ID: 1119628912

View in Genome Browser
Species Human (GRCh38)
Location 14:76208919-76208941
Sequence TTAAATCAGCATGGGGAGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119628903_1119628912 6 Left 1119628903 14:76208890-76208912 CCTAATTCCTGGACTGGACCACA 0: 1
1: 0
2: 1
3: 10
4: 111
Right 1119628912 14:76208919-76208941 TTAAATCAGCATGGGGAGGTGGG 0: 1
1: 0
2: 2
3: 14
4: 213
1119628904_1119628912 -1 Left 1119628904 14:76208897-76208919 CCTGGACTGGACCACAGACCAGT 0: 1
1: 0
2: 0
3: 18
4: 187
Right 1119628912 14:76208919-76208941 TTAAATCAGCATGGGGAGGTGGG 0: 1
1: 0
2: 2
3: 14
4: 213
1119628900_1119628912 26 Left 1119628900 14:76208870-76208892 CCTGGGAAGTTTTAAAAAGTCCT 0: 1
1: 0
2: 11
3: 74
4: 443
Right 1119628912 14:76208919-76208941 TTAAATCAGCATGGGGAGGTGGG 0: 1
1: 0
2: 2
3: 14
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119628912 Original CRISPR TTAAATCAGCATGGGGAGGT GGG Exonic
900182355 1:1317073-1317095 TTAAATTAGCCTGGCGTGGTGGG - Intronic
901200832 1:7466616-7466638 TAAAATGAGCAAGGAGAGGTGGG + Intronic
901391374 1:8948498-8948520 TTCCTGCAGCATGGGGAGGTGGG + Intronic
903579057 1:24357476-24357498 TTAAATCAGCATTTGTGGGTGGG + Exonic
904994334 1:34619214-34619236 TCAAATCTGCATGGAGAAGTTGG - Intergenic
906572241 1:46852787-46852809 TTAGTTGAGCCTGGGGAGGTTGG + Intergenic
906599538 1:47113118-47113140 ATAGATCAGCCTGTGGAGGTTGG - Intronic
907265191 1:53254971-53254993 TTAAATCAGGACTGGGAGGTGGG + Intronic
908318843 1:62961634-62961656 TGAAATCAGAATGGGGAGGAGGG - Intergenic
911104167 1:94117119-94117141 TTCAATCAACATGGGGAGGAGGG + Intronic
912964219 1:114223362-114223384 TCTAATCACCATGGGGAGGCTGG + Intergenic
914076475 1:144357137-144357159 TGAATACAGCATGGGGAAGTGGG + Intergenic
914102703 1:144609360-144609382 TGAATACAGCATGGGGAAGTGGG - Intergenic
914640365 1:149600438-149600460 TGAATACAGCATGGGGAAGTGGG - Intergenic
915229208 1:154433172-154433194 TTAACTCAGCCTGGAAAGGTTGG + Intronic
915468373 1:156111489-156111511 TGAAATCAGCATGCAGTGGTTGG - Intronic
915687788 1:157652571-157652593 TTAAACCTGCATGGAGAGGAAGG + Intergenic
920364835 1:205442650-205442672 TTGAGTCAGCATGGGTAGGTAGG + Intronic
920404713 1:205700714-205700736 TTAAAGGAGAATTGGGAGGTGGG + Intergenic
921223311 1:212990948-212990970 TAAAATCAGCTTTGGGAGGGGGG - Intronic
921625352 1:217373029-217373051 GTCAATGAGCATGGGGAGGGAGG + Intergenic
922133183 1:222799209-222799231 TGAGAACAGCATGGGGAGGGTGG + Intergenic
923475506 1:234327662-234327684 TTAAATCATTTTGTGGAGGTTGG - Intergenic
923640300 1:235751471-235751493 TTTGATCAGCATGGGGATGATGG + Intronic
923761315 1:236847708-236847730 TTAAATCAGAATCTGGAGATGGG - Intronic
924050594 1:240076382-240076404 TGAAATCAGCATGTAGAGGCAGG + Intronic
924356036 1:243177054-243177076 TGAAATCAGAATGGTGAGGATGG + Intronic
1063116737 10:3076930-3076952 TTATGTAGGCATGGGGAGGTGGG - Intronic
