ID: 1119632703

View in Genome Browser
Species Human (GRCh38)
Location 14:76247733-76247755
Sequence AAGGAGGTCTTCAGACACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119632699_1119632703 25 Left 1119632699 14:76247685-76247707 CCACTTGAAGGTTTGCTGTCCTG 0: 1
1: 0
2: 0
3: 14
4: 151
Right 1119632703 14:76247733-76247755 AAGGAGGTCTTCAGACACCCAGG 0: 1
1: 0
2: 1
3: 19
4: 165
1119632700_1119632703 6 Left 1119632700 14:76247704-76247726 CCTGCAAGTCTTACGTATTTCTC 0: 1
1: 0
2: 0
3: 14
4: 249
Right 1119632703 14:76247733-76247755 AAGGAGGTCTTCAGACACCCAGG 0: 1
1: 0
2: 1
3: 19
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119632703 Original CRISPR AAGGAGGTCTTCAGACACCC AGG Intronic
901448312 1:9321289-9321311 AAGGAGTTCTTCCTTCACCCTGG - Intronic
901960844 1:12825486-12825508 AACGAGGTCTTCAGACAGCTGGG + Exonic
901967439 1:12880088-12880110 AACGAGGTCTTCAGACAGCTGGG + Exonic
901972611 1:12919847-12919869 AAGGAGGCCTGGAGACACCTGGG - Exonic
901975238 1:12939219-12939241 AACGAGGTCTTCAGACAGCTGGG + Exonic
901982840 1:13050352-13050374 AACGAGGTCTTCAGACAGCTGGG + Intronic
901986181 1:13076986-13077008 AACGAGGTCTTCAGACAGCTGGG - Exonic
901999249 1:13178566-13178588 AACGAGGTCTTCAGACAGCTGGG - Intergenic
902009937 1:13262545-13262567 AACGAGGTCTTCAGACAGCTGGG - Exonic
902012570 1:13281915-13281937 AAGGAGGCCTGGAGACACCTGGG + Exonic
902017734 1:13321698-13321720 AACGAGGTCTTCAGACAGCTGGG - Exonic
902030795 1:13420692-13420714 AACGAGGTCTTTAGACAGCTGGG - Exonic
902341416 1:15785837-15785859 AGGGTGGTCCGCAGACACCCCGG + Intronic
903376800 1:22871478-22871500 AATGAGGTCTTCTCACATCCTGG - Intronic
903386999 1:22933416-22933438 AAGGAGCCCTTCAGAAAACCTGG - Intergenic
903708006 1:25301192-25301214 TGGAAGGGCTTCAGACACCCAGG - Intronic
903719197 1:25391873-25391895 TGGAAGGGCTTCAGACACCCAGG + Intronic
907544735 1:55249893-55249915 AAGCAGGTCTTCGGACTCACAGG - Intergenic
910159933 1:84261903-84261925 AAGCAGGTATTTATACACCCAGG + Intergenic
910832318 1:91473437-91473459 AAGGGAGTCTGCAGAAACCCTGG + Intergenic
911471848 1:98328793-98328815 AAGGAGGTCTTGAGACAAGAAGG - Intergenic
911755302 1:101547271-101547293 ATGCATGTCTTCAGGCACCCTGG + Intergenic
913386474 1:118263223-118263245 AGGGAGGTCTCCAGACACCTGGG + Intergenic
920349672 1:205329555-205329577 AAGGAGGTCACCTGCCACCCAGG + Intergenic
922082789 1:222313851-222313873 AGGGAGGTTTTCAGACTTCCAGG + Intergenic
924705773 1:246500743-246500765 AAGTTGTTCTTCAGACAGCCTGG - Intronic
1063117144 10:3079639-3079661 AACGAGGTCTTCAGAGAGCGGGG + Intronic
1069115386 10:64498841-64498863 TAGGAAGTCTGCAGACACCAAGG - Intergenic
1070625712 10:78049669-78049691 AAGGAGGTCTTCACCCACAGTGG + Intronic
1071048271 10:81412094-81412116 AAGGAGGACTTGAGGCACCATGG + Intergenic
