ID: 1119618646

View in Genome Browser
Species Human (GRCh38)
Location 14:76115032-76115054
Sequence AGCCTGCTGGGTAAGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119618629_1119618646 26 Left 1119618629 14:76114983-76115005 CCGTCACAGGCTGACCTGTCCAT No data
Right 1119618646 14:76115032-76115054 AGCCTGCTGGGTAAGGCTGCAGG No data
1119618637_1119618646 7 Left 1119618637 14:76115002-76115024 CCATGGGTATGGGATGTCTGGGG No data
Right 1119618646 14:76115032-76115054 AGCCTGCTGGGTAAGGCTGCAGG No data
1119618634_1119618646 12 Left 1119618634 14:76114997-76115019 CCTGTCCATGGGTATGGGATGTC No data
Right 1119618646 14:76115032-76115054 AGCCTGCTGGGTAAGGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119618646 Original CRISPR AGCCTGCTGGGTAAGGCTGC AGG Intergenic
No off target data available for this crispr