1063798297 10:9538887-9538909 TTAAATGATCATGGGGAATTAGG + Intergenic
1063942621 10:11146018-11146040 TTACAACAGCATGGAGAGGTGGG + Intronic
1065316883 10:24472326-24472348 AGAAATCAGCATGGAGAGGCTGG - Intronic
1067734678 10:48840306-48840328 TTCAACCAGCCTGGGGCGGTGGG + Intronic
1069049516 10:63777829-63777851 TTAAATTAGCATGGAGATTTTGG - Intergenic
1069226318 10:65949572-65949594 AGAAAAAAGCATGGGGAGGTAGG + Intronic
1070029098 10:72659694-72659716 TTAAATCCTCCTGGGGAGCTGGG - Intergenic
1070529578 10:77325065-77325087 TTAAATCAGCATGGTAATGAAGG - Intronic
1070646923 10:78208233-78208255 CTAAATCAGAATCTGGAGGTAGG + Intergenic
1070960226 10:80493992-80494014 TTTAATCTGCATGCAGAGGTTGG + Intronic
1071269934 10:83997820-83997842 TGAATTCAGGATGTGGAGGTTGG - Intergenic
1072520933 10:96229520-96229542 TAAAATCAGCCTGGAGAGGAAGG - Intronic
1073191281 10:101651997-101652019 TCAAATCCGAATGGGGAGGAGGG + Intronic
1074783192 10:116817102-116817124 GTAAATCTGCATGGTGGGGTGGG - Intergenic
1076105990 10:127824126-127824148 GAGAAGCAGCATGGGGAGGTGGG + Intergenic
1079081466 11:17416192-17416214 TGAAGTCAGGATGGGAAGGTTGG - Intronic
1082896121 11:58191552-58191574 ATAAATCAGAAAGTGGAGGTGGG - Intergenic
1084453220 11:69252207-69252229 TGAAAATAGCATGGGGAGGGAGG - Intergenic
1085165841 11:74398509-74398531 TTAAATCAGCAAGGGCGGGAAGG - Intergenic
1088281580 11:108140150-108140172 GTAAAGCAGCATGGGAAGCTGGG + Exonic
1089002740 11:115065717-115065739 TTAATTCACCATGGGGACCTTGG + Intergenic
1089301375 11:117501134-117501156 TGAAATCAGAATGGGGGAGTGGG + Intronic
1093018848 12:14184513-14184535 TTAAATAAGCGTGGGGAGCATGG - Intergenic
1094180829 12:27590951-27590973 TCCATTCAGCAAGGGGAGGTTGG - Intronic
1094797925 12:33998047-33998069 TTAACTCAGCATAGGCAGGGTGG + Intergenic
1098084588 12:66829014-66829036 TGAATTCATCCTGGGGAGGTGGG - Intergenic
1099160295 12:79233052-79233074 TTAAATCAGCAGGGGCAAGGAGG - Intronic
1100001480 12:89842230-89842252 TTAAATCAGCTTTGGGAAGGGGG - Intergenic
1100194601 12:92230452-92230474 TTAAATCAGCTGGTGGAAGTAGG - Intergenic
1101507657 12:105361847-105361869 TTAAATCAGAAAGCGGTGGTTGG - Intronic
1106400287 13:29423207-29423229 ATAAATCAGCATGGGGCCTTGGG - Intronic
1107661082 13:42640106-42640128 TTACAACAGCATTGAGAGGTGGG - Intergenic
1107962247 13:45568996-45569018 ATAAATCACCATTGGGAGCTTGG - Intronic
1108146551 13:47483507-47483529 TGACAGGAGCATGGGGAGGTTGG + Intergenic
1109941407 13:69371198-69371220 TTGAATCAGCAAGGTGAAGTTGG + Intergenic
1110615768 13:77540461-77540483 ATAACTCAGCCTGGGGAGGAAGG + Intronic
1111103561 13:83616198-83616220 TTAAAGCAGCCTGGGGATGATGG + Intergenic
1111161803 13:84404743-84404765 TTACATTAGCATTGGGAGTTAGG - Intergenic
1112561046 13:100514336-100514358 TTAATTCTGCATGGGGACGGCGG - Intronic
1114263505 14:21056937-21056959 TCAAAGCAGCATGGCGAGTTGGG - Intronic