1071783829 10:88877563-88877585 AAGCAGGTCTTCATACCCACAGG - Intergenic
1071816374 10:89235727-89235749 AAGGAGGTGGTCAGACACCAGGG + Intronic
1072007522 10:91267797-91267819 TAAGAGCTCTTCAGACATCCTGG - Intronic
1074676001 10:115851922-115851944 AAGCATGTCTCCAGTCACCCCGG + Intronic
1075575517 10:123574436-123574458 CAGGAGGTCATCAGACCCCAGGG + Intergenic
1076166262 10:128285053-128285075 AAGGAGACCTTCAGAAACACTGG - Intergenic
1076402608 10:130193733-130193755 GAGGAGGTCCTGAGACAGCCGGG - Intergenic
1079022980 11:16924381-16924403 AAGGAGGTTTTCAGGCACCATGG + Intronic
1080698541 11:34624239-34624261 AATGTGGTCTCTAGACACCCAGG - Intronic
1080702188 11:34653275-34653297 TAGTAGGTCTTGAGGCACCCGGG + Intronic
1081861360 11:46334868-46334890 AACCAGGTCTTCTGACTCCCAGG - Intronic
1086266848 11:85009921-85009943 AAGGATGTCTTCAGGAACCATGG - Intronic
1086332260 11:85765814-85765836 AATGAGCTTTTCAGAAACCCAGG - Intronic
1087291444 11:96325064-96325086 AATGAGGATGTCAGACACCCAGG - Intronic
1088037944 11:105340712-105340734 AAGAAGATCTTCAGAAAGCCAGG - Intergenic
1089541794 11:119193657-119193679 AAGGAGGGCTTCCGACTGCCAGG - Intronic
1089843111 11:121435967-121435989 AAGCAGGGCTTTAGAAACCCTGG + Intergenic
1090082127 11:123620697-123620719 AGGGTGGCCTTCAGACACCCAGG + Intronic
1091872056 12:3900727-3900749 AAGGATGTCATCAAACACTCAGG - Intergenic
1097337782 12:58403744-58403766 ATGGGGGTATTCAGACACCATGG + Intergenic
1100813281 12:98361607-98361629 ACAGAGTTCTTCATACACCCTGG + Intergenic
1101993607 12:109508093-109508115 AAGCAGATCTTGAGACACCCTGG + Intronic
1104540797 12:129662969-129662991 AAGGAAGTCTTCAGAGACCCAGG + Intronic
1106229723 13:27812486-27812508 AAGATGCTCTTAAGACACCCAGG + Intergenic
1108642710 13:52397405-52397427 AAGGAGGCCCCCAGATACCCTGG - Exonic
1110912588 13:80982292-80982314 AAGGGGGACATCACACACCCGGG - Intergenic
1111967626 13:94877045-94877067 AAGGGGTTCGTCACACACCCGGG + Intergenic
1112178997 13:97058173-97058195 AAGGATTTCTTCAGGCATCCAGG - Intergenic
1114315530 14:21506593-21506615 AAAGAGATATTCATACACCCAGG + Intronic
1115059157 14:29169148-29169170 AATGAGGTATGCAGACAACCTGG - Intergenic
1119632703 14:76247733-76247755 AAGGAGGTCTTCAGACACCCAGG + Intronic
1121463503 14:94099720-94099742 TGGGAGTTCTTCAGTCACCCTGG - Intronic
1122428023 14:101622974-101622996 AGGGAGGGCTTCAGGCAGCCTGG + Intergenic
1123176509 14:106423978-106424000 CAGGAGGACTCCATACACCCTGG - Intergenic
1202947169 14_KI270726v1_random:39589-39611 CAGGAGGACTCCATACACCCTGG + Intergenic
1123507771 15:20961997-20962019 AAGGGGGACTTCACACACTCGGG + Intergenic
1123601253 15:21973028-21973050 AAGGGGGACTTCACACACTCGGG + Intergenic
1125986326 15:44056708-44056730 AAGGATGACTTCAGAAACCTAGG + Intronic
