ID: 1119625388

View in Genome Browser
Species Human (GRCh38)
Location 14:76170016-76170038
Sequence ATGCATCTGAAGCAGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 362}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119625388_1119625391 20 Left 1119625388 14:76170016-76170038 CCCTCCTGCTGCTTCAGATGCAT 0: 1
1: 0
2: 3
3: 40
4: 362
Right 1119625391 14:76170059-76170081 GTAAGAGAGACAGCTGTTTGTGG 0: 1
1: 0
2: 2
3: 15
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119625388 Original CRISPR ATGCATCTGAAGCAGCAGGA GGG (reversed) Intronic
900352071 1:2239884-2239906 ACGCAGCTGAAGCAGCAGTGGGG - Intronic
901060494 1:6469671-6469693 ATCCATCTGCAGTGGCAGGAGGG + Exonic
902792253 1:18777534-18777556 ATGGATCTGAAGCGGGGGGAGGG - Intergenic
905937321 1:41834949-41834971 ATGAAGCTGGAGCAGCAGGCAGG + Intronic
906708941 1:47915050-47915072 AGGCACCTGAAGCATAAGGAGGG + Intronic
907338917 1:53719632-53719654 ATGCAACTGGGGCAGGAGGAAGG + Intronic
907344619 1:53764666-53764688 GTGCATCGGAATCACCAGGAGGG - Intergenic
907393122 1:54171577-54171599 ATGCATCCCAAGCTTCAGGAAGG - Intronic
908543742 1:65145873-65145895 ATGCATCAGAATCACCTGGAAGG - Intergenic
911292652 1:96076582-96076604 AGGCAGCAAAAGCAGCAGGAAGG + Intergenic
911768839 1:101713310-101713332 ATGAATTAGAAGCAGGAGGAAGG - Intergenic
912505638 1:110153864-110153886 AAACATCTGGAGCACCAGGATGG + Intronic
913616257 1:120562894-120562916 ATGCATCAGAATCACCTGGAGGG + Intergenic
913989007 1:143592376-143592398 CTGCATTTGAAGTAGGAGGATGG + Intergenic
914574018 1:148948010-148948032 ATGCATCAGAATCACCTGGAGGG - Intronic
915034403 1:152910287-152910309 AAGCACCTAGAGCAGCAGGAGGG + Exonic
915034408 1:152910317-152910339 AAGCACCCGGAGCAGCAGGAGGG + Exonic
915034466 1:152910587-152910609 AAGCACCTGGAGCACCAGGAGGG + Exonic
915034496 1:152910737-152910759 AAGCACCTGGAGCAGCAGGAGGG + Exonic
915034503 1:152910767-152910789 AAGCATCTGGAGCAGCAGGAGGG + Exonic
915034515 1:152910827-152910849 AAGCACCTGGAGCAGCAGGAGGG + Exonic
915034546 1:152910977-152910999 AAGCACCTGGTGCAGCAGGAGGG + Exonic
915034552 1:152911007-152911029 AAGCATCTGGTGCAGCAGGAGGG + Exonic
915034572 1:152911118-152911140 AAGCATCTGGAGCAGCAGCAGGG + Exonic
915034615 1:152911358-152911380 AAACATCTGGAGCAGCAGGAGGG + Exonic
915558163 1:156671228-156671250 CTGAATCTGAGGGAGCAGGATGG - Exonic
915644795 1:157262042-157262064 ATGCACCTGAGGGAGCAGAATGG - Intergenic
915672119 1:157498585-157498607 ATGCATCAGAATCACCTGGAAGG + Intergenic
915793447 1:158700908-158700930 ATGCATCAGAATCACCTGGAGGG + Intergenic
915985740 1:160462417-160462439 ATGCTTCTGATGAAGCAGCATGG + Intergenic
916561662 1:165938996-165939018 ATGCACCTGAAGATGGAGGAAGG - Intergenic
916930885 1:169576946-169576968 TTAAATCTGAAGAAGCAGGAGGG - Intronic
917724867 1:177818700-177818722 ATACATCAGAATCAGCAGGAGGG - Intergenic
918301866 1:183211839-183211861 ATGCATTTGAAGACTCAGGAAGG - Intronic
919591711 1:199511663-199511685 TTGCATCTGAATCTGAAGGAAGG - Intergenic
919871457 1:201824908-201824930 GTGCATCAGAATCACCAGGAGGG - Exonic
921200663 1:212802596-212802618 ATGTATGTAAAGCACCAGGATGG + Intronic
921255136 1:213332111-213332133 ATGCATCTGAAACATTGGGATGG - Intergenic
921255180 1:213332495-213332517 ATCCATCTCTGGCAGCAGGACGG + Intergenic
921407755 1:214799597-214799619 CTGCATCTGCAGCAGTAGAAGGG + Intergenic
922523016 1:226273755-226273777 ATGCATCAGAATCACCTGGAGGG - Intronic
922793112 1:228321509-228321531 AAGGAGATGAAGCAGCAGGAAGG + Exonic
923279184 1:232425727-232425749 GAGCATCTGCAGCAACAGGAGGG - Exonic
923610102 1:235483797-235483819 GTGCATGTGAAGTAGCAGCATGG - Intronic
