ID: 1119645244

View in Genome Browser
Species Human (GRCh38)
Location 14:76343220-76343242
Sequence TTGGAGAGACAGATTAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 230}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119645240_1119645244 9 Left 1119645240 14:76343188-76343210 CCAAGTGAGAGGGAGGGTGGTCC 0: 1
1: 0
2: 0
3: 6
4: 148
Right 1119645244 14:76343220-76343242 TTGGAGAGACAGATTAAGCAGGG 0: 1
1: 0
2: 1
3: 24
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119645244 Original CRISPR TTGGAGAGACAGATTAAGCA GGG Intronic
903449316 1:23442234-23442256 GGGGAGAGCCAGATGAAGCAAGG - Exonic
904198484 1:28803721-28803743 ATGGAAAGACAGAATAAGCCTGG - Intergenic
905816379 1:40954148-40954170 TTGCATAGAGAAATTAAGCAGGG + Intergenic
905969040 1:42126922-42126944 TAGGAGAAACTGATTAAGCCTGG - Intergenic
907229743 1:52985169-52985191 TTGGAGAAGCAGTTCAAGCAAGG - Intronic
908661906 1:66445750-66445772 TTGGAGAGACAGAGTTTTCATGG - Intergenic
908671115 1:66548726-66548748 TTGGAGAGAAAAATGAAACATGG - Intronic
909298325 1:73980016-73980038 TTGGAGAGACATAGCAAGCCTGG + Intergenic
909345293 1:74578149-74578171 TTTGACAGACAGATAAACCAAGG - Intronic
909397027 1:75181673-75181695 TTGGAGAGCCAGCCAAAGCAGGG - Intergenic
910672035 1:89783347-89783369 TGAGAGAGACAGATCAAGCCTGG - Intronic
911337530 1:96598748-96598770 TTGGAGAGACTGATTTATAAAGG + Intergenic
914686394 1:149983555-149983577 TTGGAGAGACAAATTGGGAAAGG + Intronic
917410184 1:174751323-174751345 TTTCAGAGACAGAAGAAGCATGG + Intronic
919204265 1:194400369-194400391 ATGGAGAGACAGCTCAAACAAGG + Intergenic
919526441 1:198658510-198658532 TAGGAGAGACTGATAAATCATGG - Intronic
921324563 1:213978084-213978106 TTGGAGAGAAAAATAAAGAAAGG + Intergenic
921627633 1:217395317-217395339 TTGGAGAGAGAGAAAAAGAAGGG - Intergenic
921638980 1:217529034-217529056 TTGGACAGACAGATGATGCATGG + Intronic
921898885 1:220429424-220429446 TTGGAGAGGCAGAATAACAATGG + Intergenic
922504539 1:226118901-226118923 TTGGAGAGCCAGAACAAGGATGG + Intergenic
1064542842 10:16422769-16422791 TTGGAGAGAAAGACAAAGCCAGG + Intergenic
1065138312 10:22694636-22694658 TTGAAGGGACTGATTAAGTAAGG - Intronic
1065216585 10:23455054-23455076 TTAGAGAGACAGTTTAACAATGG - Intergenic
1065438225 10:25723239-25723261 TTGAAGACACAGATTAATTAGGG - Intergenic
1065727467 10:28679508-28679530 TTGGAGCCACATTTTAAGCAAGG - Intronic
1065757422 10:28945360-28945382 TTGGAGAGACATCTAAAGTAGGG - Intergenic
1065765672 10:29027197-29027219 TTTGAGAGACAGAGAAAGCTGGG - Intergenic
1066203051 10:33160301-33160323 GTGGAGAAACAGGTCAAGCACGG - Intergenic
1066486177 10:35847085-35847107 TTGTAGAGAAAGCTTAATCAAGG - Intergenic