1126447338 15:48763303-48763325 TAGGAGAACTTCAGATACCCAGG - Intronic
1128593606 15:68925064-68925086 GAGAAGGACTTCAGCCACCCGGG - Intronic
1128745534 15:70111686-70111708 AAACAGGTCTTCAGGCTCCCAGG + Intergenic
1129119468 15:73387196-73387218 AAGGTGGTCTACAGAGCCCCAGG - Intergenic
1131813729 15:96201209-96201231 AAGGAGGCCAGAAGACACCCCGG - Intergenic
1202973361 15_KI270727v1_random:262847-262869 AAGGGGGACTTCACACACTCGGG + Intergenic
1134199831 16:12188812-12188834 AAGGAGGAATGCAGACATCCTGG + Intronic
1138291223 16:55848693-55848715 TAGGAGCTCTTCAGACATCAAGG + Intronic
1139319394 16:66101286-66101308 GAACAGGTCTTCAGGCACCCTGG - Intergenic
1139693449 16:68656253-68656275 AGGGAAGACTTCAGAGACCCTGG - Intronic
1141272566 16:82554586-82554608 AAGGAGGCCATCAGACACATAGG + Intergenic
1142007268 16:87695456-87695478 AAGGAGCTGTTCAGAGCCCCCGG - Intronic
1142143369 16:88482547-88482569 CAGGTGGGCCTCAGACACCCAGG - Intronic
1148428014 17:47616909-47616931 GATGAGGTCTCCAGACACTCTGG + Intronic
1152982874 18:295461-295483 AGGGAGGCCTCCAGACAGCCTGG - Intergenic
1155672550 18:28388916-28388938 AAGGAGCTCTTCCAAAACCCAGG + Intergenic
1159483401 18:69021425-69021447 AATGAGATCATCACACACCCAGG + Intronic
1160499431 18:79394830-79394852 CAGGAGGTCCGCAGACCCCCAGG - Intergenic
1160809681 19:1008000-1008022 CAGGAGGTCCCCAGAGACCCCGG - Intronic
1161435749 19:4261890-4261912 GAAGAGGTCTCCAGGCACCCAGG + Intronic
1162962368 19:14135895-14135917 ACGGAGATCTTCAGCCACCGTGG - Intronic
1163297433 19:16421349-16421371 AAGGAGATCTTCATGCACTCGGG - Exonic
1166329730 19:42070867-42070889 AGGGAGGCCTACAGACACCAGGG + Exonic
1168691091 19:58378057-58378079 CAGGAGCTCTTCAGTCAGCCTGG - Intronic
925696508 2:6585748-6585770 AAGGAGGACTTCATTCATCCTGG + Intergenic
926090900 2:10048532-10048554 AAGTAGGTCTTCCGGCAACCTGG - Exonic
927222203 2:20723336-20723358 AAGGGGGTCTTCTGAGACTCGGG + Intronic
927342082 2:21993742-21993764 AAGGAGGTTAGGAGACACCCAGG - Intergenic
927476895 2:23420463-23420485 ATGGAGGACTCCAGACAGCCCGG - Intronic
927685506 2:25168172-25168194 TAGGAGGTCTTGGGACAACCCGG - Intronic
933179190 2:79210892-79210914 AGGGAGGGCTTCAGAGACACTGG - Intronic
935935206 2:108174960-108174982 ACAGAGCTCTTCAGAGACCCTGG - Intergenic
935963515 2:108449592-108449614 AAAGAGTTCTTCTGACACCTGGG + Intronic
936293279 2:111245476-111245498 AAAGAGTTCTTCATAAACCCAGG - Intergenic
936316677 2:111430114-111430136 AATGAGGTCCTGAGACTCCCCGG + Intergenic
938457022 2:131473280-131473302 ACGGAGTTCTGCAGACAGCCGGG - Intronic
938739660 2:134219174-134219196 AAGGAGGAGCTCAGTCACCCAGG + Intronic
939555678 2:143670038-143670060 AAGGCAGACTTCAGACACCAGGG + Intronic
943937770 2:193944637-193944659 AAAGAGGCCTTCAGACAGCATGG + Intergenic
