ID: 1119652999

View in Genome Browser
Species Human (GRCh38)
Location 14:76396960-76396982
Sequence CCGCAGAGACACAAGATTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 94}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119652999_1119653010 19 Left 1119652999 14:76396960-76396982 CCATTAATCTTGTGTCTCTGCGG 0: 1
1: 0
2: 1
3: 11
4: 94
Right 1119653010 14:76397002-76397024 CGCCCGGGCACGGACTGACTCGG 0: 1
1: 0
2: 0
3: 2
4: 41
1119652999_1119653002 3 Left 1119652999 14:76396960-76396982 CCATTAATCTTGTGTCTCTGCGG 0: 1
1: 0
2: 1
3: 11
4: 94
Right 1119653002 14:76396986-76397008 CTCCTCCCACGCCAGCCGCCCGG 0: 1
1: 0
2: 2
3: 63
4: 1110
1119652999_1119653014 25 Left 1119652999 14:76396960-76396982 CCATTAATCTTGTGTCTCTGCGG 0: 1
1: 0
2: 1
3: 11
4: 94
Right 1119653014 14:76397008-76397030 GGCACGGACTGACTCGGGAAAGG 0: 1
1: 0
2: 0
3: 3
4: 84
1119652999_1119653007 9 Left 1119652999 14:76396960-76396982 CCATTAATCTTGTGTCTCTGCGG 0: 1
1: 0
2: 1
3: 11
4: 94
Right 1119653007 14:76396992-76397014 CCACGCCAGCCGCCCGGGCACGG 0: 1
1: 0
2: 0
3: 33
4: 636
1119652999_1119653011 20 Left 1119652999 14:76396960-76396982 CCATTAATCTTGTGTCTCTGCGG 0: 1
1: 0
2: 1
3: 11
4: 94
Right 1119653011 14:76397003-76397025 GCCCGGGCACGGACTGACTCGGG 0: 1
1: 0
2: 0
3: 3
4: 73
1119652999_1119653003 4 Left 1119652999 14:76396960-76396982 CCATTAATCTTGTGTCTCTGCGG 0: 1
1: 0
2: 1
3: 11
4: 94
Right 1119653003 14:76396987-76397009 TCCTCCCACGCCAGCCGCCCGGG 0: 1
1: 0
2: 34
3: 1028
4: 2590

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119652999 Original CRISPR CCGCAGAGACACAAGATTAA TGG (reversed) Intronic
900369040 1:2323384-2323406 CCCCAGAGACACCAGACGAAGGG + Intronic
907559270 1:55373870-55373892 CCGCTTAGCCACAAGATTGAGGG - Intergenic
908845218 1:68317606-68317628 GAGCAGAGACACAAGACAAAAGG - Intergenic
916558277 1:165911341-165911363 GCCCAGAGACAAAAGATTAAAGG - Intronic
920201513 1:204262572-204262594 CCCCAGAGACCCAGGATTTAGGG - Intronic
924364258 1:243273930-243273952 CCACAAATACACAAGATTCATGG - Intronic
1063473020 10:6303989-6304011 CGGCAGAGACACAAGATGAAAGG + Intergenic
1065422642 10:25563927-25563949 ACGCAAAGAAACAAGATTATAGG - Intronic
1073959482 10:108910276-108910298 CCACACAAATACAAGATTAATGG - Intergenic
1074328981 10:112484123-112484145 CAGCAGGTACACTAGATTAAAGG + Intronic
1078165396 11:8878844-8878866 CCACAGAGACAGAAGATAAATGG + Intronic
1078663179 11:13303636-13303658 AGGCAGAGACACAGGATAAAAGG - Intronic
1080381238 11:31774293-31774315 CCTCAGAGAAAAAAGATTAAGGG - Intronic
1080416255 11:32072583-32072605 CGGCCGAGTCACAAGATTCAAGG + Intronic
1080871796 11:36243039-36243061 CGGCAGAGACACAGGATGGAAGG - Intergenic
1084112905 11:67024924-67024946 CCGCCGAGGCACAACATTCATGG + Intronic
1088599087 11:111459920-111459942 CTGCTGAGACCCAAAATTAAAGG + Intergenic
1088755823 11:112884458-112884480 CCAAAGAGACACATGGTTAAGGG - Intergenic
1090656728 11:128851887-128851909 CCACAGACACACAAGATCTAAGG + Intronic
1092831013 12:12444376-12444398 CGGCAGAGCCACAAGATAGAAGG - Intronic
