ID: 1119644158

View in Genome Browser
Species Human (GRCh38)
Location 14:76336543-76336565
Sequence CCAGCCATGAAGAGGGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 219}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119644158_1119644168 17 Left 1119644158 14:76336543-76336565 CCTGACACCCTCTTCATGGCTGG 0: 1
1: 0
2: 0
3: 32
4: 219
Right 1119644168 14:76336583-76336605 CTTCTATTGTCTTTCCTGCTGGG 0: 1
1: 0
2: 0
3: 33
4: 258
1119644158_1119644169 18 Left 1119644158 14:76336543-76336565 CCTGACACCCTCTTCATGGCTGG 0: 1
1: 0
2: 0
3: 32
4: 219
Right 1119644169 14:76336584-76336606 TTCTATTGTCTTTCCTGCTGGGG 0: 1
1: 0
2: 0
3: 30
4: 359
1119644158_1119644167 16 Left 1119644158 14:76336543-76336565 CCTGACACCCTCTTCATGGCTGG 0: 1
1: 0
2: 0
3: 32
4: 219
Right 1119644167 14:76336582-76336604 CCTTCTATTGTCTTTCCTGCTGG 0: 1
1: 0
2: 1
3: 18
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119644158 Original CRISPR CCAGCCATGAAGAGGGTGTC AGG (reversed) Intronic
900665722 1:3814282-3814304 GCAGCCATGTGGAGGGAGTCAGG - Exonic
900927067 1:5712427-5712449 CCGGTCATAAAGCGGGTGTCTGG + Intergenic
904673750 1:32184762-32184784 ACAGCCCTGAAGAGGCTGGCTGG - Intronic
905465692 1:38151510-38151532 CCAGCCCTGAAGAGGGGAGCTGG - Intergenic
907528315 1:55067621-55067643 CCAGCCCTGAAGTGCCTGTCTGG - Exonic
908327052 1:63033100-63033122 TCTGCCATGAAGAGGGGGCCCGG + Intergenic
908819233 1:68066265-68066287 CCAGGCCTGAAGAGGAAGTCAGG - Intergenic
911383200 1:97141381-97141403 TCAGCCAAGAGTAGGGTGTCTGG - Intronic
913446398 1:118955033-118955055 CCACCCATGAAGAGGGATTCTGG - Intronic
914400615 1:147316718-147316740 CCAGGCCTGAAGAGGCAGTCTGG - Intergenic
915041424 1:152971216-152971238 CCAGCTCTGATGAGGGTCTCTGG - Intronic
915836818 1:159183473-159183495 CCAGCCAGAAAGAGGGTGGATGG + Intronic
919370786 1:196723734-196723756 CCAGCCCTGACAGGGGTGTCAGG + Intronic
920349648 1:205329416-205329438 GCAGCCATGTGGAGGGTGTCTGG + Intergenic
922591482 1:226780542-226780564 CCATCCATGAGGCGGGTGACAGG - Intergenic
922758146 1:228108062-228108084 CTAGCCAGGAAGAGGCTGCCAGG + Exonic
924089231 1:240485635-240485657 TCAGCCCTGAAGACGGTATCTGG - Intergenic
924886414 1:248222100-248222122 GCAGCCTTGCAGAGGGAGTCTGG + Intergenic
1064598489 10:16970069-16970091 CAAGCCATGAAGAGGGTGAGGGG + Intronic
1065289246 10:24213775-24213797 CCAGTGATGAAGAGGATTTCTGG - Intronic
1065355295 10:24834777-24834799 CCAGCCCTGATGAGGGTGGTAGG - Intergenic
1066608412 10:37208217-37208239 CCAGCCAAGACAAGGGTCTCAGG - Intronic
1067166162 10:43868091-43868113 CCAGCTAGGAGGAGGGAGTCTGG - Intergenic
1067428888 10:46229029-46229051 CCAGCCATGATAGGGGTGGCTGG - Intergenic