945179098 2:207073820-207073842 AGGCAGGTCTTCAGACTCCAGGG + Intergenic
946050355 2:216857052-216857074 AATGAGGTCTTCAGACCCTTAGG - Intergenic
1172839086 20:37891221-37891243 ACAGGGGTCTTCAGAGACCCAGG - Intergenic
1174993201 20:55536089-55536111 AAGGAGGATTTCACACACACAGG - Intergenic
1181575590 22:23792462-23792484 AGGGTGCTCTTCAGACACTCTGG + Intronic
1183063650 22:35349796-35349818 AAGGAGGCCTTCAGGCAGCCTGG - Intergenic
1183212150 22:36457796-36457818 AGGGGGTTCTTCAGAAACCCTGG - Intergenic
1183987047 22:41575662-41575684 AAGGAGGTCTGCAGCCAAGCTGG - Exonic
1184313041 22:43660824-43660846 CAGCATGTCATCAGACACCCTGG - Intronic
1185140924 22:49100825-49100847 GCGGAGGCCTTCAGACACCGGGG - Intergenic
954326541 3:49867190-49867212 AGGGAGGTCTTCAGCTCCCCTGG - Intronic
956640165 3:71407947-71407969 AAGGAGGTCTTAAATCACCAGGG - Intronic
959595197 3:108122065-108122087 AAGGAGCTTTCCAGAGACCCTGG - Intergenic
961259535 3:125589939-125589961 AAGCAGGCCATCAAACACCCTGG + Intronic
962168644 3:133077436-133077458 AGGGTGCTCTGCAGACACCCAGG - Intronic
962625469 3:137221569-137221591 AGTGAGGTCTTCAGACTTCCAGG + Intergenic
962683591 3:137824720-137824742 AAGTATGTCTTCAGAAAACCAGG + Intergenic
962857877 3:139365680-139365702 AAGGAGATCTTCAGGAACTCTGG + Intronic
967965756 3:194959061-194959083 CAGGAGTTCCTCAGAAACCCAGG + Intergenic
968520346 4:1032211-1032233 ATGAAGGTCTTCCGACACCCAGG - Intergenic
968630233 4:1646759-1646781 GAGGAGTTCTTCAGACAGGCAGG - Intronic
969250824 4:5967598-5967620 AGGGAGGTCTTCATGCACACAGG - Intronic
970545994 4:17130984-17131006 AATGAGCTCTTCAGGCATCCCGG - Intergenic
971658446 4:29380487-29380509 AAGGAGCTCTACAAACACCTTGG + Intergenic
971725252 4:30303632-30303654 ATGGAGGTCCTCTGTCACCCAGG - Intergenic
972057525 4:34823242-34823264 AAGGTGGTCTTCTGGAACCCAGG - Intergenic
973538306 4:51907098-51907120 AATGACGTCTGCAGACACCTAGG - Intronic
973785479 4:54328718-54328740 ATGGAGCTCATCAAACACCCTGG + Intergenic
974142324 4:57902881-57902903 AAGGAGGTCATCTGCCAACCAGG + Intergenic
976584298 4:86777883-86777905 AGGGAAGTCTTCAAACAACCTGG + Intronic
977325070 4:95564614-95564636 AAGGAGACCATCAGAGACCCAGG - Intergenic
981310387 4:143292591-143292613 AAGGAGGGCATTGGACACCCAGG + Intergenic
981747653 4:148067016-148067038 GAGGAGCTCCTGAGACACCCGGG - Intronic
984952076 4:185015517-185015539 ATGGGGGCCTTCAGGCACCCAGG - Intergenic
985868488 5:2535202-2535224 AATGTGGGCTTCAGAGACCCAGG + Intergenic
986706784 5:10459502-10459524 ACGGAGGTCTTTACAGACCCAGG - Intronic
990516533 5:56535709-56535731 AAGCAGGTCTGCAGAGACCCAGG + Intronic
995497865 5:112767582-112767604 AAATAGGTCTTCAGAATCCCAGG - Intronic
995546136 5:113233504-113233526 AATGAGGGCTTAAGATACCCAGG - Intronic
996972630 5:129390632-129390654 ACGGGGGTCTTCTGTCACCCAGG - Intergenic
