ID: 1119643811

View in Genome Browser
Species Human (GRCh38)
Location 14:76334450-76334472
Sequence CCTCGCGCTCACAGCCGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 108}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119643805_1119643811 20 Left 1119643805 14:76334407-76334429 CCTCCGTCTTCCTCATCTTGCTC 0: 1
1: 0
2: 2
3: 39
4: 717
Right 1119643811 14:76334450-76334472 CCTCGCGCTCACAGCCGCCTGGG 0: 1
1: 0
2: 1
3: 3
4: 108
1119643806_1119643811 17 Left 1119643806 14:76334410-76334432 CCGTCTTCCTCATCTTGCTCTGA 0: 1
1: 1
2: 1
3: 55
4: 624
Right 1119643811 14:76334450-76334472 CCTCGCGCTCACAGCCGCCTGGG 0: 1
1: 0
2: 1
3: 3
4: 108
1119643804_1119643811 21 Left 1119643804 14:76334406-76334428 CCCTCCGTCTTCCTCATCTTGCT 0: 1
1: 0
2: 1
3: 67
4: 515
Right 1119643811 14:76334450-76334472 CCTCGCGCTCACAGCCGCCTGGG 0: 1
1: 0
2: 1
3: 3
4: 108
1119643802_1119643811 30 Left 1119643802 14:76334397-76334419 CCAGTGTACCCCTCCGTCTTCCT 0: 1
1: 0
2: 1
3: 14
4: 202
Right 1119643811 14:76334450-76334472 CCTCGCGCTCACAGCCGCCTGGG 0: 1
1: 0
2: 1
3: 3
4: 108
1119643808_1119643811 -8 Left 1119643808 14:76334435-76334457 CCAAAACTGTTGCAGCCTCGCGC 0: 1
1: 0
2: 0
3: 5
4: 39
Right 1119643811 14:76334450-76334472 CCTCGCGCTCACAGCCGCCTGGG 0: 1
1: 0
2: 1
3: 3
4: 108
1119643803_1119643811 22 Left 1119643803 14:76334405-76334427 CCCCTCCGTCTTCCTCATCTTGC 0: 1
1: 0
2: 3
3: 57
4: 625
Right 1119643811 14:76334450-76334472 CCTCGCGCTCACAGCCGCCTGGG 0: 1
1: 0
2: 1
3: 3
4: 108
1119643807_1119643811 10 Left 1119643807 14:76334417-76334439 CCTCATCTTGCTCTGACTCCAAA 0: 1
1: 0
2: 1
3: 28
4: 298
Right 1119643811 14:76334450-76334472 CCTCGCGCTCACAGCCGCCTGGG 0: 1
1: 0
2: 1
3: 3
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119643811 Original CRISPR CCTCGCGCTCACAGCCGCCT GGG Intronic
900165489 1:1242806-1242828 CCTCCCGCTCACACCCGGCCCGG + Intronic
900523944 1:3119426-3119448 CCTGGCCTCCACAGCCGCCTGGG + Intronic
901676967 1:10890969-10890991 CCTCTTGCTCACAGCCTCTTTGG - Intergenic
904891025 1:33779713-33779735 TCTCTCGCTCCCAGCCCCCTTGG + Intronic
907340432 1:53731469-53731491 CCTCTCCTTCCCAGCCGCCTGGG + Intronic
911853875 1:102853633-102853655 CCTCGCTCTCAGCGCCTCCTCGG + Intergenic
912717105 1:111990340-111990362 ACACGCGCTCACACCCGCGTCGG - Intergenic
915299541 1:154944257-154944279 CCTTTTGCTCACAGCTGCCTTGG - Exonic
1066446894 10:35491845-35491867 CCTCGTGATCCCACCCGCCTCGG + Intronic
1067716461 10:48694516-48694538 CCAGGAGCTCACAGCCTCCTGGG - Intronic
1069076310 10:64041801-64041823 CCTCGTGCTCTGGGCCGCCTCGG - Intergenic
1072664852 10:97385369-97385391 CCTAGCACTCACAGCCCCCTTGG + Intronic
1075941091 10:126390637-126390659 CCTGGTGCTCACAACCACCTGGG - Intergenic
1077107299 11:847810-847832 CTTCGCCCTCCCACCCGCCTGGG + Intronic
1077434237 11:2531103-2531125 CTTCGCCCTCCCAGCTGCCTGGG - Intronic
1077436311 11:2540851-2540873 CCACCAGCTCACAGCCGCCCAGG - Intronic
1077492821 11:2870006-2870028 CCGCGCGCTCCCTCCCGCCTGGG + Intergenic
1084636851 11:70398604-70398626 GCGCTCGCTCACCGCCGCCTGGG - Exonic
1085508468 11:77073422-77073444 CCTCCTGCTCACAGCACCCTGGG + Intronic
1089214818 11:116829216-116829238 CCTCGGGCTCTGAGCGGCCTTGG + Intergenic
