ID: 1119640121

View in Genome Browser
Species Human (GRCh38)
Location 14:76308602-76308624
Sequence CCCCCTTGAAGCTGGCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119640121_1119640129 3 Left 1119640121 14:76308602-76308624 CCCCCAGGCCAGCTTCAAGGGGG No data
Right 1119640129 14:76308628-76308650 ACACCAAGGCTTGGTTCAGTTGG No data
1119640121_1119640128 -6 Left 1119640121 14:76308602-76308624 CCCCCAGGCCAGCTTCAAGGGGG No data
Right 1119640128 14:76308619-76308641 AGGGGGCAGACACCAAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119640121 Original CRISPR CCCCCTTGAAGCTGGCCTGG GGG (reversed) Intergenic
No off target data available for this crispr