1067059378 10:43070204-43070226 CTGGACAGACAGAGCAAGCAGGG + Intergenic
1067509322 10:46882336-46882358 TTGGAGCAACAGATTCAGCATGG + Intergenic
1067652931 10:48169519-48169541 TTGGAGCAACAGATTCAGCATGG - Intronic
1067999942 10:51320712-51320734 TTTGAGAGACAGAGCAAGAAAGG - Intronic
1069820265 10:71223116-71223138 TTGGGGAGACAGGTTCAGCAGGG + Intronic
1070364802 10:75726181-75726203 CTGGGGAGACACATTAAGCATGG + Intronic
1070978050 10:80621567-80621589 TTGGAGAGACCCATCAAGCAAGG - Intronic
1071379889 10:85047995-85048017 TTGGAGACCCAGAGAAAGCATGG - Intergenic
1072849392 10:98871676-98871698 TTGGACAGGCAGATTTAGTAGGG + Intronic
1073090054 10:100928618-100928640 TTGGAGAGGCAGTATAAGCAAGG + Intronic
1076785576 10:132748203-132748225 TCGGAGAGACAGAGGCAGCAAGG - Intronic
1077324004 11:1955861-1955883 TTGGATGGACAGGTTCAGCATGG + Intronic
1078023943 11:7676972-7676994 TTATGGAGACAAATTAAGCAAGG - Intronic
1078870946 11:15344049-15344071 AAGGAGAGACAAATGAAGCAAGG + Intergenic
1079274907 11:19026298-19026320 CTGGAAAGACAGAGTAAACATGG - Intergenic
1080927850 11:36776938-36776960 TTAGCCAGACAGCTTAAGCATGG + Intergenic
1081342021 11:41939932-41939954 TTGGAGAGAGAGACAGAGCAGGG + Intergenic
1081827254 11:46067960-46067982 TTGAAGACTCAGCTTAAGCAAGG - Intronic
1085097139 11:73770450-73770472 TTGCAGTGACAGATTTAGGATGG - Intergenic
1085834705 11:79940289-79940311 CTGGAGTGACAGGTTAAGCCAGG - Intergenic
1086455081 11:86953333-86953355 TTGGAGAAACAGCTTTTGCAGGG - Intronic
1087433841 11:98088042-98088064 TTGGAGAGAGAGATGCAGCATGG - Intergenic
1090170260 11:124595944-124595966 TAGGAGAGAAAGATTAGGGATGG - Intergenic
1202806990 11_KI270721v1_random:11056-11078 TTGGATGGACAGGTTCAGCATGG + Intergenic
1092013008 12:5131452-5131474 TTAGAGAGACAGACCAACCATGG - Intergenic
1093731950 12:22575090-22575112 TTGGAGAAACAAATTTAGCCTGG + Intergenic
1096824630 12:54265600-54265622 TTGAAGAGAAAGATTAACTATGG + Intronic
1099765802 12:86981813-86981835 AGAGAGAGACAGAGTAAGCAAGG - Intergenic
1100813220 12:98360896-98360918 ATGGAGAGAGAGATTAAGAGTGG + Intergenic
1100847236 12:98672551-98672573 TTTAAGAGACAGAATAATCAGGG - Intronic
1101607064 12:106255218-106255240 CTGGAGAGAAAAATAAAGCAGGG - Intronic
1102296000 12:111737098-111737120 TTGGAGAGACCGATTTGGCCAGG + Intronic
1104111076 12:125704860-125704882 TTGGAGCTAAATATTAAGCAGGG - Intergenic
1105600852 13:21885794-21885816 CTGGAGGGAGAGATTAAGAAGGG + Intergenic
1106343340 13:28852275-28852297 CTGGAGAGACAGATGAACAAAGG - Intronic
1113325901 13:109280935-109280957 TTAGAGAAACAGAATAAACAGGG + Intergenic
1114472551 14:22973839-22973861 TGGGAGAGTCAGATTCAGAAAGG + Intronic
