ID: 1119621320

View in Genome Browser
Species Human (GRCh38)
Location 14:76134123-76134145
Sequence CTGGGCAGGGGCACCCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119621320_1119621331 1 Left 1119621320 14:76134123-76134145 CCCACTGGGGTGCCCCTGCCCAG No data
Right 1119621331 14:76134147-76134169 CTCTGCCTGTGGAAGGGCCTTGG No data
1119621320_1119621333 11 Left 1119621320 14:76134123-76134145 CCCACTGGGGTGCCCCTGCCCAG No data
Right 1119621333 14:76134157-76134179 GGAAGGGCCTTGGCCCACCATGG No data
1119621320_1119621324 -10 Left 1119621320 14:76134123-76134145 CCCACTGGGGTGCCCCTGCCCAG No data
Right 1119621324 14:76134136-76134158 CCCTGCCCAGCCTCTGCCTGTGG No data
1119621320_1119621328 -5 Left 1119621320 14:76134123-76134145 CCCACTGGGGTGCCCCTGCCCAG No data
Right 1119621328 14:76134141-76134163 CCCAGCCTCTGCCTGTGGAAGGG No data
1119621320_1119621326 -6 Left 1119621320 14:76134123-76134145 CCCACTGGGGTGCCCCTGCCCAG No data
Right 1119621326 14:76134140-76134162 GCCCAGCCTCTGCCTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119621320 Original CRISPR CTGGGCAGGGGCACCCCAGT GGG (reversed) Intergenic