ID: 1119640128

View in Genome Browser
Species Human (GRCh38)
Location 14:76308619-76308641
Sequence AGGGGGCAGACACCAAGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119640113_1119640128 11 Left 1119640113 14:76308585-76308607 CCAGCAGACCCCTGCTGCCCCCA No data
Right 1119640128 14:76308619-76308641 AGGGGGCAGACACCAAGGCTTGG No data
1119640123_1119640128 -7 Left 1119640123 14:76308603-76308625 CCCCAGGCCAGCTTCAAGGGGGC No data
Right 1119640128 14:76308619-76308641 AGGGGGCAGACACCAAGGCTTGG No data
1119640125_1119640128 -9 Left 1119640125 14:76308605-76308627 CCAGGCCAGCTTCAAGGGGGCAG No data
Right 1119640128 14:76308619-76308641 AGGGGGCAGACACCAAGGCTTGG No data
1119640112_1119640128 12 Left 1119640112 14:76308584-76308606 CCCAGCAGACCCCTGCTGCCCCC No data
Right 1119640128 14:76308619-76308641 AGGGGGCAGACACCAAGGCTTGG No data
1119640124_1119640128 -8 Left 1119640124 14:76308604-76308626 CCCAGGCCAGCTTCAAGGGGGCA No data
Right 1119640128 14:76308619-76308641 AGGGGGCAGACACCAAGGCTTGG No data
1119640117_1119640128 1 Left 1119640117 14:76308595-76308617 CCTGCTGCCCCCAGGCCAGCTTC No data
Right 1119640128 14:76308619-76308641 AGGGGGCAGACACCAAGGCTTGG No data
1119640115_1119640128 3 Left 1119640115 14:76308593-76308615 CCCCTGCTGCCCCCAGGCCAGCT No data
Right 1119640128 14:76308619-76308641 AGGGGGCAGACACCAAGGCTTGG No data
1119640121_1119640128 -6 Left 1119640121 14:76308602-76308624 CCCCCAGGCCAGCTTCAAGGGGG No data
Right 1119640128 14:76308619-76308641 AGGGGGCAGACACCAAGGCTTGG No data
1119640116_1119640128 2 Left 1119640116 14:76308594-76308616 CCCTGCTGCCCCCAGGCCAGCTT No data
Right 1119640128 14:76308619-76308641 AGGGGGCAGACACCAAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119640128 Original CRISPR AGGGGGCAGACACCAAGGCT TGG Intergenic
No off target data available for this crispr