1091124752 11:133083780-133083802 CCTCGCGCTCACAGCCCATGTGG - Intronic
1095203734 12:39415488-39415510 CCTCGGCCTCCCAGCAGCCTCGG + Intronic
1096195764 12:49647923-49647945 CCTCCAGCTCACAGGGGCCTGGG - Intronic
1105851235 13:24338752-24338774 CCTCGCTCTCAGCGCCTCCTCGG + Intergenic
1105964604 13:25372626-25372648 CATCGCGGTGACTGCCGCCTAGG - Intronic
1106526476 13:30545152-30545174 CCTCGCTCTCAAATCCGACTAGG - Intronic
1111125267 13:83906620-83906642 CCCCGTCCTCACAGCAGCCTCGG - Intergenic
1113417356 13:110138552-110138574 CCGCGCGCACACAGCCGGCCAGG + Intergenic
1119643811 14:76334450-76334472 CCTCGCGCTCACAGCCGCCTGGG + Intronic
1119650091 14:76377133-76377155 CCGCGAGCGCAAAGCCGCCTCGG - Intronic
1122293655 14:100693120-100693142 CCTTGCGCTCGCTGGCGCCTGGG + Intergenic
1122688675 14:103521631-103521653 CCCCGCGCCCACAGCGGCCTGGG - Intronic
1123063476 14:105604976-105604998 CCTCTCCCTCACTGCTGCCTGGG + Intergenic
1123087536 14:105723762-105723784 CCTCTCCCTCACTGCTGCCTGGG + Intergenic
1126451181 15:48810967-48810989 CCTCGCGGTAACAGCCTCCGTGG - Exonic
1129666986 15:77584839-77584861 CCCGGAGCTCACAGCCTCCTGGG - Intergenic
1132467549 16:84461-84483 CCTGGCCCTCCCAGCCACCTGGG - Intronic
1134529797 16:14974704-14974726 CCACTCGCTCACCGCCTCCTTGG + Intronic
1135421256 16:22307111-22307133 CTCCGTGCTCACAGCGGCCTTGG + Intronic
1137365162 16:47853774-47853796 CCTCCCCCTCACAGCTGCCCAGG + Intergenic
1137524077 16:49218569-49218591 CCAGGCACTCACAGCCTCCTGGG + Intergenic
1138483093 16:57317147-57317169 CCTCCAGCACACAGCAGCCTTGG - Intergenic
1139866553 16:70066258-70066280 TCTCTCGCTCACCGCCTCCTTGG - Intergenic
1141669085 16:85482113-85482135 CCTCCCTCCTACAGCCGCCTGGG - Intergenic
1141725826 16:85787714-85787736 CCACGCACTCCCAACCGCCTTGG + Intronic
1141935389 16:87235000-87235022 CCTTTCGCTCCCAGCTGCCTAGG + Intronic
1142105884 16:88302523-88302545 CCCTGGGCTCACAGCTGCCTGGG + Intergenic
1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG + Exonic
1144847463 17:18227316-18227338 CCTCACCCTCACAGCCTCCCCGG - Intronic
1148054191 17:44783952-44783974 CCTCGTGATCCCACCCGCCTCGG - Intergenic
1148664045 17:49361768-49361790 CCTAGCGCACGCAGCTGCCTCGG + Intronic
1151855083 17:76715297-76715319 CCCCACGCCCACAGCCCCCTTGG - Exonic
1152363686 17:79843662-79843684 CGCCGCGCTCACAACGGCCTCGG + Intergenic
1152386481 17:79977836-79977858 CCTCCCGTGCACAGCCGGCTGGG - Intronic
1157825045 18:50805022-50805044 CCTCGTGATCCCACCCGCCTCGG + Intronic
1160957247 19:1699394-1699416 CCTGGCGCTCCCACCCTCCTGGG + Intergenic
1162979285 19:14228279-14228301 CAGCGCGCTCACAGCCGCCGGGG + Intergenic
1167246047 19:48373791-48373813 CCTCCCGCTCACAGCCCTCCTGG + Intronic
1167349558 19:48965948-48965970 CCTCGCGCGCACGGCCTGCTGGG - Intronic
925336353 2:3101880-3101902 CCCCGCCCTCACAGCCTCCGAGG + Intergenic
927168922 2:20351805-20351827 CGTGGAGCTCACAGTCGCCTAGG - Intronic
928278223 2:29921325-29921347 CCTTGCTCTCACCGGCGCCTCGG + Exonic
932093805 2:68829298-68829320 CCTCCCCCTCTCAGCGGCCTTGG - Intergenic
932256655 2:70293660-70293682 CCGCGGGCTCACAGATGCCTTGG + Exonic
936103568 2:109604491-109604513 CCTCGTGATCCCACCCGCCTCGG - Intronic
938406252 2:131034891-131034913 CCCCGCCCGCACAGCCGGCTTGG + Intronic
938639815 2:133266675-133266697 CCACGCGCTCACCGCAGCCCGGG + Intronic
