAGG No data
1119617459_1119617461 2 Left 1119617459 14:76108109-76108131 CCGGGACTCTACTTAACACTTCC No data
Right 1119617461 14:76108134-76108156 CTTCTTCCTGAGCCAGCTGCAGG No data
1119617459_1119617468 16 Left 1119617459 14:76108109-76108131 CCGGGACTCTACTTAACACTTCC No data
Right 1119617468 14:76108148-76108170 AGCTGCAGGGGCAGGGAGACAGG No data
1119617459_1119617463 4 Left 1119617459 14:76108109-76108131 CCGGGACTCTACTTAACACTTCC No data
Right 1119617463 14:76108136-76108158 TCTTCCTGAGCCAGCTGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119617459 Original CRISPR GGAAGTGTTAAGTAGAGTCC CGG (reversed) Intergenic
No off target data available for this crispr