924030956 1:239885261-239885283 GTGCATCTGAATCACCTGGAAGG + Intronic
1062987374 10:1781435-1781457 CTGCATATGGAGCAGCAGAAGGG - Intergenic
1063102244 10:2960963-2960985 CTGCACCTGAGGCAGCAGCAGGG - Intergenic
1064473520 10:15661762-15661784 ATTCATCTACAGCAGTAGGAGGG + Intronic
1065775980 10:29120727-29120749 AAGCATCTGAGGCTGGAGGATGG - Intergenic
1066791914 10:39074610-39074632 ATGCTTTTGAATCAGCAGGTTGG + Intergenic
1067260363 10:44684563-44684585 ATGCAAATGAAGCTGCACGATGG + Intergenic
1067741877 10:48901734-48901756 ATGCCTCTGCAGCAGGAGAAAGG + Intronic
1068605039 10:58995875-58995897 ATCCTTCTGAAGCACCATGAGGG - Intergenic
1069252749 10:66291313-66291335 ATGCATCAGAATCACCAGAAAGG + Intronic
1069629612 10:69889636-69889658 CTCCATCTGAAGCATGAGGATGG + Intronic
1071080522 10:81804624-81804646 GAGCAGCTGAAGCAGCAGCAGGG - Intergenic
1071436316 10:85651079-85651101 ATGCATCAGAATCACCTGGAGGG - Intronic
1071439640 10:85678943-85678965 ATGCATGTTAAGCAGCAGCGTGG - Intronic
1072399808 10:95086482-95086504 AGCCATCTGAAGCTGCAGGTGGG + Intergenic
1072585039 10:96774100-96774122 CTGCATCAGAAGCACCTGGAGGG + Intergenic
1073003785 10:100305858-100305880 ATGCATCAGAATCACCTGGAAGG + Intronic
1073814781 10:107194722-107194744 ATATGTCTGAAGCAGCAGTAAGG - Intergenic
1074067927 10:110035644-110035666 ATGCATTGGAAGCACCTGGAGGG + Intronic
1075486884 10:122829650-122829672 AAGCAGCTGCAGCAGCAGCAGGG - Intergenic
1075627601 10:123973743-123973765 TTGCACCTGAAGGAGCTGGATGG - Intergenic
1076041668 10:127255032-127255054 TTGCCTCTGAAGCAGATGGATGG + Intronic
1078487556 11:11738203-11738225 ATGGAGCTGAGGCAGCAGGTGGG - Intergenic
1078850141 11:15156126-15156148 ATGGATTTGTAGCAGCAGCAGGG - Intronic
1079008264 11:16807977-16807999 ATGCATCAGAATCAGCCAGAGGG + Intronic
1079149773 11:17887076-17887098 AGGAGTCAGAAGCAGCAGGAAGG + Intronic
1079338186 11:19589646-19589668 ATGTATCTAGAGCAGCAGGTGGG + Intronic
1079765421 11:24386504-24386526 ATGCATCAGAATCACCTGGAAGG + Intergenic
1080351061 11:31386338-31386360 CTTCATCTCAAGCAGAAGGAAGG - Intronic
1080569779 11:33545287-33545309 CTGCAGCCGATGCAGCAGGAAGG - Exonic
1081209008 11:40308903-40308925 ATGCATATGAATCATCAGAATGG + Intronic
1081319868 11:41679038-41679060 AGGCCTCTGAAGGTGCAGGATGG + Intergenic
1083119856 11:60500898-60500920 ACACATCTGAAGCAGGAGGTGGG - Intronic
1083679466 11:64344513-64344535 GTGCAGCTGGAGGAGCAGGAGGG + Exonic
1084568018 11:69942624-69942646 ATGCATCGGAGGGGGCAGGATGG - Intergenic
1085880338 11:80459984-80460006 ATGCTGCTGAAGAAGTAGGAAGG - Intergenic
1086103014 11:83121181-83121203 ATGCCAGTGAAGCAGGAGGAAGG - Intergenic
1086640314 11:89146278-89146300 CTCCTTCTGAAGCAGCAGAAAGG + Intergenic
1086890273 11:92249655-92249677 TTGCATATGAAGCTGAAGGAGGG - Intergenic
1088707373 11:112475929-112475951 ATCGATTAGAAGCAGCAGGAAGG - Intergenic
1088773890 11:113063088-113063110 AGGTTTCTGAAGCAGCCGGAGGG + Intronic
1088930949 11:114350240-114350262 ATGCATCAGAATCACCTGGAGGG - Intergenic
1089447438 11:118564921-118564943 ATGCTACTGAAAGAGCAGGATGG - Intronic
1090213658 11:124941438-124941460 ATTCAGCTGAAGCAGGAGTATGG + Intergenic
1090453867 11:126830324-126830346 ATACTTATGAAGCAGGAGGATGG - Intronic
1090885710 11:130874432-130874454 CTGAAACTGCAGCAGCAGGAAGG + Intergenic
1091860600 12:3778610-3778632 TTGCATCTGAAGCAGGAGTGGGG - Intergenic
1091874519 12:3922721-3922743 ATGCATCAGAATCAGTTGGAGGG + Intergenic
1092281038 12:7097756-7097778 ATGCCTCTGAGGAGGCAGGAAGG - Intronic
1093680118 12:21992926-21992948 CTGCATCTTAAGCAGCAGGAAGG + Intergenic
1096231138 12:49897554-49897576 CAGCAGCTGAATCAGCAGGATGG + Exonic