1067808726 10:49410626-49410648 CCAGCCAAGAAGATGGTGTGGGG - Intergenic
1068161675 10:53272456-53272478 CCAGCCTTGATGAGGGTAGCTGG - Intergenic
1068367242 10:56067654-56067676 CCTGCCATGATGAGGGTGGCTGG + Intergenic
1068532829 10:58208885-58208907 CCAGCCTTGATGAGGGTAGCTGG + Intronic
1069490494 10:68856665-68856687 GCAGCAAGGAGGAGGGTGTCTGG - Intronic
1071200281 10:83214353-83214375 TCAGCCAAGCAGATGGTGTCAGG + Intergenic
1071345139 10:84685158-84685180 CCAGCAGTGAAGGGGGGGTCAGG - Intergenic
1071354769 10:84783677-84783699 CCAGCCCTAAAGAGGATGGCTGG + Intergenic
1071582823 10:86789019-86789041 TCAGGGATGAAAAGGGTGTCAGG + Intronic
1072269124 10:93758104-93758126 CCAACCATGAACAGGGCTTCTGG - Exonic
1073104078 10:101022304-101022326 CCAGCTCAGAAGATGGTGTCCGG - Exonic
1075640994 10:124064583-124064605 CCAGCAACGAAGAGGGGCTCAGG - Intronic
1076808083 10:132869306-132869328 CGCGCCATGAAGAGGCGGTCGGG - Exonic
1076843043 10:133056006-133056028 CGAGCCATGAGGAGGCTCTCTGG + Intergenic
1077224501 11:1434282-1434304 CCAGCCAGGATCTGGGTGTCTGG + Intronic
1077497876 11:2895308-2895330 CCAGCCATGTCCAGGGTGCCTGG + Intronic
1077956061 11:7020803-7020825 CCAGGAACGAAGAGGGTGTCTGG - Intronic
1078440639 11:11363861-11363883 CCTGCCATGAGGAGGGTTCCAGG - Intronic
1084575020 11:69983494-69983516 CCTGCCATGCCCAGGGTGTCGGG + Intergenic
1085420317 11:76352709-76352731 CCAGCGAAGAAGAGGGTGAAGGG - Exonic
1086821406 11:91440907-91440929 CCAGTCATTAAGAGTGTCTCAGG - Intergenic
1086982878 11:93218026-93218048 GCAGCCATGTAGAGGATGACTGG + Intergenic
1087127222 11:94640064-94640086 CCACCCAGGAAGAGGGCGGCAGG - Intergenic
1088413983 11:109568904-109568926 CCAGCCTTGATGAAGGTGGCTGG + Intergenic
1089078181 11:115755720-115755742 CCATGCAGGAAGAGGGTGTCTGG + Intergenic
1091347558 11:134865208-134865230 ACAGCCATGTAGATGGTGTTGGG - Intergenic
1091560080 12:1605550-1605572 CCGGGCATGAAGAGAGTGCCAGG + Intronic
1092128652 12:6093179-6093201 GCAGCTTTGTAGAGGGTGTCGGG + Intronic
1092980033 12:13785420-13785442 CCAGCCTGGAAAAGGGTGTTTGG - Intronic
1094020022 12:25904299-25904321 CTAGCCATAAAGAGGGCATCTGG - Intergenic
1095777283 12:46024058-46024080 CCAGCTCTGATGAGGGTGGCAGG + Intergenic
1097650454 12:62292060-62292082 CCAGCCCTGACAAGGGTGGCAGG + Intronic
1098223736 12:68298704-68298726 CCAGCCTTGATGAAGGTGGCTGG - Intronic
1099493752 12:83318973-83318995 CCAGCCATGAAAATAGTCTCTGG + Intergenic
1099759022 12:86893932-86893954 CCAGCCCTAAAGAGGATGGCTGG - Intergenic
1101397393 12:104360332-104360354 CCAGCCCTCCAGTGGGTGTCAGG - Intergenic
1102026557 12:109717117-109717139 TCAGCCATGGAGGGGGAGTCTGG + Intronic
1102029492 12:109731726-109731748 CCACCCATGTTGAGGGTCTCTGG + Intronic