1114496757 14:23138123-23138145 TTGGCGAGAGAGAATTAGCAAGG - Intronic
1115992393 14:39163535-39163557 CTGTGGAGACAGATTAAGCAAGG - Intronic
1116057183 14:39877975-39877997 TTGAAGACACAGTTTAAGAATGG - Intergenic
1116461959 14:45187525-45187547 TCAGAGAGATAGATAAAGCAGGG + Intronic
1116789592 14:49326488-49326510 CAGGAGAGACAGAGTAGGCAGGG - Intergenic
1116814583 14:49571793-49571815 ATGGAGAGACACATAAAGTAAGG - Exonic
1117334448 14:54744949-54744971 TTGGTGAGACAGAGAAAACAGGG - Intronic
1119645244 14:76343220-76343242 TTGGAGAGACAGATTAAGCAGGG + Intronic
1120005692 14:79355268-79355290 TTGGAGGGACAGAGGAAGGAGGG - Intronic
1120784099 14:88514948-88514970 TTGGAGAGAAAGATTATGAGGGG - Intronic
1124421800 15:29529372-29529394 TTGGTGAGGCAGGTTAAGCATGG + Intronic
1124557798 15:30744081-30744103 TTGGAGATAGAGAAGAAGCATGG + Intronic
1124673438 15:31661575-31661597 TTGGAGATAGAGAAGAAGCATGG - Intronic
1130248029 15:82271751-82271773 TTGGAGAGACAAGTTAAAAAAGG + Exonic
1131366368 15:91845454-91845476 TTGCACAGATAGATTCAGCAAGG + Intergenic
1132087116 15:98917429-98917451 TTTGAAAGACAGAGTAACCACGG - Intronic
1135652451 16:24218113-24218135 TTGGAGAGAAACAATAAACAGGG - Exonic
1136689551 16:32019336-32019358 TTGCAGAGACAGAGTTACCAAGG - Intergenic
1136790138 16:32962894-32962916 TTGCAGAGACAGAGTTACCAAGG - Intergenic
1136879675 16:33891034-33891056 TTGCAGAGACAGAGTTACCAAGG + Intergenic
1137443010 16:48511983-48512005 TTGGAGGGACAGACTAAGCCAGG - Intergenic
1137570945 16:49566022-49566044 TTGCAAAGACAGGTTAAGGATGG - Intronic
1138217790 16:55220010-55220032 TTGGCCAAACAGATCAAGCATGG + Intergenic
1138742750 16:59329905-59329927 TTGGAAAGCCAGATTAGGGAGGG - Intergenic
1138781549 16:59794595-59794617 TTGGAGAAACTGATAAAGCTGGG + Intergenic
1139658385 16:68403204-68403226 TTGGAAAGAAAAATGAAGCAGGG - Intronic
1141011804 16:80407784-80407806 TGGGTGAGACAGAGTAAGCATGG + Intergenic
1203092345 16_KI270728v1_random:1224348-1224370 TTGCAGAGACAGAGTTACCAAGG - Intergenic
1142825704 17:2508825-2508847 TTGGAGGGACAGATAAGGCCTGG - Intronic
1146799513 17:35807480-35807502 TTGGAGAGACAGAAATAGGAAGG - Intronic
1147152396 17:38525477-38525499 TTGCAGAGACAGAGTTACCAAGG - Intergenic
1147804162 17:43118016-43118038 TTAAAGAGAAAAATTAAGCAGGG + Intronic
1149237705 17:54612606-54612628 TTTAAGAGACAGATTAAAGAGGG + Intergenic
1153068450 18:1076626-1076648 ATGGAGACACATATTAACCATGG + Intergenic
1154059990 18:11050746-11050768 TTGGAGAGGCAGAATTAGAAAGG - Intronic
1155246392 18:23914277-23914299 TTGGAGAGACAGAATAAACAAGG - Intronic
1156731872 18:40204152-40204174 TTGGAGAGACTGCTTGATCAGGG - Intergenic
1156954004 18:42939188-42939210 CTGGTGAGAGGGATTAAGCATGG + Intronic