998652503 5:144136655-144136677 AAGCAGGTCATCAGACACATGGG - Intergenic
1001122817 5:168994105-168994127 AAGGGTGTCTGCAGACAGCCTGG - Intronic
1004094153 6:12536089-12536111 AAGGAGTTCTCCAGAGACCAAGG + Intergenic
1007026546 6:38581533-38581555 ACGGAGGACTTCAGAGTCCCAGG - Intronic
1008875366 6:56320017-56320039 AAGTAGGTGGTTAGACACCCAGG - Intronic
1018795727 6:167184148-167184170 AAGGGGAACATCAGACACCCGGG - Intronic
1018820589 6:167370911-167370933 AAGGGGAACATCAGACACCCAGG + Intronic
1018960335 6:168442875-168442897 AAGGAGGTTTTCACACACTCAGG + Intronic
1019369448 7:653289-653311 AACGAGGCCTTCAAAGACCCAGG + Intronic
1019384402 7:746486-746508 AAGGAGGGCGTCACAAACCCTGG - Intronic
1019738239 7:2660760-2660782 CAGGAGGGCTTCAGAACCCCAGG - Intronic
1020984860 7:15120585-15120607 AAGAAGGTCTTCAGCAAACCAGG + Intergenic
1021608584 7:22433986-22434008 AAGGATGTGTCCAGCCACCCAGG + Intronic
1023581598 7:41690019-41690041 AGGGTGGTCTTCAGACTGCCGGG + Exonic
1030673025 7:112357613-112357635 AGGGTGGAGTTCAGACACCCAGG + Intergenic
1031927014 7:127648501-127648523 AAGGAGGTCATCAGTGACCTTGG + Intergenic
1032784870 7:135193155-135193177 AAGAGGCTCTTCAGAAACCCAGG + Intronic
1034413322 7:150952522-150952544 GAGGAGGTGGTCAGCCACCCCGG - Exonic
1035425245 7:158766866-158766888 AAGGAGCTTTTCAGTCACTCAGG - Intronic
1039489279 8:37935642-37935664 CAGCAGGTCTGCAGGCACCCAGG + Intronic
1042020933 8:64370885-64370907 AATAAGGTCATCAGCCACCCTGG - Intergenic
1049332173 8:142060420-142060442 AAGGAGAACTTCTCACACCCAGG + Intergenic
1053388135 9:37711541-37711563 GAGGAGGTCTTCAGATAACATGG - Intronic
1054934188 9:70669180-70669202 ATCCAGGTCTTCAGACACCCAGG - Intronic
1055084072 9:72296208-72296230 GATGAGGTCTTCAGAGGCCCTGG + Intergenic
1057305781 9:93911214-93911236 CAGGAGGCCTTGAGACACTCCGG - Intergenic
1058250663 9:102691844-102691866 AAGGAGGTCTGAAGAAAGCCTGG - Intergenic
1058903618 9:109462665-109462687 AACGAGGTCTCCAGTCTCCCAGG - Intronic
1059544471 9:115162404-115162426 TGTGAGGTCTTCAGACACCTTGG + Intronic
1060540574 9:124427437-124427459 AAGGAAGTCTGCAGGCACCAAGG + Intergenic
1060720390 9:125972643-125972665 ACCCAGGTCTTCTGACACCCTGG + Intergenic
1061277146 9:129575764-129575786 AAGCTGGTCTTCAGACCCTCAGG + Intergenic
1062069773 9:134549430-134549452 AAGAAGGTGTTCTGGCACCCTGG - Intergenic
1187613830 X:20971918-20971940 AAGGAGCCCAGCAGACACCCTGG - Intergenic
1190326369 X:49209478-49209500 AAGGAGTCCTTCAGCCACCCTGG + Intronic
1192237543 X:69305645-69305667 AAGCAGCTCTTCAGAGCCCCAGG - Intergenic
1196455709 X:115890111-115890133 AAGGAGATGTTCAAACTCCCAGG - Intergenic
1196843593 X:119880827-119880849 CAGGAGGAATTCCGACACCCAGG - Intergenic
1198609570 X:138382989-138383011 AAACAGGTCTTCAGACAGCATGG + Intergenic