1115325991 14:32138966-32138988 ATAAATCAGCAGGGGGTGGGGGG - Intronic
1117087308 14:52214808-52214830 TGAATTCAGCATGGGCAAGTGGG - Intergenic
1117786598 14:59292169-59292191 TTAAACCAGAATGGGGTAGTGGG + Intronic
1117987889 14:61406422-61406444 TAAAATCAGGATGGGAATGTTGG + Intronic
1118391719 14:65301408-65301430 TTAAATAATCCTGGGGAAGTAGG + Intergenic
1118620094 14:67607311-67607333 TTAAATCAGAATGGGCAGTGTGG + Intergenic
1119628912 14:76208919-76208941 TTAAATCAGCATGGGGAGGTGGG + Exonic
1119808095 14:77495914-77495936 TTAAAATGTCATGGGGAGGTCGG + Intronic
1119814719 14:77555569-77555591 TTAAATCAAAATTGGGAGTTTGG + Intronic
1120328825 14:83061396-83061418 ATCAGTCAGCAAGGGGAGGTGGG + Intergenic
1121636706 14:95458593-95458615 TTAATTCAGCCTGGGGCAGTGGG - Intronic
1121706644 14:96001362-96001384 TTAAATAAGCATGGTGAGGAGGG - Intergenic
1121928798 14:97953211-97953233 GTAGATCAGCATAGGGAGCTGGG + Intronic
1121957694 14:98229053-98229075 TTGAATCAGCTTTGGGGGGTGGG - Intergenic
1123484431 15:20675217-20675239 TTAAAACAGGACAGGGAGGTTGG - Intergenic
1123537158 15:21244184-21244206 TTAAAACAGGACAGGGAGGTTGG - Intergenic
1123986378 15:25649910-25649932 ATCAATCAGCATGGGGAGTTGGG + Intergenic
1127346817 15:58109348-58109370 AGAAGTCAGCATGGGGATGTAGG + Intronic
1127456714 15:59161788-59161810 TTAAAACTGGATGGGGAGTTTGG - Intronic
1128747073 15:70122270-70122292 TTAGAACAGCCTGGTGAGGTAGG + Intergenic
1128798600 15:70482328-70482350 TTAAAGCATCATGGGAAGGAAGG + Intergenic
1128967019 15:72069798-72069820 TTCAATTAGAATGGGGGGGTGGG + Intronic
1129562456 15:76586168-76586190 TTAAGTTTGCATGGGGTGGTGGG + Intronic
1131495470 15:92906342-92906364 TTAAGTCAGCAGAGGAAGGTGGG + Intronic
1134072598 16:11269956-11269978 TTAGATCTGGCTGGGGAGGTAGG - Intronic
1134156146 16:11844846-11844868 GTGTATCAGCTTGGGGAGGTAGG - Intronic
1134237494 16:12478782-12478804 TTCAATCAGAATGGGGATGGAGG - Intronic
1135473668 16:22754529-22754551 TTAAATTAGCATGGTGTCGTTGG - Intergenic
1136517937 16:30779019-30779041 TTAAAGGAGCTTGGGGAGGTGGG + Exonic
1137031813 16:35531636-35531658 TCACATCAGCATATGGAGGTGGG - Intergenic
1137300196 16:47142621-47142643 TTAAATCAGCAGGGGGAAAAAGG + Intronic
1137662104 16:50216803-50216825 TTAAATAAGCAGGGCGTGGTAGG - Intronic
1139153079 16:64408038-64408060 TGCAATCACCATGTGGAGGTGGG + Intergenic
1139321290 16:66116561-66116583 TTGAAGCAGCATGGGGTGTTTGG - Intergenic
1139379026 16:66518907-66518929 TCAAATCAGCAGTGGGAGTTGGG + Intronic
1141899743 16:86983507-86983529 TCACCTGAGCATGGGGAGGTCGG + Intergenic
1144202772 17:12956218-12956240 TTAAGTCAGCATTGGGATGAGGG + Intronic
1146475148 17:33156823-33156845 TTAAATCAGACTGGGGAGACGGG + Intronic
1146551193 17:33781736-33781758 GGAAATCAGGAAGGGGAGGTGGG - Intronic
1147199926 17:38793784-38793806 TCACCTGAGCATGGGGAGGTAGG + Intronic