939003060 2:136758317-136758339 CCTCGCTCTCAGCACCGCCTCGG + Intergenic
943441733 2:187934364-187934386 CCTAGCGCTCACACCCTACTGGG + Intergenic
946112943 2:217436263-217436285 TCTCCTGCTCACAGCCCCCTTGG - Intronic
1171123624 20:22584584-22584606 CCGCGCGCTTCCCGCCGCCTCGG - Intronic
1172732426 20:37099201-37099223 CCTCGTGATCCCACCCGCCTCGG + Intergenic
1175668162 20:60877927-60877949 GGTCCCGCTGACAGCCGCCTTGG + Intergenic
1179972382 21:44843301-44843323 TGTCGGCCTCACAGCCGCCTAGG - Intergenic
1180594206 22:16962988-16963010 CCTCCTGCTCTCAGCAGCCTGGG + Intronic
1183666552 22:39249439-39249461 CCTCACCCTCACAGTCGCCCAGG + Intergenic
1184550708 22:45202906-45202928 CCCCGTGCTCACGGCCCCCTGGG - Intronic
1185063657 22:48620183-48620205 CCTCGTGCCCACTGCCCCCTTGG + Intronic
1185227337 22:49660481-49660503 CCTCGCCATCCCAGCCCCCTCGG - Intergenic
961518970 3:127456010-127456032 CCTGGCCCTCCCAGTCGCCTGGG + Intergenic
962974912 3:140437501-140437523 CCTCAGGCTCTCAGCCTCCTTGG + Intronic
963091486 3:141487244-141487266 CCTCGCGCCCAGCGCCGCCAGGG - Intronic
968568336 4:1326730-1326752 CCTTGGCCTCACAGCCACCTAGG + Intronic
968585815 4:1415453-1415475 CCTCCCCCTCACAGCCTCGTGGG + Intergenic
969700071 4:8763041-8763063 CCTCCTGCCCACAGCGGCCTTGG + Intergenic
969720734 4:8892072-8892094 CTTCGCGGTCGCAGACGCCTGGG - Intergenic
971231087 4:24800497-24800519 GCTCACGCTGACAGCCTCCTAGG + Exonic
980053904 4:128061920-128061942 CCTCACGGGGACAGCCGCCTGGG - Intronic
980384075 4:132063179-132063201 CCTGGCTCTCAGAGCCTCCTCGG - Intergenic
989710346 5:44389526-44389548 CCTGGCGTTCCCAGCAGCCTAGG - Intronic
990954637 5:61330888-61330910 CGCCGCGCTCTCAGTCGCCTTGG - Intergenic
992837420 5:80654640-80654662 GCTCGCGCCCGCAGACGCCTGGG + Exonic
995301230 5:110585721-110585743 CCTCATGCTCACTGCAGCCTTGG - Intronic
997158266 5:131580532-131580554 TCTCGCTCTCACCGCCTCCTCGG - Intronic
998199433 5:140107891-140107913 CCGCTCACTCACAGCCCCCTTGG - Intronic
1001215916 5:169855594-169855616 CCACCCCCTCACAGCTGCCTGGG - Intronic
1003603739 6:7541738-7541760 CTCCGCGCTCGCAGCGGCCTCGG + Exonic
1004424938 6:15500902-15500924 GGTCGAGCTCACAGCCCCCTGGG - Exonic
1008757151 6:54810003-54810025 CCTAGTGCTCACAGGCACCTAGG - Intergenic
1013580119 6:111525725-111525747 CCTCGTGATCCCACCCGCCTCGG - Intergenic
1037769176 8:21789016-21789038 CCCCGCGCCGCCAGCCGCCTGGG - Intronic
1038644332 8:29350291-29350313 CCTCGCGCGCCCAGCCGCCTCGG - Exonic
1044302958 8:90606609-90606631 CCTCGCTCTCGGAGCCTCCTCGG - Intergenic
1048186953 8:132250160-132250182 GCTCGCGCTCAGTGCCTCCTCGG - Intronic
1049612032 8:143560329-143560351 CCTTGTCCTCACAGCAGCCTGGG - Intronic
1053105342 9:35403734-35403756 TCTTGTGCTCACAGCCTCCTGGG + Exonic
1053276471 9:36787236-36787258 CCACTGGCTCACAGCAGCCTGGG - Intergenic
1061621624 9:131814510-131814532 CCTGGCGCTCTCAGCTGTCTTGG - Intergenic
1061666541 9:132163446-132163468 CCCCGCGCTCACTGTAGCCTCGG - Intronic
1192538681 X:71949993-71950015 TCTGGCGCTCCCAGCCGCCAGGG - Intergenic
1196815289 X:119660793-119660815 CCCCCCGCTCACCCCCGCCTTGG - Intronic
1196939315 X:120760033-120760055 CCTCTCCCTCACAGCAGACTTGG - Intergenic
1200087074 X:153612232-153612254 CCTCGTGATCCCCGCCGCCTTGG - Intergenic