1096408029 12:51357885-51357907 ATGCATCAGAATCACCAGGAAGG - Intronic
1096445147 12:51683097-51683119 ATGTATGAGAGGCAGCAGGAGGG - Intronic
1096688610 12:53305891-53305913 ATACATCTAAGGCAGCAGCAGGG - Exonic
1097008686 12:55937284-55937306 AAGCATCTGAGGCAGGAGTATGG - Intronic
1097318549 12:58200247-58200269 ATGCCTCTGAAACATCTGGAGGG - Intergenic
1097591212 12:61577542-61577564 AGGAGTCTGAAGCAGGAGGATGG + Intergenic
1098251345 12:68572840-68572862 CTGCATTCCAAGCAGCAGGAAGG - Intergenic
1098301780 12:69061659-69061681 CAGCATCTGAACCAGCAGGATGG + Intergenic
1100121558 12:91374762-91374784 ATGCATCAAAAGCAACAAGAGGG - Intergenic
1100207370 12:92364939-92364961 AGGCATCAGAAACAGCTGGAGGG + Intergenic
1101687969 12:107044417-107044439 ATGCAGCTGGAGCAGCTGCATGG + Intronic
1102510852 12:113414467-113414489 CTGCACCTGCTGCAGCAGGAAGG + Intronic
1105009056 12:132742957-132742979 ATGCATCTGTAGAACCAGGAGGG - Intronic
1106165750 13:27244521-27244543 ATGTATCTGAACGACCAGGAAGG - Intergenic
1108255126 13:48602434-48602456 ATGCATGAGAAGCACCTGGAGGG - Intergenic
1112579722 13:100668143-100668165 GTGCATCTTCAGCAGCAGGCAGG - Intronic
1113137758 13:107113026-107113048 ATGCCACTGAAGCAGCTGCAAGG - Intergenic
1113987034 13:114325456-114325478 GTGCTTCTGGAGAAGCAGGAGGG - Exonic
1114311444 14:21471318-21471340 AAAAATCTGAAGCAGCAGGCTGG + Intronic
1114636587 14:24190553-24190575 AACCGTCAGAAGCAGCAGGATGG + Exonic
1117714136 14:58563426-58563448 ATTCCCCTGAAGCAGCAGGGTGG + Intergenic
1117785853 14:59284084-59284106 AAGCATCAGAATCACCAGGAAGG - Intronic
1119615337 14:76095284-76095306 CTGCATCTGAAGCACCTGCAGGG + Intergenic
1119625388 14:76170016-76170038 ATGCATCTGAAGCAGCAGGAGGG - Intronic
1119895984 14:78220392-78220414 AAGCAGCAGATGCAGCAGGAAGG + Intergenic
1119909149 14:78334054-78334076 ATTTATCCTAAGCAGCAGGAAGG + Intronic
1119972272 14:78984635-78984657 AGGCATCTGAACCACCTGGAGGG + Intronic
1120577905 14:86207118-86207140 ATGAATCTGAGGTAGCAGGAGGG + Intergenic
1120653767 14:87165228-87165250 ATGCCTCAGAATCACCAGGAGGG + Intergenic
1121431442 14:93891145-93891167 AGGAATCCGGAGCAGCAGGAAGG - Intergenic
1121566661 14:94915012-94915034 ATGCCTCTGCAGCAGCACGCAGG + Intergenic
1121843586 14:97154664-97154686 GTGCCTGTGATGCAGCAGGATGG + Intergenic
1122249367 14:100427277-100427299 ATGCATCTAATGCAGCTGGGGGG - Intronic
1123103183 14:105819361-105819383 AGGCATCTGAAACTGCAGGTGGG - Intergenic
1124413054 15:29452392-29452414 AAGCCTCTGAAACACCAGGAAGG + Intronic
1125744546 15:41989553-41989575 CTGCACATGAAGCAGCAGGACGG + Intronic
1125973135 15:43928499-43928521 ATGCAGCTGAACCATCATGATGG + Intronic
1126168340 15:45672895-45672917 GTGCATCTGAATCAGCTGGAGGG + Intronic
1126670827 15:51113686-51113708 ATGGGTCAGAAGAAGCAGGAAGG - Intergenic
1127299291 15:57637021-57637043 CTGCCTCTGAAGCTGCAGGAGGG - Intronic
1129744758 15:78010321-78010343 GGGAATCTGGAGCAGCAGGATGG + Intronic
1130116327 15:81007755-81007777 ATGCATCTGAATCAACTGGGAGG - Intronic
1131870371 15:96757466-96757488 ATGAAGCTGAAACAGCAGAAGGG - Intergenic
1134762321 16:16725155-16725177 AAGCAACAGCAGCAGCAGGATGG + Intergenic
1134983738 16:18634015-18634037 AAGCAACAGCAGCAGCAGGATGG - Intergenic
1136030778 16:27501306-27501328 ATGGATCAGGAGAAGCAGGAAGG - Exonic
1136394824 16:29987172-29987194 AAGCAGCAGCAGCAGCAGGAGGG - Exonic
1136461716 16:30415332-30415354 CTGTTTCTGAAGCTGCAGGAGGG - Intronic
1137391042 16:48081774-48081796 ATGCATCTGAAGGAGCAGCAGGG + Intergenic
1138587736 16:57982069-57982091 AATCAACTGAAGCAGGAGGAAGG - Intronic
1138729781 16:59182355-59182377 ATGCATGTGCAGCAGCAGTGTGG + Intergenic