1151470398 17:74314312-74314334 TTAAAGCAGCACTGGGTGGTGGG + Intronic
1151652172 17:75476867-75476889 TTGAATGAGCATGGGTAGCTGGG + Intronic
1153248962 18:3101435-3101457 TAAAATGAGCATGGGGAGAATGG - Intronic
1153456423 18:5287569-5287591 TTAAATGAGTATTGGTAGGTGGG + Intergenic
1155940374 18:31796288-31796310 GAAAATCATCATGGTGAGGTGGG + Intergenic
1158841977 18:61397255-61397277 TTCCTTCAGTATGGGGAGGTTGG - Intronic
1162205730 19:9054779-9054801 TGAAACCAGGACGGGGAGGTGGG + Intergenic
926845003 2:17126646-17126668 TTAAACCAGGATAGTGAGGTGGG - Intergenic
927849837 2:26491961-26491983 TTAAAACAACAGAGGGAGGTGGG - Intronic
928387470 2:30882721-30882743 TTTACCCAGCCTGGGGAGGTGGG + Intergenic
931993714 2:67819381-67819403 TTACATCAATATGGGAAGGTTGG - Intergenic
932037631 2:68262956-68262978 TTTTATCAGAATGGGGAAGTTGG + Intergenic
932694805 2:73946618-73946640 TTAAACCTGTTTGGGGAGGTAGG + Intronic
933429792 2:82161534-82161556 TTACATCAGCCTGTGGAGATGGG + Intergenic
934586738 2:95506262-95506284 TTAAATCAGTCTGGGAAGGCAGG + Intergenic
942741991 2:179191636-179191658 TTAAATCAGAATGAAGAGCTAGG - Intronic
943358516 2:186890229-186890251 TCAAAGGAGCATGGAGAGGTAGG - Intergenic
943566700 2:189524755-189524777 TTCAATCAGAATCTGGAGGTGGG - Intergenic
944451088 2:199843430-199843452 AAAATTCAGCATGGGGGGGTGGG - Intronic
948326818 2:237128416-237128438 TTCATTCAGCATGGGGTGGCGGG + Intergenic
1169897897 20:10523660-10523682 TTAAATCAGCACTGGGTGTTTGG - Intronic
1170412469 20:16106320-16106342 TCAGATGAGCATGGGGAGGGAGG + Intergenic
1170809838 20:19665494-19665516 TTAGATCTGCAAGGGGATGTAGG - Intronic
1173125073 20:40328965-40328987 CTGAATCAGAATGGGGAGGAAGG + Intergenic
1173327021 20:42043193-42043215 TCCAATCAGCCTGTGGAGGTAGG + Intergenic
1174623981 20:51899232-51899254 GTAAATTAGCATTGGGAGGATGG + Intergenic
1174655214 20:52166236-52166258 TTAAAATAGCATGGGGGGGCAGG + Intronic
1180828970 22:18887981-18888003 TGAACCCAGGATGGGGAGGTTGG + Intergenic
1181529977 22:23511856-23511878 TTCCAGCAGCATGGGGAGGAAGG + Intergenic
1181865161 22:25848905-25848927 TTAACCCAGCAGGGGGAGATGGG - Intronic
1182369527 22:29801170-29801192 TTAATACAGCAGGGGGAAGTGGG - Intronic
1203279061 22_KI270734v1_random:113969-113991 TGAACCCAGGATGGGGAGGTTGG + Intergenic
949310823 3:2695904-2695926 TGAAATCAGTATAGGGTGGTAGG + Intronic
953671821 3:44969392-44969414 TAAAAGCAGGATGGGGAAGTGGG - Intronic
957722779 3:84025658-84025680 TGAAATTGGCATGGGGAGGCAGG - Intergenic
960671228 3:120157032-120157054 ATAAATCAGCATAAGGAGATGGG - Intergenic
962436761 3:135374038-135374060 TTCAATCAGCTTGGTGAGGAAGG - Intergenic
966826758 3:183971506-183971528 GCAGATCAGCATGGGGTGGTGGG + Intronic
967047780 3:185753646-185753668 GGAAATCAGAAGGGGGAGGTGGG - Intronic
967060392 3:185867169-185867191 GAAAGTCAGCATGGGGAGGAGGG + Intergenic
971775832 4:30963391-30963413 TTAAATAATCATGGAGAGCTTGG - Intronic