1102586947 12:113930309-113930331 CCAGCCATGCTGAGGGGTTCTGG - Intronic
1106033170 13:26020679-26020701 CCAGCCATGCAGCAGGTGTGGGG - Exonic
1107266964 13:38567317-38567339 CCAGCCCTGAAAAGGGTGGCTGG - Intergenic
1114418543 14:22560160-22560182 CCAGCCATGGGGAGTGTGTCTGG - Intergenic
1117777663 14:59199113-59199135 CCAGCCAAGAACAGGATCTCAGG - Intronic
1119143654 14:72290804-72290826 CCAGCCATGAAGGGTGTTGCTGG - Intronic
1119644158 14:76336543-76336565 CCAGCCATGAAGAGGGTGTCAGG - Intronic
1119645898 14:76348280-76348302 CCAGCCCTGTGGTGGGTGTCTGG + Intronic
1120011791 14:79423914-79423936 CAAGCAATGAAGAGGTTGTTTGG - Intronic
1125316746 15:38440678-38440700 CCAGCCCTGATGAGGGCGGCTGG + Intergenic
1125965423 15:43871530-43871552 CCAGAGATGAAAAGGCTGTCAGG - Exonic
1126244711 15:46490593-46490615 CCAGCCTTAATGAGGGTGTCTGG + Intergenic
1127380023 15:58422861-58422883 CCAGCCAGGAAGAGGGGACCGGG - Intronic
1130748825 15:86687336-86687358 ACAACCAAGAAGAAGGTGTCTGG + Intronic
1131077397 15:89503904-89503926 CCATCCATACAGAGGGTGACAGG + Intergenic
1131818138 15:96244159-96244181 CCAGTCCTGAAGGGGGTATCTGG + Intergenic
1132607811 16:800808-800830 CCAGCCCTGAGGAGGGTGTGGGG - Intergenic
1134050213 16:11131945-11131967 CCAGCCATGCAGAGGGCTCCAGG - Intronic
1136276774 16:29183457-29183479 GCAGCCCTGCAAAGGGTGTCAGG - Intergenic
1137445749 16:48531116-48531138 GCAGAGATGGAGAGGGTGTCTGG + Intergenic
1138235748 16:55380878-55380900 CCAGGCATGAGGAGTGTGTTGGG - Intergenic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1139397194 16:66649727-66649749 CCCCCCATGAGGAGGGAGTCGGG - Intronic
1139994019 16:70963143-70963165 ACAGTCATGAAGAGAGTGTGAGG - Intronic
1140951589 16:79823620-79823642 TCAGCCATCACCAGGGTGTCAGG - Intergenic
1141133248 16:81448909-81448931 CCAGCCATGAAGAGCCAGTGAGG - Intronic
1141646274 16:85369736-85369758 CCAGCCAGGGAGAGTGTGTTAGG - Intergenic
1141900238 16:86986244-86986266 CCAGCCCTGAAGAGGTGGTCAGG + Intergenic
1142411443 16:89919083-89919105 CCAGCCAGGGAGAGGGTGTGAGG + Exonic
1142415138 16:89937011-89937033 CCATCCATGTTGGGGGTGTCAGG - Intergenic
1148091083 17:45022858-45022880 CCAGGCAGGATGAGGGTGGCAGG - Intergenic
1150711294 17:67532836-67532858 ACAGCCATGAACAGAGTGACCGG + Exonic
1152230388 17:79111363-79111385 CCAGCCAGGTAGAGGGAGACGGG - Intronic
1152285144 17:79408200-79408222 CCAGCCATCGAGTGTGTGTCTGG - Intronic
1153122959 18:1753329-1753351 TCAGCCATAAAAAGGGAGTCCGG + Intergenic
1153532930 18:6068364-6068386 CCAGCCTTGATGAAGGTGCCTGG + Intronic
1155685156 18:28539496-28539518 TGAGCCAGAAAGAGGGTGTCAGG + Intergenic
1156268687 18:35511669-35511691 CCAGCCCTAATGAGGGTGTTGGG + Intergenic