1140467728 16:75195883-75195905 ATGCATCAGAATCACCTGGAAGG + Intergenic
1141412312 16:83843919-83843941 ATGCACCAGTAGCAGCAGGAAGG + Intergenic
1141455833 16:84141297-84141319 GTGTATCTGAACCAGCAGCAGGG - Intronic
1141455840 16:84141336-84141358 GTGTATCTGAACCAGCAGCAGGG - Intronic
1141455847 16:84141375-84141397 GTGTATCTGAACCAGCAGCAGGG - Intronic
1142578364 17:924608-924630 ATGCACCTAATGCTGCAGGACGG - Intronic
1142707538 17:1705907-1705929 ACGCAGCAGAAGCAGCAGGGAGG + Exonic
1142800343 17:2341027-2341049 AGGCATCTGAAGCAGGCTGATGG - Intronic
1144005517 17:11095894-11095916 AAGTATCTGAATCACCAGGAGGG - Intergenic
1144261818 17:13528825-13528847 AGGCATTTCAAGCAGCGGGATGG + Intronic
1144433126 17:15213448-15213470 CTTCATCTGAAGCAGCATGATGG + Intergenic
1146919581 17:36701561-36701583 ATGCAGTTGAAGGAGGAGGAAGG - Intergenic
1147658122 17:42102409-42102431 GTGCCTCTTAACCAGCAGGAAGG - Intronic
1147794693 17:43034118-43034140 GTGCATCTGAAGCAGGGAGAGGG - Intergenic
1149455477 17:56784570-56784592 ATGCATCAGAATCACCAGGAGGG + Intergenic
1149954487 17:61033221-61033243 ATGCATCAGAATCATCTGGAGGG + Intronic
1150134745 17:62689594-62689616 CGGCTTCTGAAGCAGCCGGAAGG - Exonic
1151262002 17:72923373-72923395 ATGCATATGAAGCAGAACCATGG + Intronic
1152374458 17:79911925-79911947 CTGTCTCTGAAGCACCAGGATGG - Intergenic
1152672255 17:81615891-81615913 ATGCATCTGGAGCAGAACCAGGG + Intronic
1153014212 18:568785-568807 AGGCATCTTACCCAGCAGGAAGG - Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153867597 18:9287185-9287207 ATGCATGTAAATCAGCAGGACGG - Intergenic
1155382890 18:25244150-25244172 CTGCATCTGGTGGAGCAGGATGG - Intronic
1155657131 18:28205335-28205357 ATCCATCTGAAGCAGCTGTAAGG - Intergenic
1156082027 18:33347427-33347449 ATGCTTCTGAGGCAGCATGCTGG - Intronic
1157482433 18:48064111-48064133 ATGCATATGCAGCTGCTGGATGG + Intronic
1157740963 18:50092431-50092453 ACGCAGCAGCAGCAGCAGGATGG - Intronic
1158894605 18:61901179-61901201 TGGCAGCTGGAGCAGCAGGAGGG - Intergenic
1160038927 18:75326745-75326767 ATGCAAAGCAAGCAGCAGGAAGG + Intergenic
1165364983 19:35359809-35359831 ATGGAGCTGAAGGAGCAGAAGGG + Exonic
1165366802 19:35372278-35372300 ATGGAGCTGAAGGAGCAGAAGGG + Exonic
1167488738 19:49779677-49779699 ACGCATGTGAGGCAGGAGGATGG - Intronic
1167621120 19:50561363-50561385 ATGCCTCTCAAGCACCAGAAGGG - Intronic
1168477117 19:56684435-56684457 ATGCAGCTGAAGCAGTACTAAGG + Intergenic
926865601 2:17354435-17354457 ATGCATCACAAGCATCTGGAAGG + Intergenic
927094580 2:19737887-19737909 ATGGATCTTCAGCAGCAGGGTGG + Intergenic
927143007 2:20142430-20142452 ATGCATCAGAATCATCTGGAGGG - Intergenic
927649003 2:24899498-24899520 TTCCATCTGCAGCAGCAAGAAGG - Intronic
927813770 2:26195879-26195901 ACGCATCAGAATCACCAGGAGGG - Intronic
927906842 2:26864704-26864726 ATGAGTGTGAAGCTGCAGGAAGG + Intronic
928115856 2:28544800-28544822 ATGCGTCAGATGCAGCAGCAAGG + Intronic
929590563 2:43143064-43143086 AGGCAGCAGCAGCAGCAGGAGGG - Intergenic
930174637 2:48289180-48289202 ATGCATCGGAATCAGCTAGAGGG - Intergenic
930798531 2:55419348-55419370 AGGCATCTGGAGGAGGAGGAAGG + Exonic
930864943 2:56113297-56113319 ATGCATCTGAATCACCTGGAGGG - Intergenic
931594416 2:63926127-63926149 TTTCATCCGTAGCAGCAGGAAGG - Intronic
931709164 2:64972949-64972971 CTGCATCTCAAGCAGGAGGAAGG - Intergenic
931736999 2:65204986-65205008 CTGCAGCTGCAGCAGCTGGAGGG - Intergenic
932893688 2:75618106-75618128 ATGCATCTGAAACAACAGGGAGG + Intergenic
934580512 2:95434211-95434233 CTGCATCTGAAGGAGCAGCCTGG - Intergenic
934598936 2:95642506-95642528 CTGCATCTGAAGGAGCAGCCTGG + Intergenic
937192030 2:120111476-120111498 ATGCATCAGAATCTCCAGGAGGG - Intronic