1092925851 12:13271500-13271522 CCGCTGAGCCTAAAGATTAACGG - Intergenic
1093920101 12:24849845-24849867 CCACAGGGACACTGGATTAAAGG + Exonic
1094365744 12:29678506-29678528 ATGCAGAGCCACAAGATTGAGGG + Intronic
1100167611 12:91935391-91935413 CTGCAGAAACACTAGACTAAAGG + Intergenic
1100368980 12:93947729-93947751 GCCCAGAGACAAAAGATTAGAGG - Intergenic
1101329669 12:103747430-103747452 TGGCAGAGCCACAAGATAAAAGG - Intronic
1114517137 14:23307354-23307376 TGGCAGAGACACAAGATGAGGGG - Intronic
1118453001 14:65920973-65920995 CCGCATAGACACAAGGTAGATGG + Intergenic
1119652999 14:76396960-76396982 CCGCAGAGACACAAGATTAATGG - Intronic
1121718555 14:96093293-96093315 TCCCAGAGACACAAAGTTAAGGG - Exonic
1122547248 14:102530487-102530509 CGGCAGAGCCACAGGATGAAAGG - Intergenic
1125720524 15:41843034-41843056 CCTCACAGACACAGGATTATTGG + Intronic
1127655369 15:61050660-61050682 GCGCAGAGTCACAAGAGTCAGGG + Intronic
1130410668 15:83645668-83645690 ATGCAGAGCCACAAGATGAAAGG - Intergenic
1131990704 15:98089919-98089941 CCACAGACACACAGGACTAAAGG + Intergenic
1132857817 16:2054840-2054862 ACACAGAGACCCAAGACTAATGG - Intronic
1133022474 16:2972902-2972924 CGGGAGAGACACAGGATAAAAGG + Exonic
1133474127 16:6103591-6103613 CAGCAGAGTCACAAGATGGAAGG - Intronic
1135031052 16:19039032-19039054 GGGCAGAGCCACAAGATGAACGG - Intronic
1137908933 16:52355836-52355858 GGCCAGAGAAACAAGATTAAAGG - Intergenic
1137910454 16:52372936-52372958 CCAAAGAGACACAAAATTATTGG + Intergenic
1143433616 17:6905701-6905723 ATGCAGAGCCACAAGATGAAGGG - Intronic
1150576850 17:66438151-66438173 CCGCAGTCACACAAGATGAAGGG - Intronic
1151102321 17:71570257-71570279 ACACAGAGAAACAAGATTTAAGG + Intergenic
1156287898 18:35716900-35716922 CCACAGAGAAAAAAGATAAAGGG + Intergenic
1157656209 18:49391646-49391668 CTGGAGAGACAGAAGAATAAAGG + Intronic
1158380518 18:56924965-56924987 TCACAGAGACAGAAGATTAATGG - Intronic
1165181648 19:33976783-33976805 GCTCAGAGACACAACATGAAAGG - Intergenic
925436713 2:3844493-3844515 TCTCAGAAACACATGATTAAGGG + Intronic
927069965 2:19517895-19517917 CCACAGAGACACAAGTTTCAGGG + Intergenic
938374040 2:130793317-130793339 AGGGAGAGACACAAGATAAATGG - Intergenic
940375930 2:152958727-152958749 CTGCAGATATACAAGATTAGGGG - Intergenic
942841134 2:180362212-180362234 CAGCAGAGAAACAAAATTACTGG + Intergenic
942980315 2:182072833-182072855 CTGGAGACAGACAAGATTAAAGG - Intronic
1173882105 20:46423234-46423256 CCTCAGAGAAACCAGATTGAGGG + Intronic
1175609070 20:60335054-60335076 GCTCAGAGACCCAAGAATAAAGG + Intergenic
1182011430 22:27003895-27003917 ATGCAGACACACAACATTAATGG + Intergenic
949316258 3:2759015-2759037 CCACAGAGACAGTAGATTAGTGG - Intronic
949736692 3:7180716-7180738 CGGCATAGAGACAAGATTTAGGG - Intronic
952146275 3:30536411-30536433 CTGTAGAGACAGCAGATTAATGG + Intergenic
952172669 3:30826104-30826126 AGGAAGAGACATAAGATTAAAGG - Intronic
952193003 3:31043333-31043355 CACCATAGACACAAGTTTAATGG - Intergenic
961071722 3:123936038-123936060 CTGCAGATACAGAAGATAAAGGG - Intronic
962183028 3:133227989-133228011 CCATAGAGACAATAGATTAATGG + Intronic