1157235497 18:45961456-45961478 CTAGCCAGGAAAAGGCTGTCTGG - Intronic
1158944015 18:62432704-62432726 CCTGCTATGAAGAGGGGATCAGG - Intergenic
1160058828 18:75510923-75510945 CCAGCCTTGATGAGGGTGGCTGG - Intergenic
1160532884 18:79575913-79575935 CCAGGCATGGACAGGGTCTCAGG - Intergenic
1161407680 19:4099495-4099517 TTAGCCATGGAGAGGGTGACGGG - Intronic
1161728405 19:5944223-5944245 GCAGGCATGAATAGGGAGTCAGG + Intronic
1162577269 19:11506258-11506280 CCAGCCCTGCAGAGGATGTCTGG + Exonic
1162898182 19:13777973-13777995 CTAGCCAGGAAGAGGGTGACTGG + Intronic
1163056229 19:14720427-14720449 CAAGCTAAGAAGAGGGTGGCCGG + Exonic
1163506174 19:17707641-17707663 CCAGCCCTGAGGATGGTGGCGGG + Intergenic
1163666482 19:18606244-18606266 CCTGGCATGCAGAGGGTCTCAGG + Intronic
1166397473 19:42452403-42452425 CTAGCTTTGAAGAGGGTCTCAGG - Intergenic
1166930606 19:46299102-46299124 CCAGCCAAGAACAGGGGGTGGGG - Intronic
1167658238 19:50780302-50780324 CCAGCCAGGACGTGGATGTCAGG + Intergenic
1168274777 19:55271610-55271632 CCAGCCATGCAGAGGCTGGGAGG - Intronic
925253950 2:2466323-2466345 CCAGCCAGGAAGAGCGGGCCAGG + Intergenic
925661079 2:6203403-6203425 CCAGCCACGGAGAGAGTATCAGG - Intergenic
926926540 2:17993597-17993619 GCAGCCAGGGAGAGGGTGTTAGG + Intronic
931966550 2:67542524-67542546 CCATCCATGTCGATGGTGTCCGG + Intergenic
933785963 2:85841752-85841774 CCAGACATGAGGAGGGAGTGGGG - Intronic
934747786 2:96770822-96770844 GCAGCCATGGAGAGTGTGTATGG + Intronic
936336528 2:111595219-111595241 CCAGCTATGGTGAGGGTTTCGGG - Intergenic
937358484 2:121213031-121213053 CCAGCCATGATGCGGGCGTGAGG - Intergenic
938370804 2:130767290-130767312 GCAGCCATGAAATGGGTTTCTGG + Exonic
939305315 2:140402710-140402732 CCAGCCTTTATGAGGGTGGCTGG - Intronic
943446670 2:187995245-187995267 CCAGCTCTGATGAGGGTGGCAGG - Intergenic
944907935 2:204281540-204281562 CCAGCCATGTAGAAGGTCTCAGG - Intergenic
946207951 2:218124397-218124419 CCAGCCTTGATGAGAGTGCCTGG + Intergenic
946596422 2:221310481-221310503 GCAGCCATTTACAGGGTGTCTGG + Intergenic
948758239 2:240171955-240171977 CCAGCCATGAAAAAGGTGGCTGG + Intergenic
1172204834 20:33155880-33155902 CCTGCCCTGAAGAGGGAGGCAGG - Intergenic
1173990176 20:47296260-47296282 CCAGCCAGGAAGAAGGAGTGGGG - Intronic
1174042106 20:47707383-47707405 CTTGCCCTGAAGAGAGTGTCTGG - Intronic
1175793625 20:61757719-61757741 GCTGCCATGTGGAGGGTGTCAGG + Intronic
1178892684 21:36533234-36533256 CCAGCCAGGCAGAGAGTGGCTGG + Intronic
1179885171 21:44310807-44310829 CCAGCTGTGCAGAGGGTGTCTGG + Intronic
1180060767 21:45383810-45383832 GCAGCCGGGAAGAGGGTGTGAGG - Intergenic
1181021541 22:20106116-20106138 CCAGCCATGAAGAGGCCGGTGGG + Intronic