938670949 2:133586317-133586339 AGGAATCGGAAGCAGAAGGAAGG - Intergenic
938913680 2:135912043-135912065 ATGCATCAGAATCACCTGGAGGG - Intronic
939011252 2:136848281-136848303 ATGCATCAGAATCACCTGGAAGG + Intronic
940068094 2:149652392-149652414 TTGCAACTGCAGCAGCAGAATGG + Intergenic
940112049 2:150165812-150165834 ACTCATATTAAGCAGCAGGAAGG + Intergenic
940384163 2:153050776-153050798 ATGCATCAGAATCACCTGGAGGG + Intergenic
941601512 2:167548522-167548544 ATGCATTCCAGGCAGCAGGAGGG - Intergenic
941711457 2:168718478-168718500 ATGCAGCAGAATCATCAGGAAGG - Intronic
941769477 2:169329749-169329771 ATGCTTCTGGGGCAGCTGGAGGG - Intronic
943592435 2:189814992-189815014 AGGAATCTGAAGCAGGAGAATGG + Intronic
944772809 2:202931695-202931717 ATGCAGCTGAAGAAGCTGCATGG - Intronic
944899860 2:204203162-204203184 ATGCATCAGAATCACCTGGAAGG + Intergenic
944939555 2:204608735-204608757 ATGCATATGCAGGAGCAGGGAGG - Intronic
945324124 2:208463202-208463224 GTGGAGCTGAGGCAGCAGGAGGG - Intronic
945476054 2:210284405-210284427 ATGCAACTGAAGCAGCTGCACGG - Intergenic
945786673 2:214247921-214247943 AGGATGCTGAAGCAGCAGGATGG + Intronic
947239768 2:227981757-227981779 ATGCATGAGGAGCAGAAGGATGG - Exonic
1169196762 20:3687373-3687395 ATGCATCTGGAGCAGGAATAAGG + Exonic
1170823494 20:19773733-19773755 ATGCACCTCAGCCAGCAGGAAGG - Intergenic
1170841335 20:19926963-19926985 ATGCATAGGAAGCTGCAGGGAGG - Intronic
1171491742 20:25524255-25524277 AGGCATCTGCAGCACCAGCAGGG + Intronic
1171964569 20:31519654-31519676 ATGCATCAGAATCACCAGGTGGG - Intronic
1172590168 20:36112231-36112253 ATGCACCTGAAGCGGCAGCAGGG - Intronic
1173178883 20:40786614-40786636 ATGCAGAAGAGGCAGCAGGATGG - Intergenic
1173311621 20:41901354-41901376 ATGCATCAGAATCACCTGGAGGG - Intergenic
1174543275 20:51306445-51306467 CTGCATTTGAAGCAGGAGCATGG + Intergenic
1174578160 20:51552170-51552192 ATGAAGCTGAAACAGGAGGATGG + Intronic
1174585824 20:51607415-51607437 ACGAATCTGAAATAGCAGGAAGG - Intronic
1174645022 20:52078343-52078365 CAGCATCTGAAGCAGCATGTGGG + Intronic
1175614853 20:60389288-60389310 AGGCTTCTGAATGAGCAGGAAGG + Intergenic
1175988121 20:62774430-62774452 ATGCTTCTGAAGCACAAGGAGGG + Intergenic
1176716643 21:10355894-10355916 ATGCATCTGCACCATCAGCATGG - Intergenic
1177758862 21:25380073-25380095 ATTCATTAGAAGCAGCAGAATGG - Intergenic
1178361790 21:31954684-31954706 ACGCATCAGAAGCACCTGGAGGG + Intronic
1178448951 21:32674206-32674228 ATGTTTTTGAAACAGCAGGAAGG - Intronic
1178503651 21:33145900-33145922 ATAGAACTGAAGCTGCAGGAAGG + Intergenic
1180922053 22:19526047-19526069 ATGGGTCTGCAGCAGGAGGAAGG - Intronic
1182520625 22:30882597-30882619 TGGCATCAGAATCAGCAGGAGGG + Intronic
1182869570 22:33634240-33634262 ATGCATCAGAATCACCTGGAGGG + Intronic
1183093089 22:35536720-35536742 TTGCATCAGAATCACCAGGAGGG + Intergenic
1183507863 22:38219554-38219576 ATGCATCCTAAGGAGGAGGAGGG + Exonic
1184255115 22:43282053-43282075 AGGCATCGGGAGCAGCTGGACGG + Intronic
1185136674 22:49077381-49077403 ATGCCCAAGAAGCAGCAGGAAGG - Intergenic
951068930 3:18302705-18302727 ATGAAACAGAAGCAGCTGGATGG - Intronic
951264629 3:20551642-20551664 ATGCATCAGAATCACCTGGAGGG - Intergenic
951286029 3:20815026-20815048 ATGAATCTGGAGCAGTAGCAAGG - Intergenic
952100491 3:30006514-30006536 ATGCATGGGAAGCTGAAGGATGG - Intronic
952282722 3:31938996-31939018 GTTGATCTGAAGCAGGAGGAAGG - Intronic
952427284 3:33188476-33188498 ATGCATCAGAATCACCTGGAAGG + Intronic
953713700 3:45297216-45297238 ATGCATCTGTGGCAGCACCAAGG - Intergenic
954571320 3:51643387-51643409 ATACATCTGGAACAGTAGGATGG - Intronic
954877280 3:53810350-53810372 GTGCAACTGTAACAGCAGGAAGG + Intronic