972892196 4:43571808-43571830 TCAAAACTGCATGGAGAGGTTGG - Intergenic
976221524 4:82760248-82760270 TCAAATCAGCAAGGGAGGGTAGG - Intronic
977738773 4:100451365-100451387 TTGAATCAGCATTTAGAGGTAGG + Intronic
979245775 4:118502575-118502597 TGAAATCAGAATGGTGAGGATGG - Intergenic
979429637 4:120613067-120613089 TTAAATAAGGGTGGGGAGGCTGG + Intergenic
979623860 4:122825706-122825728 ATAACTCAGCGTGGGGAGGCAGG - Intergenic
980920688 4:139083421-139083443 TTAAATGAGCAAAGGGAGGCGGG + Intronic
981447355 4:144855345-144855367 TTAAATCAGTAGTAGGAGGTGGG + Intergenic
982375357 4:154684489-154684511 TTAATTCAGAAAGTGGAGGTTGG + Intronic
1202764841 4_GL000008v2_random:141091-141113 TTTAATCACAAAGGGGAGGTTGG - Intergenic
986074083 5:4316506-4316528 TTAAATCAGAATCAGGAGGTGGG - Intergenic
986723258 5:10575681-10575703 TTAAATCAGCAAGGGTAAGTCGG - Intronic
990498307 5:56370368-56370390 TGAGATCAGCATGGAGAGGATGG - Intergenic
991049923 5:62261888-62261910 TGAAATCTGCATGTGGAGGACGG - Intergenic
991480815 5:67077292-67077314 TTAAATCAGAATGGGGAGGGAGG - Intronic
991645390 5:68795830-68795852 TTGCATCAAAATGGGGAGGTGGG - Intergenic
993041574 5:82820682-82820704 TTACATAAGCATGGGGACTTTGG - Intergenic
996549911 5:124719513-124719535 CAAAATCAGCATGGGGTGGTGGG + Intronic
997576842 5:134985427-134985449 TGAACTCAGAAGGGGGAGGTTGG + Intronic
998954614 5:147426368-147426390 TTAAATCAGGTTGGGGAGGTAGG + Intronic
1001404929 5:171469515-171469537 TTGACTCAGCCTGGGGAGGAAGG - Intergenic
1001747588 5:174103648-174103670 TTAAATCAGAAAGGAGTGGTCGG + Intronic
1004201322 6:13550681-13550703 TTAAATCAGAATTTGGAGATGGG + Intergenic
1004527940 6:16426786-16426808 TTAAAGCAGCAAGGGGATGCTGG - Intronic
1006020296 6:31113920-31113942 TTAAGCCAGCAGGGGCAGGTGGG - Intergenic
1006055550 6:31381883-31381905 CTAATTCAGCATGGGGAAGGGGG + Intergenic
1007492139 6:42231490-42231512 TTACATCAGCAAGGCTAGGTGGG - Intronic
1007750312 6:44067187-44067209 TTAAATCACCATGGGTAGCTGGG + Intergenic
1009493663 6:64324274-64324296 TTAATTCACCATGATGAGGTAGG + Intronic
1013521264 6:110935907-110935929 TAGAATCAGAATGGGGAGGGAGG - Intergenic
1017183620 6:151577996-151578018 TGAGATCAGAATGGGGAGGAGGG - Intronic
1017429863 6:154360524-154360546 TTAATTCAGCATGGCTAGGGAGG + Intronic
1018616032 6:165687851-165687873 TTCAAACAGCCTGGTGAGGTGGG + Intronic
1018887958 6:167957204-167957226 ACAAAGCAGCATGGGCAGGTGGG - Intronic
1020219727 7:6226424-6226446 TTAGATGAGGGTGGGGAGGTGGG + Intronic
1021570722 7:22062398-22062420 TTCAACCAGCAAGGGGAGGAAGG + Intergenic
1022258847 7:28685034-28685056 GAAAAACAGCCTGGGGAGGTGGG - Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1024758877 7:52569765-52569787 TTCAATAAGCATTGTGAGGTTGG + Intergenic
1026127777 7:67594647-67594669 TGAAATCAGCCTGGGGAGCATGG + Intergenic
1028857707 7:95610570-95610592 ATAAATCAGCATAGTGAAGTTGG - Intergenic