1158263509 18:55635080-55635102 TTGGAGAGAAAGAGGAACCATGG + Intronic
1160617985 18:80148310-80148332 TGGGAGAGGCAGATTAGGCTGGG + Intronic
1164292245 19:23879219-23879241 GTGGAGAGAAAGAGAAAGCAGGG + Intergenic
1165413367 19:35676033-35676055 ATGGATAGACAGATGGAGCAGGG - Intronic
1167233916 19:48302493-48302515 TTGGAGGGACAGATGATGGATGG + Intronic
1168385137 19:55956781-55956803 TAGGAGTGATAGATGAAGCAAGG - Intronic
926046718 2:9715399-9715421 TTGGAGAAACAGACTCAACAAGG - Intergenic
926404624 2:12538563-12538585 CTGGAGAGACTGATTAACTAAGG + Intergenic
926783316 2:16495676-16495698 TTGAAGATGCAGATCAAGCATGG - Intergenic
926788372 2:16543291-16543313 TAGGAGAGGAAGATTAAGAAGGG + Intergenic
928121840 2:28589373-28589395 TTGGAGAAAGAGATCAATCAAGG + Intronic
929801831 2:45111197-45111219 ATTCAGAGACAGATTGAGCACGG - Intergenic
930298499 2:49585308-49585330 ATGAAGAGACACATAAAGCAAGG - Intergenic
932360634 2:71102747-71102769 TTGAAGAGACAGAGCAAGCATGG + Intergenic
938971255 2:136435029-136435051 AAGGAGAGACAAATTAAGGATGG - Intergenic
939354102 2:141078538-141078560 TTGAACAGACATATAAAGCAAGG + Intronic
940328292 2:152448534-152448556 TTGGAAAGACAGATTAAATGTGG + Intronic
944531388 2:200670923-200670945 TTGAAGAGACAGAGTAATGACGG - Exonic
944815772 2:203373616-203373638 TTAGAAAAAAAGATTAAGCAAGG + Intronic
946886044 2:224223979-224224001 ATGTAGAGTCAGATTAAGAAGGG + Intergenic
1170466251 20:16625086-16625108 TTGGAAAAACAGATTATGGAAGG - Intergenic
1172461986 20:35126120-35126142 TTGGAGGGACAGGTTGAGGATGG - Intronic
1172641322 20:36442096-36442118 CTGGAGATACAGATTAGGGATGG - Intronic
1173693595 20:44986417-44986439 TTGTTGAAACAGATTGAGCAAGG + Intronic
1173771026 20:45657706-45657728 TTAAAGAGAAAAATTAAGCATGG - Intronic
1174952722 20:55060570-55060592 TTGTTGAGAAAGTTTAAGCAGGG + Intergenic
1175421260 20:58835390-58835412 TGGGGGAGACAGATGAATCATGG - Intergenic
1178232259 21:30799652-30799674 TTGCAGAGACAGATTCAAGAAGG + Intergenic
1179286106 21:39978554-39978576 TGGGAGAGACAGCATGAGCAGGG + Intergenic
1180556141 22:16577255-16577277 TTGTAGTGACAGATTAAATAAGG - Intergenic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182652145 22:31860842-31860864 TTGGAGAGATACATTGAGCCAGG - Intronic
1184195530 22:42925090-42925112 TGGGAGAGAAAAATAAAGCAGGG - Intronic
1184934718 22:47712894-47712916 ATGGAGAGACAGAAAATGCAAGG - Intergenic
949517082 3:4817646-4817668 TTGAGGAGACAGAATAAGTAAGG - Intronic
949952455 3:9240484-9240506 TTGGAAAGAAAGATGAGGCAAGG - Intronic
949965866 3:9355678-9355700 TTAGGGAGAAAAATTAAGCAAGG - Intronic
951828301 3:26894060-26894082 ATGGGTAGACAGAATAAGCATGG - Intergenic
