ID: 1119645652

View in Genome Browser
Species Human (GRCh38)
Location 14:76346537-76346559
Sequence CAAGCCCCCATGGTGTCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 94}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119645652_1119645661 17 Left 1119645652 14:76346537-76346559 CCTCAAGACACCATGGGGGCTTG 0: 1
1: 0
2: 0
3: 8
4: 94
Right 1119645661 14:76346577-76346599 CTGAGCCTGGATTTCTGGCTGGG 0: 1
1: 0
2: 2
3: 32
4: 274
1119645652_1119645657 4 Left 1119645652 14:76346537-76346559 CCTCAAGACACCATGGGGGCTTG 0: 1
1: 0
2: 0
3: 8
4: 94
Right 1119645657 14:76346564-76346586 TGGGTGAGCTGACCTGAGCCTGG 0: 1
1: 1
2: 4
3: 24
4: 281
1119645652_1119645660 16 Left 1119645652 14:76346537-76346559 CCTCAAGACACCATGGGGGCTTG 0: 1
1: 0
2: 0
3: 8
4: 94
Right 1119645660 14:76346576-76346598 CCTGAGCCTGGATTTCTGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 258
1119645652_1119645658 12 Left 1119645652 14:76346537-76346559 CCTCAAGACACCATGGGGGCTTG 0: 1
1: 0
2: 0
3: 8
4: 94
Right 1119645658 14:76346572-76346594 CTGACCTGAGCCTGGATTTCTGG 0: 1
1: 0
2: 3
3: 24
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119645652 Original CRISPR CAAGCCCCCATGGTGTCTTG AGG (reversed) Intronic
900311581 1:2035878-2035900 CAGGCCCCCATGCTGACTGGGGG + Intergenic
901405316 1:9041262-9041284 CCAGGCCCCAGGCTGTCTTGGGG + Intronic
901926788 1:12571129-12571151 CAAGAGCCCATGGTCACTTGTGG + Intronic
905249596 1:36639347-36639369 CAAGCCCTCATGGTCACATGGGG + Intergenic
909146266 1:71937003-71937025 CAATCCCCCAAGGTGTTCTGTGG - Intronic
912437387 1:109671355-109671377 GAAGCAGCCATGGTTTCTTGGGG + Exonic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
1065181354 10:23129374-23129396 AAAGCCCCCTTGGTGTCTCATGG - Intergenic
1070897246 10:79995394-79995416 CAACCCCCAATGGAGTGTTGTGG - Intergenic
1070961862 10:80505188-80505210 CATGCCCCCAGGGTGCCCTGTGG + Intronic
1071292537 10:84197913-84197935 AAAGCCCCCATGAAGGCTTGGGG - Intronic
1075222001 10:120593064-120593086 CAAGCCCCCATGACTTCTGGGGG - Intergenic
1075486877 10:122829621-122829643 CACTCCCCCAGGGTGTCCTGGGG - Intergenic
1076109621 10:127850927-127850949 CAAGTCCCACTGTTGTCTTGTGG - Intergenic
1079777719 11:24554951-24554973 AAAGCTACTATGGTGTCTTGAGG + Intronic
1080824998 11:35840552-35840574 CAAGCAGCCATGGTGTTTGGAGG + Intergenic
1081224474 11:40503066-40503088 CGAGTCAGCATGGTGTCTTGGGG - Intronic
1085063805 11:73473601-73473623 CAAGCATGCATGGTGTCTTCAGG - Intronic
1085395407 11:76204746-76204768 CAAGCCCCCACGCTGGCCTGTGG - Intronic
1087495937 11:98890790-98890812 GAAGCCACCAAGGTTTCTTGTGG + Intergenic
1088645425 11:111913104-111913126 CAAGCACCAAGTGTGTCTTGAGG - Intronic
1089351981 11:117826687-117826709 TAAGCCTCCATGGAGTCTTTCGG + Intronic
1090393252 11:126403064-126403086 AAAGGCGCCATGTTGTCTTGAGG + Intronic
