ID: 1119653628

View in Genome Browser
Species Human (GRCh38)
Location 14:76400993-76401015
Sequence CTTCTTCTCACACATGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 193}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119653628_1119653637 20 Left 1119653628 14:76400993-76401015 CCAGACACATGTGTGAGAAGAAG 0: 1
1: 0
2: 0
3: 16
4: 193
Right 1119653637 14:76401036-76401058 CCCGGGTGTGATCACAGCTCCGG 0: 1
1: 0
2: 3
3: 3
4: 171
1119653628_1119653632 3 Left 1119653628 14:76400993-76401015 CCAGACACATGTGTGAGAAGAAG 0: 1
1: 0
2: 0
3: 16
4: 193
Right 1119653632 14:76401019-76401041 TCCTTTTGCCGTTTTACCCCGGG 0: 1
1: 0
2: 0
3: 5
4: 100
1119653628_1119653639 26 Left 1119653628 14:76400993-76401015 CCAGACACATGTGTGAGAAGAAG 0: 1
1: 0
2: 0
3: 16
4: 193
Right 1119653639 14:76401042-76401064 TGTGATCACAGCTCCGGCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 160
1119653628_1119653631 2 Left 1119653628 14:76400993-76401015 CCAGACACATGTGTGAGAAGAAG 0: 1
1: 0
2: 0
3: 16
4: 193
Right 1119653631 14:76401018-76401040 CTCCTTTTGCCGTTTTACCCCGG 0: 1
1: 0
2: 0
3: 7
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119653628 Original CRISPR CTTCTTCTCACACATGTGTC TGG (reversed) Intronic
900775845 1:4585010-4585032 TTGCTTCTCACAGATGTGTTTGG - Intergenic
901752648 1:11420855-11420877 CTTCTTCTCCCACCTGGGTATGG + Intergenic
903370973 1:22836002-22836024 TTTCATCTCACAGATGTTTCTGG - Intronic
903444148 1:23410117-23410139 CTTCCCCTCTCCCATGTGTCTGG - Intronic
903848897 1:26294668-26294690 CTCCTTCTCACACTTGGGCCAGG - Intronic
905616572 1:39404920-39404942 CTTCTTCCCACCCTTCTGTCAGG + Intronic
909044413 1:70691559-70691581 CTTCTCCTCAGATATCTGTCTGG - Intergenic
913193501 1:116433391-116433413 CTGCCACTCACACGTGTGTCTGG + Intergenic
918202125 1:182277512-182277534 CTTCATCTCTCTCCTGTGTCTGG + Intergenic
919030818 1:192239779-192239801 CTGCTTTTCAGACATGTGGCAGG - Intergenic
919203110 1:194384749-194384771 CTTCTTCTCACTTTTCTGTCAGG - Intergenic
919372190 1:196741911-196741933 CTTCTTCTCTCCCATGGGTATGG - Exonic
919471939 1:197989442-197989464 CTCCTTCTCACATATCTCTCAGG + Intergenic
919596313 1:199567562-199567584 CTTCTTGTCACTCATGTCTTTGG + Intergenic
922205286 1:223441100-223441122 CTTCATCACACAAATGTGTTGGG + Intergenic
923313102 1:232755176-232755198 GTTACTCTCACATATGTGTCAGG + Intergenic
923709245 1:236372530-236372552 CTTCTTGTAACACTTTTGTCTGG + Intronic
1063204420 10:3817234-3817256 CTTGATATGACACATGTGTCAGG + Intergenic
1065599778 10:27356732-27356754 CTGCTGCTCACACTAGTGTCAGG - Intergenic
1067292490 10:44953949-44953971 CTTGTCCTCACAGATGTGTTTGG + Intergenic
1067854707 10:49782229-49782251 CTTCTTGACTCACATGTGTCCGG - Intergenic
1068685312 10:59864886-59864908 CTTGTTCTTACAAATGTGTGTGG - Intronic