952865270 3:37851086-37851108 TTGAAAAGACAGATTAGGCTGGG + Intergenic
958942002 3:100327078-100327100 TTGGAGAAATTGATTAAGGAAGG + Intergenic
959333410 3:105035226-105035248 TTAGAGAGACAGCTTAAAAACGG + Intergenic
960357316 3:116669603-116669625 TTATAGAGACAGCTTAAGGAGGG + Intronic
960885345 3:122388215-122388237 TTGGAGATACTGAGTAAGGAAGG + Intronic
963202994 3:142603230-142603252 TTGGTGAGACATATGTAGCATGG + Intronic
963641601 3:147867164-147867186 TTAGGGAGGCAGATTAAGAAGGG - Intergenic
965225073 3:165978392-165978414 TTGGAGAGACTGAAGAATCAGGG + Intergenic
967292225 3:187932410-187932432 TTGGTGACACAGGTAAAGCAGGG + Intergenic
967961448 3:194928565-194928587 GTGGAGAGACTGAGTAGGCAGGG - Intergenic
969892664 4:10274196-10274218 TTGGACAGACAGGCCAAGCATGG - Intergenic
970017298 4:11526256-11526278 TTGGAGAGTAAGAATAAGAAGGG + Intergenic
971290395 4:25332498-25332520 TTGGAGAGAGAAAATAATCATGG - Intronic
972784320 4:42312854-42312876 TTAGAGAAACAGGTTAAACACGG - Intergenic
973071831 4:45869738-45869760 TTGGAGAAACTTATTTAGCAGGG + Intergenic
975703570 4:77089843-77089865 TTAGAGAGACAGTTTAATAACGG + Intergenic
977358289 4:95974031-95974053 TTGGAGGAACAGATTACACAGGG - Intergenic
978177699 4:105754218-105754240 TTGGAGAGATACCTGAAGCAAGG + Intronic
980280437 4:130711764-130711786 TTGGATAGGGAGATTAAGGAAGG - Intergenic
980401883 4:132298742-132298764 TTGGAGAGAATTATTAGGCATGG - Intergenic
980538286 4:134159488-134159510 TTGGGGAGGGAGAGTAAGCATGG + Intergenic
983699008 4:170568308-170568330 CTGGAGAGATATATTAAGGAAGG - Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
984764389 4:183388473-183388495 TTGGAGAGACTGATTAATATAGG - Intergenic
988279053 5:29121520-29121542 TGGGAGAGAAAGATCAAGAAAGG + Intergenic
990448406 5:55914160-55914182 TTGGAGAGACAGCTCAACCAGGG - Intronic
992398431 5:76388922-76388944 TTAGAGAGAAAGATTAACCACGG - Intergenic
992558071 5:77922663-77922685 TTGGGGAGACAGATTCAGTCAGG - Intergenic
995333322 5:110970233-110970255 TAGGAGAGACAGACAAATCATGG + Intergenic
997070456 5:130616489-130616511 GTGGAGAGCAAGAATAAGCAAGG - Intergenic
998712128 5:144838545-144838567 TTTTGGAGACAGATAAAGCAGGG + Intergenic
998899480 5:146837892-146837914 TCAGAGAAACTGATTAAGCAGGG + Intronic
1000039568 5:157475079-157475101 TTGGAGAGACACATTACGCCTGG - Intronic
1005151501 6:22756927-22756949 TTGGAGAGAAAGAAAAGGCAGGG + Intergenic
1009691834 6:67044583-67044605 TTTCAGAGAGAGATGAAGCAGGG + Intergenic
1011077342 6:83450951-83450973 TTGAAGAGACAGTTTATGGAAGG + Intergenic
1013659412 6:112279641-112279663 TTGGAGAAACAGCTAAAGCAAGG + Intergenic
1013723851 6:113067291-113067313 TTGGAGAGAAAGAGTATACATGG - Intergenic