963708197 3:148714836-148714858 GCCCAGAGACACAGGATTACAGG - Intronic
966007097 3:175027913-175027935 CCACCGAGATACAAGATAAAGGG - Intronic
967597603 3:191345637-191345659 CCGCAGATACACCAGATTGCAGG - Intronic
977531391 4:98204539-98204561 ACTCAGAGACACAAGAATACAGG - Intergenic
978508522 4:109488304-109488326 CTGTAGAGACAGAGGATTAATGG - Intronic
978890483 4:113820659-113820681 CTGCAGAGACAGAAGAATGAAGG + Intergenic
980291407 4:130850764-130850786 TGGCAGAGACACAGGATTACTGG - Intergenic
992613800 5:78531031-78531053 CAGCAGAGGCACAAAATTTAAGG + Intronic
995487341 5:112652222-112652244 CCACAGAGACAAAAAATTAAAGG + Intergenic
997066035 5:130560025-130560047 TGGCAGAGACACAACATGAAAGG + Intergenic
998853971 5:146377135-146377157 CCCCAGAGACAGAGAATTAATGG + Intergenic
999905965 5:156141618-156141640 CCTCAGAGATACAAGATAAATGG + Intronic
1001054330 5:168436615-168436637 CAGCGGAGACACAGGATGAAAGG - Intronic
1002634082 5:180598583-180598605 CCACAGAGAGAGAGGATTAAGGG - Intergenic
1006556693 6:34872968-34872990 CAGGAGAGGCACAAGAATAAGGG + Exonic
1007822830 6:44573581-44573603 TGGCAGAGACACAAGATGGAAGG + Intergenic
1009659994 6:66599111-66599133 AGACAGAGAAACAAGATTAATGG - Intergenic
1015126472 6:129760689-129760711 CCTCACAGACCCAAGTTTAATGG + Intergenic
1017981165 6:159402064-159402086 CCACAGAGACACCACATTCAGGG + Intergenic
1022377894 7:29831724-29831746 TGGCAGAGCCACAAGATGAAAGG - Intronic
1030064693 7:105650577-105650599 CAGCAGAGACAAAAGAAAAATGG + Intronic
1031901544 7:127416874-127416896 TAGCAGGGTCACAAGATTAAAGG + Intronic
1036124847 8:6053147-6053169 CAGCATAGAACCAAGATTAATGG - Intergenic
1038215183 8:25555501-25555523 AGGCAGAAACACAAGATTAATGG - Intergenic
1038259263 8:25978992-25979014 CCTCCGTGTCACAAGATTAAGGG - Intronic
1038950802 8:32411982-32412004 CCACAGACACACCTGATTAATGG - Intronic
1040425703 8:47283494-47283516 ACACAGAGACACAAGTTTATAGG + Intronic
1041477811 8:58285202-58285224 CCACAGATGCAAAAGATTAATGG - Intergenic
1042225859 8:66513785-66513807 CTGCAGAGACCCAGGATTATTGG - Intronic
1045379205 8:101606238-101606260 CCAAAGAGACCCAAGATTAGAGG - Intronic
1048406185 8:134124586-134124608 CTGCTGAGACACAGGATTCAAGG - Intergenic
1049584650 8:143427287-143427309 CCGCAGAGACCCAAAAGCAAAGG + Intronic
1049659555 8:143813660-143813682 CTGCAGAGACACATCATTCAGGG + Exonic
1055176975 9:73331662-73331684 AAGAAGAGACACAAGATTAATGG - Intergenic
1056915622 9:90743665-90743687 CCCCAGAGACACTAGATTCAAGG + Intergenic
1189596529 X:42572130-42572152 CCGTAGAGACAAAAGGTTAGTGG - Intergenic
1193822532 X:86183636-86183658 CGGCAGAGACACAACAAAAAAGG - Intronic
1194518497 X:94889174-94889196 CCACAGAGACAAAAGAAAAATGG + Intergenic
1195769602 X:108336440-108336462 CCATAGAGACAAAAGATTAGTGG + Intronic
1196295369 X:113990879-113990901 ACCCAGAGACACAAAACTAAGGG + Intergenic
1199388510 X:147251433-147251455 CCACAGCAACACAAAATTAAGGG - Intergenic
1200732256 Y:6755133-6755155 TGGCAGAGACACAAGAAAAATGG - Intergenic
1201248664 Y:12033070-12033092 AGGCAGAGACACAAGAAAAAAGG - Intergenic