1182297733 22:29319405-29319427 CCAGCCCTCAAGAGGCTGCCTGG - Intronic
1182902618 22:33910967-33910989 ACAGCCATGAAGAAGGAGCCAGG - Intronic
1183062066 22:35342339-35342361 CCAGCCAGGCACAGGGTGACGGG + Intronic
1183311042 22:37109617-37109639 AGAGCCATGACCAGGGTGTCTGG + Intergenic
1184058956 22:42070551-42070573 CCAGCACTGCAGAGGGTGTGAGG - Exonic
1184774959 22:46618526-46618548 CCAGAGCTGATGAGGGTGTCGGG + Intronic
1184986248 22:48137667-48137689 CCAGCCTAGGAAAGGGTGTCGGG - Intergenic
951908088 3:27722778-27722800 CCAGCCAATAGGAGGGTCTCCGG - Intergenic
952232430 3:31445789-31445811 CAAGCCATGAAGACTGTGTGTGG + Intergenic
952993776 3:38856567-38856589 CCAGCCTTGATGAAGGTGGCTGG - Intronic
953125613 3:40088980-40089002 CTAGGCATGCAGAGGGTGTGGGG + Intronic
954002101 3:47565913-47565935 CCAGCCTTGAAGGGTATGTCAGG - Intronic
955069593 3:55560998-55561020 CAAGCCATGAAGAGGAGGTGTGG - Intronic
955445823 3:59008353-59008375 CCAGCCTTGATGAGTGTGGCTGG - Intronic
956510089 3:69984057-69984079 CCAGCCATGAAAGTGGTTTCAGG - Intergenic
957043054 3:75351635-75351657 CCAGCCTTGAGGACGGAGTCTGG - Intergenic
957777082 3:84767336-84767358 CCAGCCTTGATGAGGGTGGCTGG - Intergenic
958149106 3:89667734-89667756 CCAGCCTTGATGAGGGTGGCTGG - Intergenic
958266701 3:91446260-91446282 CCAGACATGAAAAGGGAGGCTGG - Intergenic
958510031 3:95036625-95036647 CCAGCCTTGATGAGGATGGCTGG + Intergenic
958903545 3:99916834-99916856 CCAGCCGTGAAGATGATGGCTGG - Intronic
959727353 3:109559765-109559787 CTAGCCTTGATGAGGGTGCCTGG + Intergenic
961553075 3:127680039-127680061 CCAGGCCTGAAGAGGCTGTGCGG + Exonic
962031613 3:131606782-131606804 CCAGACATTTAGAGGGTGGCTGG - Intronic
964193250 3:154031101-154031123 TCATCCATGAAGAGGGTCTGTGG - Intergenic
966565617 3:181377659-181377681 CCAGCTATGAACAGCCTGTCTGG + Intergenic
966819160 3:183911257-183911279 CCTGCCATGAAGAGGCTGTGAGG - Intergenic
969576078 4:8036486-8036508 GCAGCCGTGAAGAGGGTGCTGGG + Intronic
969837048 4:9850560-9850582 GAAGCCATGAAGAGGGTCCCAGG - Intronic
969897334 4:10317610-10317632 CCAGGCATGAAAGGAGTGTCTGG - Intergenic
971721161 4:30246829-30246851 CAAGCCTTGATGAGGGTGTCTGG + Intergenic
974848365 4:67379012-67379034 CCAGCCTTGATGAAGGTGACTGG - Intergenic
975165170 4:71170056-71170078 CCAGCCATGCAGAGCATGTTGGG - Intergenic
975374917 4:73632259-73632281 CCAGCTCTGATGAGGGTGGCAGG - Intergenic
976067333 4:81203833-81203855 CCAGGCAGGAAGAGGATTTCAGG - Intronic
976907838 4:90262646-90262668 CCAGCCTTGATGAAGGTGGCTGG + Intronic
977715270 4:100175101-100175123 CCAGACATGAAGAGGGAACCTGG - Intergenic
978692389 4:111529613-111529635 CCAGTCCTGATGAGGGTGTCTGG + Intergenic