955146426 3:56324721-56324743 ATGTAACTGAACCTGCAGGAAGG + Intronic
955571853 3:60315683-60315705 ATCCATCAGCAGCAGCAGAATGG - Intronic
955972607 3:64450823-64450845 ATGCATTTGAAGGACCAGCATGG + Intergenic
956308876 3:67857051-67857073 ATGTATCAGAATCACCAGGATGG - Intergenic
956371776 3:68571023-68571045 ATGCAGGTAAAGCAGCATGAGGG - Intergenic
956488517 3:69746973-69746995 ATGCATCCAAAGCCACAGGAGGG - Intronic
956899882 3:73704343-73704365 ATGCATCAGAAACACCTGGAGGG + Intergenic
957828733 3:85487459-85487481 CTGCATCTGAAGAAGAAGAAAGG + Intronic
958748659 3:98168002-98168024 ATGCATTTGAATCACCTGGAGGG + Intergenic
958752348 3:98206720-98206742 ATGCATTTGAATCAACTGGAGGG + Intergenic
959383627 3:105673994-105674016 ATGCATCAGAATCACCAGGAAGG + Intronic
960126546 3:114004961-114004983 ATGGATTTGAAGCATTAGGATGG - Intronic
960895417 3:122499652-122499674 AGGAGGCTGAAGCAGCAGGATGG + Intronic
961051066 3:123747484-123747506 ATGCATCAGAATCACCCGGAGGG - Intronic
961127735 3:124435685-124435707 ATTCCTCTGAAGCAACAGAAAGG - Intronic
961453990 3:127015356-127015378 AACCATCTGAAACAGGAGGAGGG - Intronic
961671514 3:128535278-128535300 CTGCATGTCAGGCAGCAGGATGG - Intergenic
962502522 3:136009717-136009739 ATGCATCAGAATCACCCGGAGGG - Intronic
963059592 3:141214471-141214493 ATGCTTCTTAAGCAGCTGAACGG - Intergenic
963762273 3:149295784-149295806 ATGCACAAGGAGCAGCAGGAAGG - Intergenic
964460271 3:156917486-156917508 AAGCTTCTGAAGCAGGGGGAAGG + Intronic
964792985 3:160470415-160470437 CTGGAGCTGAAGCAGCTGGAAGG - Intronic
966412113 3:179654481-179654503 ATGTGTGAGAAGCAGCAGGAGGG + Intronic
966650106 3:182291126-182291148 AGGAAACTGATGCAGCAGGACGG - Intergenic
967532161 3:190561044-190561066 AATCATCTGAAGCAACAGCAGGG + Intronic
968509803 4:990679-990701 ATGTGTAGGAAGCAGCAGGAAGG - Intronic
969070003 4:4528719-4528741 GTGTGTCTCAAGCAGCAGGAAGG + Intronic
969230225 4:5825417-5825439 TTTCCTCAGAAGCAGCAGGAAGG + Intronic
970731631 4:19111370-19111392 ATGTATCAGAATCAGCTGGAAGG + Intergenic
970897953 4:21125145-21125167 GTGCATCAGAATCAGCAGGAGGG + Intronic
971265573 4:25093758-25093780 CTGCATGTGGAGCACCAGGAGGG - Intergenic
973314161 4:48742100-48742122 ATGCATGTGTGGGAGCAGGAAGG + Intronic
975224967 4:71860553-71860575 AAGGAGCTGAAGCAGCAGGGTGG + Intergenic
977332921 4:95660761-95660783 ATGTACCTGAGGCAGCAGTATGG - Intergenic
978901627 4:113957007-113957029 TTGCAGCTGTAGCAGCAAGATGG + Intronic
979695965 4:123613238-123613260 ATGTATCTGGATCTGCAGGAAGG + Intergenic
980180835 4:129398681-129398703 ATGCTTCTGAAGCAGCTGGGAGG - Intergenic
980298587 4:130957571-130957593 ATGCTTCTGAGGAAACAGGACGG + Intergenic
981992427 4:150938648-150938670 CTGCATCTTAAGCAGTAGGAAGG - Intronic
983507888 4:168575146-168575168 ATGCATCAGAATCACCTGGAGGG + Intronic
984942018 4:184941191-184941213 AGGAAGCTGAAGCAGGAGGATGG - Intergenic
985041457 4:185895485-185895507 CTGCATCTGCTGCAGCAGAACGG - Intronic
987023508 5:13899568-13899590 GTGTATTTGGAGCAGCAGGAGGG - Intronic
987844182 5:23260174-23260196 ATTCATCAGAATCACCAGGAGGG - Intergenic
988248798 5:28726699-28726721 CTACATTTGAAGAAGCAGGAAGG - Intergenic
989215768 5:38902841-38902863 ATGCATCTGAATACCCAGGAAGG + Intronic
989337432 5:40335310-40335332 AATTATCTGAAGCAGCAGAAAGG - Intergenic
990848346 5:60171489-60171511 ATGGATCTGAGGTAGAAGGAAGG + Intronic
991008588 5:61857390-61857412 GTGCATCAGAATCATCAGGAAGG - Intergenic
991434924 5:66588012-66588034 ATGCATATGAGGAAGCAGGTGGG + Intergenic
996957073 5:129196100-129196122 ATGCATCAGAAGTAAAAGGAAGG - Intergenic
998615245 5:143733353-143733375 ATGCATCAGAATCACCTGGATGG + Intergenic