1015623626 6:135157951-135157973 TTGAAGAGAAAAATTCAGCAAGG + Intergenic
1017568889 6:155720553-155720575 ATGGAGAGAAAAATAAAGCATGG + Intergenic
1018285899 6:162237206-162237228 TTGGAAAGATAAATTTAGCATGG + Intronic
1018441026 6:163813574-163813596 TCAGAGAGACTGGTTAAGCAAGG - Intergenic
1019480760 7:1265657-1265679 TTGGAGAGACAGATTGTGTATGG + Intergenic
1019949047 7:4356071-4356093 CTGGGGAGAAAAATTAAGCATGG - Intergenic
1020404311 7:7814779-7814801 TGGGAGAGACAGGTTAAGGAAGG - Intronic
1020903873 7:14040818-14040840 GTAGACAGACACATTAAGCAAGG - Intergenic
1021132491 7:16927994-16928016 CTGTGGAGATAGATTAAGCAGGG - Intergenic
1021493776 7:21249471-21249493 TTTCACAGACAGATTAAGTAAGG + Intergenic
1022184328 7:27952384-27952406 TTGGTGACACAGATGAAGCATGG - Intronic
1023359301 7:39399545-39399567 ATGAAGAGACACATAAAGCAAGG + Intronic
1026864881 7:73817400-73817422 CTGGAGAGAAAAATTAAGAAGGG - Intronic
1027200560 7:76061477-76061499 TCGAAGAGACAGTTTAAGCCTGG + Intronic
1028051325 7:86191624-86191646 ATGGAGAGAAAGTATAAGCACGG - Intergenic
1028318415 7:89433268-89433290 TTGGATAGATAGATTAAGGGAGG - Intergenic
1028363909 7:90005006-90005028 CTGTAGAGACAGATAAAGCGTGG + Intergenic
1028875925 7:95823386-95823408 TAGGAAAGACAGATTAAGAATGG - Intronic
1029175665 7:98662665-98662687 TTGCAGAGACTGTTTAAGGAGGG + Intergenic
1030065240 7:105654368-105654390 TTGGGGATAGAGATTAAACACGG - Intronic
1033413430 7:141141193-141141215 TTGGAGCAACAAAATAAGCAAGG - Intronic
1034066804 7:148144794-148144816 CTGGAGACACACATTAAGCGAGG + Intronic
1034450418 7:151134365-151134387 TGGGAGAGACAGATGAAGACTGG - Intronic
1035836107 8:2753863-2753885 TTGGTGAGGCAGATGAAGCAAGG + Intergenic
1036103979 8:5819751-5819773 TTAGAGAGACATCTTACGCATGG + Intergenic
1037924384 8:22833025-22833047 TGGGTGAGACAGGGTAAGCAGGG - Intronic
1039169631 8:34728164-34728186 TTGGAGAAACAGATTATTCTTGG + Intergenic
1039183975 8:34895858-34895880 TTGGAGAGGGGGATTTAGCAGGG - Intergenic
1039415222 8:37387557-37387579 TTGGAGAGAAACAGTCAGCATGG + Intergenic
1039513218 8:38108348-38108370 TTGGATAGACAGTTTAGGAAAGG + Intronic
1042588412 8:70369347-70369369 TTAGAAAGCCAGATTAATCAGGG - Intronic
1042917325 8:73888525-73888547 TTAGAGAGACAGTTTAACAATGG - Intergenic
1043058310 8:75468343-75468365 TGGGAGATGCAGACTAAGCATGG - Intronic
1043604542 8:81984354-81984376 TTGGAGGGATAGATTAAAGATGG - Intergenic
1044691559 8:94885142-94885164 TTGGAGAAAGAGATTTAGCCAGG + Exonic
1046209097 8:111043258-111043280 TAGGATAGACACATAAAGCAAGG - Intergenic
1046335194 8:112776971-112776993 CTGGATAGAATGATTAAGCATGG + Intronic
1046576364 8:116034916-116034938 CAGGAGAGAGAGATTATGCAGGG + Intergenic