979664366 4:123294203-123294225 CCAGCTCTGATGAGGGTGGCAGG + Intronic
981076255 4:140595371-140595393 CCAGCCCTGCTGAGGGTGGCTGG + Intergenic
983368526 4:166827773-166827795 CCAGATTTGAAGTGGGTGTCAGG - Intronic
984832540 4:183988883-183988905 CCACCCGTGAAGAGGGTGCACGG + Intronic
985567187 5:625044-625066 CCAGCCATGGGGAGGGAGACAGG - Intronic
986366551 5:7038558-7038580 TCTGCCATGAAGAGCCTGTCAGG - Intergenic
989479432 5:41912983-41913005 CTCCCCATGAAGAGGGGGTCTGG - Intronic
989525848 5:42453440-42453462 ACAGCCTTGATGAGGGTGGCTGG + Intronic
989818364 5:45764393-45764415 CCAGCCTTGAAGAAGGTGGCTGG + Intergenic
990005565 5:50940208-50940230 GCAGCCTTGATGAGGGTGGCTGG - Intergenic
991414791 5:66380637-66380659 CCAGCCTTGATGAGGGTGGCTGG - Intergenic
992771283 5:80050686-80050708 CCAGGCAAGAAGAGGGTCTTCGG + Intronic
993796725 5:92276208-92276230 CCAGCCTTGATGAGGGTGGCTGG - Intergenic
994873073 5:105378871-105378893 CCAGCCCTAACCAGGGTGTCTGG + Intergenic
997226637 5:132214124-132214146 GCAGCCACAAAGAGGGTCTCTGG + Intronic
997286911 5:132686543-132686565 AGAGCCAAGGAGAGGGTGTCTGG - Intergenic
1000458416 5:161482028-161482050 CCAGCCTTGAAGTGGCTGTGTGG - Intronic
1001537065 5:172505547-172505569 CCAGCAATGGCAAGGGTGTCTGG - Intergenic
1002601213 5:180354777-180354799 CCAGCGGTGGAGAGGGTGCCAGG + Intergenic
1002680475 5:180959191-180959213 CCAGCTCTGATGAGGGTGGCAGG + Intergenic
1004240758 6:13918947-13918969 TCATCCATGAAGAGCCTGTCTGG + Intergenic
1005418553 6:25626637-25626659 CCAGCCATGAAGATGATGCCTGG - Intergenic
1005587323 6:27289279-27289301 TCAGCCATGGAGAGGATTTCAGG - Intronic
1007599630 6:43073777-43073799 CCAGCCATGGAGAGAGAGTTTGG + Intronic
1008988512 6:57575333-57575355 CCAGACATGAAAAGGGAGGCTGG + Intronic
1009177119 6:60473924-60473946 CCAGACATGAAAAGGGAGGCTGG + Intergenic
1010017390 6:71121352-71121374 CCAGCCTTGATGAGGGTGACTGG + Intergenic
1011752725 6:90469524-90469546 CCAGCCAGGGGAAGGGTGTCTGG - Intergenic
1012696649 6:102392164-102392186 CCAGCCTTGATGAAGGTGGCTGG - Intergenic
1014421082 6:121245970-121245992 CCAGCCATGATGGTGGTGACTGG - Intronic
1017338568 6:153291358-153291380 CCATACATGAACAGGGTTTCTGG + Intergenic
1018656404 6:166041354-166041376 CCAGAGAGGAAGAGTGTGTCTGG - Intergenic
1019616455 7:1965085-1965107 CCAGCCCTGATCATGGTGTCTGG + Intronic
1021551200 7:21872845-21872867 AAACCAATGAAGAGGGTGTCAGG + Intronic
1021754786 7:23841782-23841804 CCAGCCTTGATGAGGGTAGCTGG + Intergenic
1022640336 7:32176818-32176840 GCAGCCATAATGAGGGTGTTGGG + Intronic
1025236405 7:57237689-57237711 ACAGCCAGGAACTGGGTGTCTGG - Intergenic
1026336156 7:69395687-69395709 ACAGCCATGCAGAGGGTGAGTGG - Intergenic