999301432 5:150493140-150493162 ATGCATTAGAATCAGCGGGAAGG - Intronic
999443364 5:151620065-151620087 ATGCCTCCCCAGCAGCAGGAGGG + Intergenic
999661557 5:153869114-153869136 ATGCAGATGAAGCAGCATAATGG - Intergenic
1000127763 5:158263537-158263559 AAGCACCTGAAGCGACAGGAAGG + Intergenic
1001234413 5:170017452-170017474 ATGCATCAGAAGTAGCAGATAGG - Intronic
1001370768 5:171198543-171198565 AGGCATCTGAATCATCTGGAGGG + Intronic
1001427603 5:171633937-171633959 CAGCATCTGAAACAGGAGGATGG - Intergenic
1001595315 5:172895080-172895102 ATGCAGCAGAATCAGCAAGAGGG + Intronic
1001750992 5:174131309-174131331 ATTCATAAGAATCAGCAGGAAGG + Intronic
1001855815 5:175009730-175009752 ATGTTTCTGAAAGAGCAGGAAGG + Intergenic
1003243849 6:4367897-4367919 ATGCATCAGAATCATCTGGAAGG + Intergenic
1005106062 6:22225542-22225564 GTTCATCTGAAGTAGCAGGTGGG - Intergenic
1005405775 6:25486300-25486322 ATGCTACTGAAACAGCATGAAGG - Intronic
1006459295 6:34149069-34149091 AACAATCTGATGCAGCAGGAGGG - Intronic
1007898242 6:45384827-45384849 GTGCATCTGTAGCATCAGGTGGG - Intronic
1008718789 6:54323138-54323160 ATGCCTCTTAAGCAGCCGTAGGG - Intronic
1010537221 6:77045978-77046000 ATTCATCTGTTGCTGCAGGAAGG - Intergenic
1011919816 6:92559529-92559551 ATGCAACTACACCAGCAGGAAGG + Intergenic
1012323471 6:97882735-97882757 ATGCATCGGAATCACCAGGAAGG - Intergenic
1013012280 6:106131771-106131793 ATGCACCTGACCCAGCAGGTTGG + Intergenic
1013624658 6:111925375-111925397 AGGCATCAGAAGCACCTGGAGGG - Intergenic
1014271056 6:119336389-119336411 ATGCATCAGAATCACCTGGAGGG - Intronic
1015425945 6:133067562-133067584 ATGGAGCTGAAACAGCAGGTAGG + Intergenic
1017200908 6:151754064-151754086 AACCTTCAGAAGCAGCAGGAAGG + Intronic
1017820514 6:158045769-158045791 CTACATCTGAGGCAGCACGAAGG - Intronic
1017822410 6:158059264-158059286 GTGCTTCTGAAGGAGCAGTACGG + Exonic
1017930485 6:158949756-158949778 ATGCAGTTGAAGGAGAAGGAAGG - Intergenic
1018090701 6:160345274-160345296 TAGGATCTGAAGCAACAGGAAGG + Intergenic
1022888725 7:34674158-34674180 TTGCTTCTGTAGCAGCAGGTAGG + Intronic
1023293337 7:38689819-38689841 ATGCATCTGAATCACCTGGAGGG - Intergenic
1024245221 7:47464545-47464567 TTGCATCAGAACCACCAGGAGGG + Intronic
1024417083 7:49119978-49120000 GTGCATCAGCAGCAGCATGAGGG + Intergenic
1026268638 7:68817369-68817391 CTGCATCCTAGGCAGCAGGAAGG + Intergenic
1027591042 7:80119669-80119691 TTGAATCAGAAGTAGCAGGAGGG - Intergenic
1028420335 7:90625719-90625741 ATGCTACAGAAGCAGCAGGCTGG + Intronic
1028512439 7:91640356-91640378 ATGCTTCAGAATCATCAGGAGGG + Intergenic
1028601753 7:92608738-92608760 ATGCCTCTGAGACAGCAGCAGGG + Exonic
1029022502 7:97379869-97379891 CTGAATCTGAAACTGCAGGATGG - Intergenic
1029812516 7:103063884-103063906 AAGCATCTGAAGCAAGATGAGGG - Intronic
1030215313 7:107039121-107039143 AAGCATCTGAATCACCTGGAGGG - Intergenic
1031469761 7:122155250-122155272 GTGCATCAGAATCACCAGGAGGG + Intergenic
1031850249 7:126854426-126854448 ATGCATCAGAATCACCTGGAAGG + Intronic
1031946077 7:127841988-127842010 ATGCTTTAGAAGCAGCAGAATGG - Intronic
1032650383 7:133871664-133871686 AAGAATGTGAAGCAGGAGGAAGG - Intronic
1032863950 7:135907311-135907333 TAGCATCTGAAGAAACAGGAGGG - Intergenic
1033265649 7:139884456-139884478 AGGGAGCTGGAGCAGCAGGAAGG + Intronic
1033467080 7:141602809-141602831 ATGCAGCTGAAGCAGTAGAGTGG - Intronic
1034140112 7:148807701-148807723 CTGTATCTGAAACAACAGGAAGG + Exonic
1034890603 7:154835689-154835711 CTGCATCTGAATCACCCGGATGG - Intronic
1035729313 8:1843381-1843403 AGGCATCTGGAGCTGCAGCATGG + Exonic
1035791497 8:2309771-2309793 ATTCATCTGAAGAAGTAGAATGG + Intergenic