1030664537 7:112260744-112260766 TGAAATCAGGAGTGGGAGGTGGG + Intronic
1030850417 7:114477842-114477864 TTAAATAGGAATGGGCAGGTAGG + Intronic
1031690145 7:124777959-124777981 TTTAATGAGGATGGGGAGGCAGG + Intronic
1033973085 7:147067370-147067392 ATAAAACAGCATTTGGAGGTGGG - Intronic
1034397122 7:150835768-150835790 CTAAATCAGAATCCGGAGGTGGG + Intronic
1039380316 8:37078963-37078985 TTATTTCAGCATTGGGAAGTTGG - Intergenic
1040853677 8:51927098-51927120 TCAAATCAGCAAAGGGAGGATGG - Intergenic
1042248035 8:66727527-66727549 ATACAACAGCATTGGGAGGTGGG + Intronic
1042302703 8:67302935-67302957 TTAAATCAGCTTGGGCATGGTGG + Intronic
1042391509 8:68240839-68240861 TGAACCCAGGATGGGGAGGTTGG + Intergenic
1046844510 8:118900893-118900915 ATGAATCAGCCTGGGGAGGAAGG + Intergenic
1047372567 8:124268026-124268048 TTAAGTAAGCTTGGGGAGCTGGG - Intergenic
1047726300 8:127686921-127686943 TTTAATCAGGATGGGGAAGTCGG + Intergenic
1048253076 8:132883298-132883320 CTAAAGGAGCATGGTGAGGTGGG + Intronic
1050585359 9:7105378-7105400 TGAAAACAACATGGTGAGGTGGG - Intergenic
1051094359 9:13448866-13448888 TTAAATAAGCATGGCGTGTTTGG + Intergenic
1053266741 9:36720678-36720700 TTAAAACAGGATGGAGAGGCGGG + Intergenic
1053545451 9:39018629-39018651 TGAATACAGCATGGGCAGGTGGG + Intergenic
1053809782 9:41840327-41840349 TGAATACAGCATGGGCAGGTGGG + Intergenic
1054620811 9:67347101-67347123 TGAATACAGCATGGGCAGGTGGG - Intergenic
1055737753 9:79350545-79350567 TTAAACAAGCTTGGGGAGGAAGG - Intergenic
1055816111 9:80209071-80209093 CTAAATCAGAATCTGGAGGTAGG + Intergenic
1055950964 9:81729302-81729324 TTAAGTCAACATTAGGAGGTGGG - Intergenic
1056145272 9:83722706-83722728 TTAAATCAGGCTGGGGTAGTGGG + Intergenic
1056662158 9:88551977-88551999 ATCACTCAGCATGTGGAGGTGGG + Intronic
1059350268 9:113659395-113659417 CTAAGACAGCATGGGCAGGTGGG + Intergenic
1059916469 9:119108219-119108241 TTTAATAAGAATGGTGAGGTGGG - Intergenic
1060385640 9:123225525-123225547 TTGAATCACCATCTGGAGGTAGG - Intronic
1060398709 9:123334634-123334656 TCAAACTAGCCTGGGGAGGTGGG + Intergenic
1061159967 9:128888066-128888088 TTACAGCAGCAGAGGGAGGTCGG + Intronic
1186050811 X:5592969-5592991 TTAATTCAGTCTGGGAAGGTGGG - Intergenic
1186706642 X:12146678-12146700 TTAACCCAGGATTGGGAGGTTGG - Intronic
1186726826 X:12366768-12366790 ATAAATCTGCATGGGGCTGTGGG + Intronic
1186984445 X:14996823-14996845 TTGCATCAGCATGGGCAGGTTGG - Intergenic
1187699984 X:21955926-21955948 TTAAATCAGAAGGGTGAGGATGG + Intronic
1190733199 X:53238019-53238041 TGAAATGAGGATGGGAAGGTTGG + Intronic
1190795535 X:53737730-53737752 TGAAATCACCATGAGGAGGGAGG + Intergenic
1192456996 X:71284120-71284142 TTAATTCAGAATGGGCAAGTGGG + Intronic
1193786447 X:85765490-85765512 TTAAATCAGCTTTGGGAGTAAGG - Intergenic
1200831637 Y:7691962-7691984 TTAAGTCAGGCTGGGGAGCTTGG + Intergenic