1029599535 7:101555734-101555756 CCGGCCATGAGGAAGGGGTCAGG - Intronic
1031011659 7:116530495-116530517 CCAGCCATGAAAAGGATAGCAGG + Intronic
1032094712 7:128932298-128932320 TCAGGGAAGAAGAGGGTGTCAGG - Intergenic
1032334531 7:131012748-131012770 CCAGCTATGAAGTAGGTCTCAGG + Intergenic
1035219479 7:157397342-157397364 CCAGCCAGGGAGAGGGGGTGCGG + Intronic
1035227992 7:157444143-157444165 CCCACCCTGAAGATGGTGTCAGG - Intergenic
1035777015 8:2196084-2196106 CCGGCCATGCAGAGGCTGGCGGG - Intergenic
1036453513 8:8890225-8890247 CTAGCAATGGACAGGGTGTCTGG + Exonic
1036667208 8:10754957-10754979 CCAGCCCAGACCAGGGTGTCAGG + Intronic
1043303293 8:78761986-78762008 CCAGCGAAGAAGAGGGTGAAGGG - Intronic
1043725992 8:83611371-83611393 GCAGCCATGTAGGGGGTGCCGGG - Intergenic
1044606383 8:94051528-94051550 CTAACCATGAAGAGGGCTTCAGG - Intergenic
1045047065 8:98289327-98289349 CAAGCCATAAGGAGGGTATCAGG + Intronic
1047208155 8:122819911-122819933 CCAGCCAAGGCGAGGGTGTGGGG - Intronic
1048963896 8:139601270-139601292 CCGGCCTTTAAGAGGTTGTCTGG + Intronic
1049272371 8:141702766-141702788 CCAGGCATGATGAGGGTGTGAGG - Intergenic
1049352007 8:142169634-142169656 CCCTCCATGTTGAGGGTGTCTGG - Intergenic
1049352037 8:142169733-142169755 CCCTCCATGTTGAGGGTGTCAGG - Intergenic
1049352052 8:142169783-142169805 CCCTCCATGCTGAGGGTGTCAGG - Intergenic
1049352069 8:142169833-142169855 CCCTCCATGCTGAGGGTGTCAGG - Intergenic
1049352086 8:142169883-142169905 CCCTCCATGCTGAGGGTGTCAGG - Intergenic
1049352103 8:142169933-142169955 CCCTCCATGTTGAGGGTGTCAGG - Intergenic
1055182075 9:73401294-73401316 CCAGCCTTGATGAAGGTGGCTGG + Intergenic
1057238850 9:93391098-93391120 CCAGCCATGTAGAGCATGCCAGG + Intergenic
1057304499 9:93904399-93904421 CCAGCCAGAATGAGGGTGCCTGG - Intergenic
1057903884 9:98969630-98969652 CCAGCCATAGGGAGGGAGTCAGG + Intronic
1058102923 9:100937194-100937216 CCAGCCTTGATGAGGGTGGCTGG + Intergenic
1058343072 9:103921469-103921491 CCAGCCTTGATGAGGGTGGCTGG - Intergenic
1062061264 9:134496518-134496540 CCAGTCATGAAGAGGTTGGTTGG + Intergenic
1062192420 9:135254828-135254850 CCAGCCCTGCAGAGGGGTTCCGG - Intergenic
1062241365 9:135540862-135540884 CCAGCCATGAAGGGTGCGTGTGG + Intergenic
1062328594 9:136025104-136025126 CCAGCCAAGAGGAGGGGTTCTGG + Intronic
1187489748 X:19739866-19739888 CAAGCCATGAAGTGGGTTTGTGG - Intronic
1187744122 X:22389595-22389617 CCAGCCCTGAGCAGGGTGTTTGG + Intergenic
1189980637 X:46506826-46506848 CCAGCAATGCAGAGGGTGAAGGG + Intronic
1194634124 X:96322973-96322995 CCCACCTTGAAGAGGGTGGCTGG + Intergenic
1200141607 X:153905430-153905452 GGAGCCAGGAAGTGGGTGTCCGG + Intronic
1202051313 Y:20783670-20783692 CCAGACAGAAAGAGGCTGTCAGG - Intergenic