1035801308 8:2411934-2411956 ATTCATCTGAAGAAGTAGAATGG - Intergenic
1036208753 8:6825202-6825224 ATATGTCTGAAGCAGCAGGTGGG + Exonic
1036438546 8:8758960-8758982 ATGCATCAGAATCATCTGGAGGG - Intergenic
1037547973 8:19941702-19941724 ATGCATCTGGAGGAGAAAGAGGG - Intronic
1037596815 8:20361217-20361239 GGGAATCTGAAGCAGGAGGATGG + Intergenic
1037893206 8:22635043-22635065 ATGCAGGAGAGGCAGCAGGAGGG - Intronic
1039479278 8:37859790-37859812 CAGCATCTGCAGCAGCTGGAAGG + Exonic
1040837253 8:51745657-51745679 CTGCACCTGAAGGAGTAGGAAGG - Intronic
1041129073 8:54677289-54677311 ATGCATCTGCATCACCAGGAGGG - Intergenic
1043544110 8:81295781-81295803 ATTCCTCTGAAACAGAAGGAAGG - Intergenic
1045110931 8:98939322-98939344 ATGCATCAGAATCACCTGGAGGG + Intronic
1046480994 8:114818317-114818339 CTGCAGCTGAAGCAGGAGAATGG + Intergenic
1047940997 8:129827143-129827165 CTGCATCAGAATCACCAGGAGGG - Intergenic
1049368116 8:142250630-142250652 ATGCACCTGAAGCAGCAGCTAGG + Intronic
1049786806 8:144454805-144454827 AGGCAGCTGAAGCAGTAGGATGG - Intronic
1050110522 9:2210889-2210911 CTGCATCAGAATCACCAGGAGGG + Intergenic
1051106984 9:13591627-13591649 ATGGATTGGAAGCTGCAGGAAGG - Intergenic
1052437223 9:28444375-28444397 ATGCAACAGAAGCAGCAGTGGGG + Intronic
1052685997 9:31756758-31756780 TTACATCTGAAGCAGCAAGAGGG + Intergenic
1053426097 9:38011114-38011136 ATCCTGCTGATGCAGCAGGAAGG - Intronic
1054776737 9:69130414-69130436 TTGCATCTGAACCATCTGGAAGG + Intronic
1056467849 9:86876570-86876592 ATGAATATGAAGCAGCGGGAAGG - Intergenic
1056814203 9:89789816-89789838 TTGCATTTCAGGCAGCAGGAAGG + Intergenic
1057124904 9:92609378-92609400 AAGTCTCTGGAGCAGCAGGAAGG + Intronic
1057835271 9:98439704-98439726 ATCCAACTGAAGCAGCTGGTTGG + Intronic
1058042693 9:100321476-100321498 AGGCTTCTGAGGCAGGAGGATGG - Intronic
1060018109 9:120104701-120104723 GTGCATCTGCAGTAACAGGAAGG + Intergenic
1060976877 9:127770258-127770280 GTGCACCTGGAGCAGGAGGAAGG - Intronic
1186387876 X:9128222-9128244 GTGCATCTGAATCAGCAGAAAGG + Intronic
1186421776 X:9432516-9432538 ATGCATCAGTAGCAACTGGAGGG + Intergenic
1186979964 X:14948218-14948240 ATGCATCAGAATCACCTGGATGG + Intergenic
1187075511 X:15930434-15930456 ATCAATCTGAAGCAGCCAGAGGG - Intergenic
1187420531 X:19130001-19130023 CTGCATCAGAATCACCAGGAAGG + Intergenic
1187528004 X:20071438-20071460 ATGCATCAGAACCACCTGGAGGG + Intronic
1189116744 X:38350716-38350738 CTGCATCTGTAGCATTAGGAGGG + Intronic
1189186371 X:39058950-39058972 ATGCATCAGAATCACCTGGAAGG - Intergenic
1189563713 X:42217621-42217643 ATGCATCAGAATCACCTGGAGGG + Intergenic
1190729164 X:53213544-53213566 GAGCAGCTGAAGCAGCAGTAAGG - Intronic
1190834143 X:54084941-54084963 ATGCTTCTGGAGCTGAAGGAAGG + Intronic
1190843848 X:54172689-54172711 ATGTATCAGAATCAGCTGGAGGG + Intronic
1190915869 X:54810815-54810837 ATGCAGGTGAAGCATCTGGATGG + Exonic
1192232615 X:69276459-69276481 ATGCATCAGAATCATCAAGAAGG + Intergenic
1192247073 X:69382325-69382347 AATCATTTGAAGCAGAAGGAAGG - Intergenic
1192926357 X:75758967-75758989 ATGCATCTGAAGGAGCTGGCTGG - Intergenic
1193150974 X:78124375-78124397 ATGCATGAGAATCACCAGGAGGG - Intronic
1193223301 X:78952713-78952735 ATTCATCTTGAGCAGCAGGAAGG + Intronic
1194646497 X:96464476-96464498 ATTTACCTGAAGCAGGAGGAAGG + Intergenic
1195091014 X:101459069-101459091 TAGCCTCTGATGCAGCAGGATGG - Intronic
1195400624 X:104457752-104457774 ATGCATCAGAATCACCAGGATGG + Intergenic
1197149785 X:123207717-123207739 ATTAAGCTGAAGCAGCAGGCAGG + Intronic
1198694751 X:139324237-139324259 ATGCAGCTGCTGCAGCAGGTGGG - Intergenic
1200275181 X:154725293-154725315 ATGCATCTGAATCACCTGGAAGG + Intronic