1047817397 8:128479657-128479679 TTGGAAAGATGGAGTAAGCAAGG + Intergenic
1050313247 9:4374303-4374325 TTGCAGGGATAGATAAAGCAGGG - Intergenic
1050614393 9:7386993-7387015 TTGCAGAGATAGAATAAGCGAGG - Intergenic
1050710899 9:8462040-8462062 ATGAAGAGACAGATTCTGCATGG - Intronic
1051369616 9:16347180-16347202 ATTGAGAGCCAGTTTAAGCAAGG - Intergenic
1052384788 9:27809577-27809599 TTGGAGGGACAGGTTAAGGGAGG + Intergenic
1052955442 9:34250201-34250223 TTGGAGAGGCAGAGAAAGGAGGG - Intronic
1053184766 9:36006218-36006240 TTGGAGAGACAAATGTGGCAAGG + Intergenic
1053290628 9:36877564-36877586 TTGGAGAAACAAGTGAAGCAAGG - Intronic
1053528412 9:38853262-38853284 TTTGAGAAACAGATGAGGCAGGG - Intergenic
1053555365 9:39131861-39131883 TTGGCCAGACAGATTAGGGAAGG + Intronic
1054200638 9:62077695-62077717 TTTGAGAAACAGATGAGGCAGGG - Intergenic
1054637719 9:67510665-67510687 TTTGAGAAACAGATGAGGCAGGG + Intergenic
1058513390 9:105743950-105743972 TTGGAGAGTCAGAATATGTATGG + Intronic
1058581821 9:106466910-106466932 ATGAAGAAACAGATTAAGTAAGG + Intergenic
1060509616 9:124222399-124222421 TTGAAGTGACAGATGAAGCTAGG - Intergenic
1061003903 9:127917425-127917447 TTGGGGAGGGAAATTAAGCAGGG + Intergenic
1061770740 9:132918922-132918944 TAGAAGAAACAGATTATGCAGGG + Intronic
1185942695 X:4339133-4339155 TTGGAGAGGCAGATTGAATATGG + Intergenic
1186644887 X:11495899-11495921 TTGGAGAGACCCATGAGGCAAGG + Intronic
1186828672 X:13367552-13367574 TTGCAGAGACAAATTACGCTTGG - Intergenic
1187296384 X:18005297-18005319 ATGCAGCCACAGATTAAGCATGG + Intergenic
1187599074 X:20806806-20806828 TTGGGGAGACAGGGAAAGCAGGG - Intergenic
1189258194 X:39656692-39656714 TTGGAGAAACAGATTAAAAGAGG + Intergenic
1189578555 X:42381798-42381820 TAGAAGAGACAGATAAAGCAAGG - Intergenic
1195252244 X:103060477-103060499 TTGGAGAGGCACATATAGCAAGG - Intergenic
1195653909 X:107315912-107315934 TTGGAGAGAGAGAGAGAGCATGG + Intergenic
1195970972 X:110472888-110472910 TTGGAGTGAAAGGTAAAGCATGG + Intergenic
1196035539 X:111139829-111139851 TTGGAGGTACAGATTAAGGTAGG + Intronic
1196273320 X:113737342-113737364 TTAGAGAGACTGATTAAAAAGGG - Intergenic
1197067284 X:122248499-122248521 TTGGACAAACAGGCTAAGCATGG - Intergenic
1197173610 X:123461715-123461737 TTGAAGAGAGAGATGAAGCAGGG + Intronic
1198178047 X:134174368-134174390 TTGGAGAGACAGAAGAAGGTTGG + Intergenic
1198620095 X:138498511-138498533 TTGGAGAGACACATGTATCATGG + Intergenic
1198801548 X:140452773-140452795 TTGGAGATACAGAAGGAGCAGGG + Intergenic
1199074478 X:143512865-143512887 TTGGATGGACAGGTTAAGGAAGG - Intronic
1199764704 X:150932663-150932685 TTGGAGGGAGAGACTGAGCATGG - Intergenic