1091697790 12:2639732-2639754 CAGGCGCCCATGGTGTCATGGGG + Intronic
1093310568 12:17577375-17577397 CAAGCCCAAAATGTGTCTTGTGG + Intergenic
1094371024 12:29737651-29737673 CAAGCCCTTATGGTGTTTTCTGG - Intronic
1098086293 12:66847777-66847799 CCAGCCACCATTGGGTCTTGAGG - Intergenic
1102533414 12:113563679-113563701 CCAGCCTCCAAGGTGGCTTGTGG + Intergenic
1104653117 12:130551871-130551893 CAAGACTACATGGTGACTTGGGG - Intronic
1111779408 13:92702625-92702647 CAAGCCCCCATTTTCTCTTCTGG + Intronic
1112350549 13:98629885-98629907 CAAATCCCCATGGTCTCTTTGGG - Intergenic
1112772051 13:102802341-102802363 GAAGCCCCCTTGGCCTCTTGGGG + Intronic
1115724554 14:36198867-36198889 CATGCCCCCATGGATTCTGGGGG - Intergenic
1117439927 14:55749796-55749818 GCAGGCCCCATGGTGTCTTGTGG + Intergenic
1119645652 14:76346537-76346559 CAAGCCCCCATGGTGTCTTGAGG - Intronic
1119646893 14:76354641-76354663 CGAGACCCCATGGGTTCTTGTGG - Intronic
1119646896 14:76354644-76354666 CAAGAACCCATGGGGTCTCGGGG + Intronic
1127601083 15:60537515-60537537 CAAACCCTTATGGTGTCCTGGGG - Intronic
1128901433 15:71426023-71426045 CATGCTCCCATGGTGCCTTCTGG + Intronic
1129663817 15:77568128-77568150 CAAGTCCCCATGCTGGCCTGAGG + Intergenic
1129687263 15:77693882-77693904 CAGGCCCCCGAGGTTTCTTGAGG - Intronic
1134028056 16:10969714-10969736 CATGCCCAGATGTTGTCTTGGGG + Intronic
1134401104 16:13910506-13910528 CAAGCCCAGATGGTGTTTTTAGG - Intergenic
1138417379 16:56879248-56879270 CCAGCCCCCACTGTGTCTGGTGG - Intronic
1140412996 16:74752751-74752773 CAAGGCCCCAGTTTGTCTTGGGG - Intronic
1140591041 16:76352943-76352965 CATGGTCCCTTGGTGTCTTGGGG - Intronic
1142603912 17:1071341-1071363 CGAGCCCCCAGGGTCTCCTGGGG - Intronic
1144410243 17:14993894-14993916 CAGGCCCCCATGGAATTTTGGGG - Intergenic
1148813069 17:50307147-50307169 AAAGTCTCCATGGTGTCTAGTGG + Intergenic
1149413232 17:56430874-56430896 CAGGACCCAATGTTGTCTTGGGG + Intronic
1152908919 17:82986019-82986041 AAAGCCCTCATGCTGTCTTCAGG + Intronic
1155171088 18:23267282-23267304 CAACCCCCAGTGGTGTCCTGAGG - Intronic
1157482007 18:48060984-48061006 CAAGCCGCCATGGAGTGCTGGGG + Intronic
1158658424 18:59362012-59362034 CAGGGCCCAATGGTGTGTTGAGG - Intergenic
1159935500 18:74363579-74363601 CAGACCCCCATGGTGTCCTGCGG - Intergenic
1164535514 19:29084011-29084033 CTAGCCCCCATGGTGTCCAGAGG - Intergenic
1165284945 19:34833585-34833607 CAAGGCCCCATGTAGTCTTTTGG - Intergenic
927435304 2:23061291-23061313 CCAGCCCCCCTTGTTTCTTGAGG + Intergenic
930675821 2:54199283-54199305 CATACCCACATGGGGTCTTGAGG + Intronic
934043088 2:88146348-88146370 CAAGCTCCCCTGGTGTTTTGGGG + Intergenic
937598358 2:123697392-123697414 CAAGCCCCCATTTTGCCATGGGG - Intergenic
945261402 2:207847144-207847166 GAAGCCACCATTGTGTTTTGAGG - Intronic
945635965 2:212351266-212351288 CAGGCCCCTCTTGTGTCTTGTGG - Intronic
945978112 2:216286201-216286223 CAAGTCCCTATGCTGTCTTTTGG - Intronic
948785924 2:240352963-240352985 CATGCCCCCATGGTGCCTATAGG + Intergenic
1172792550 20:37515856-37515878 CTAGGCCTTATGGTGTCTTGTGG + Intronic
1175219345 20:57408032-57408054 CTAGGTCCCATTGTGTCTTGAGG + Exonic
1175813152 20:61869696-61869718 TAAGCCCCCTTGGAGGCTTGGGG - Intronic
1182858959 22:33542432-33542454 CAAGTCCCCTTGGTGACTTCAGG + Intronic
1184425697 22:44407947-44407969 AAAAACCCCATGGTGTCTTCTGG - Intergenic
1185239244 22:49733787-49733809 CAGGCCCCTGGGGTGTCTTGTGG + Intergenic
949183360 3:1161726-1161748 CAAGACCCCATGGTGCCCTTAGG + Intronic
949439057 3:4060973-4060995 TAAGACCCCAAAGTGTCTTGAGG + Intronic
950856762 3:16112975-16112997 CAAGCTACCATGCTCTCTTGTGG + Intergenic
953593749 3:44287068-44287090 CAAGCTCCCAGGCAGTCTTGAGG - Intronic
954223210 3:49166904-49166926 CAAGCGCACATGGAGTCTGGGGG + Intergenic
958072488 3:88632273-88632295 CAACCCCCCCTGGTGTCCTCAGG + Intergenic
959261035 3:104080350-104080372 CAAGCCCATATGGTGACATGTGG + Intergenic
961564921 3:127756536-127756558 CATGCCCCCATGGTATGCTGTGG + Intronic
965760588 3:172071672-172071694 CCAGCCTCCATGCTGTCTTGAGG - Intronic
967951820 3:194847278-194847300 CAAGCGCCCATGGTATGTCGGGG - Intergenic
969596171 4:8150420-8150442 CAAGGCCCCATCGTGCCCTGAGG + Intronic
980301678 4:131003537-131003559 CAAACACCCCAGGTGTCTTGCGG + Intergenic
985621691 5:959433-959455 CAAGTCCCCATAGCGGCTTGAGG - Intergenic
993358787 5:86947280-86947302 CCGGCCCCCATGGCTTCTTGTGG + Intergenic
994015264 5:94957488-94957510 CAAGACCCAATGGTGTATTCAGG + Intronic
996642268 5:125770514-125770536 CAAGCCCACATGGATTCATGTGG - Intergenic
997955425 5:138275090-138275112 TCAGCCCCGATGGTGTCGTGAGG + Intergenic
999852762 5:155560545-155560567 CAATGCCGCATGGTGTCTTGTGG + Intergenic
1018111757 6:160543279-160543301 CAAGCCCACAAGGTCTCTGGAGG + Intronic
1018279798 6:162173000-162173022 CAATTCCCCAGGGTGTCTTCAGG - Intronic
1023528668 7:41131070-41131092 CAGGCCCCCACGGTGTCATGGGG - Intergenic
1029170906 7:98628396-98628418 CTACCCCCCACGGTGTCCTGGGG - Exonic
1035373151 7:158391971-158391993 CAGGCCCCCAGGGTGGCTTCAGG + Intronic
1041550721 8:59097715-59097737 AAAGTCTCCATGGTTTCTTGAGG + Intronic
1056680580 9:88714299-88714321 CAAGCCCCCCAGGTCTCTTTTGG + Intergenic
1057034750 9:91803766-91803788 CAAGGCCACATGCTGTCATGAGG - Intronic
1057140900 9:92726289-92726311 CAGGTCCTCATGGTGTGTTGGGG + Intronic
1058634859 9:107028622-107028644 AAAGCCCCCATGTTGTCTAATGG + Intergenic
1061739065 9:132686161-132686183 CAAGTCACAATGGTGGCTTGTGG + Intronic
1187308214 X:18116227-18116249 AAATCCACCATGGTGCCTTGTGG + Intergenic
1193480551 X:82022431-82022453 CAAACTCCCATTGTGTCTGGTGG - Intergenic
1194896673 X:99450527-99450549 CTTGCCCCCATGGTTTCTTCTGG + Intergenic