1072441931 10:95464580-95464602 CTTTGTCCCACACATGTGACAGG + Intronic
1072494730 10:95945714-95945736 CTGCTTTTCACCAATGTGTCAGG + Intergenic
1072832919 10:98678261-98678283 CTTCTTCTCTGACATGTGGATGG - Intronic
1074578784 10:114696392-114696414 CTTCATTGCACAGATGTGTCTGG + Intergenic
1077780364 11:5321760-5321782 TTATTTCTCACACATGTGGCAGG + Intronic
1079169016 11:18074373-18074395 GTTCTTCTTACACATGACTCTGG + Intronic
1079662463 11:23056801-23056823 CTTCTTTTCCCACATGAGTCAGG - Intergenic
1082585196 11:54928753-54928775 TTTCTTTTCACACTTATGTCTGG - Intergenic
1082588510 11:54974406-54974428 CTTCTTCTCATTCAGCTGTCTGG + Intergenic
1083700583 11:64475202-64475224 CTCTTTCCCACACATGTGTCAGG - Intergenic
1085667041 11:78423138-78423160 CTTATTTTCTCACATGTTTCTGG - Intergenic
1091914335 12:4257851-4257873 CTTCTAGTCATATATGTGTCAGG + Intergenic
1093744422 12:22723314-22723336 CCTCTTCACAGACATTTGTCAGG - Intergenic
1094620672 12:32077487-32077509 CTTCTTTTAACACATCAGTCTGG + Intergenic
1096255487 12:50059532-50059554 CTTCCTCTCACCCATGTGCTGGG + Intronic
1096538462 12:52289904-52289926 CCTCCTCTTACACAGGTGTCTGG + Intronic
1096540317 12:52303460-52303482 CCTCCTCTTACACAGGTGTCTGG - Intronic
1097498225 12:60370363-60370385 CATGTTCTCACACATATGTAGGG + Intergenic
1098661234 12:73096503-73096525 ATTTTTCTCACACATTTCTCTGG + Intergenic
1100772402 12:97937978-97938000 CTTCTTTTCTCAGATGTGTGAGG + Intergenic
1101061709 12:100979279-100979301 ATGGTTCTCAAACATGTGTCAGG + Intronic
1101289310 12:103351587-103351609 TTTCTCCTCAGACATGTGTGAGG - Intronic
1105810482 13:23990929-23990951 CTTCTTGCCACACAGGTTTCAGG - Intronic
1108727048 13:53194167-53194189 CTTCTTGCTACACATGGGTCAGG + Intergenic
1109150240 13:58838019-58838041 CCTCTACTCCCATATGTGTCTGG + Intergenic
1109448698 13:62480372-62480394 CTTCTTGTCACACAAGTCTGGGG - Intergenic
1115796230 14:36939066-36939088 AGTCTTCTCAAACATGTCTCTGG + Intronic
1118287279 14:64487443-64487465 CATCTCCATACACATGTGTCTGG - Exonic
1119653628 14:76400993-76401015 CTTCTTCTCACACATGTGTCTGG - Intronic
1120390641 14:83903465-83903487 CTTCTTCTACCAAATGTATCAGG - Intergenic
1122240304 14:100360546-100360568 CTTCTTCTCACACAGGTCAGGGG - Exonic
1124195766 15:27626723-27626745 CATCTTCTCACTACTGTGTCCGG - Intergenic
1125475522 15:40045682-40045704 CTTCTTCGCACAGAGGTGGCAGG - Intergenic
1127299850 15:57642520-57642542 TTTCTTCCCTCACATGGGTCTGG + Intronic
1129533278 15:76287854-76287876 ATAGTTCTCACAAATGTGTCAGG + Exonic
1129887894 15:79051518-79051540 CTTCTTCTCACCTCTGTGCCAGG + Intronic
1134070965 16:11259478-11259500 TTTCCTCTAACCCATGTGTCGGG + Intronic
1134202183 16:12208353-12208375 CATCTTCTCACTCATTTGTGTGG + Intronic
1135069220 16:19337615-19337637 TTTCTTCTCACTCCTATGTCGGG - Intergenic
1136655381 16:31706248-31706270 CTTCATGTCACACAGGGGTCTGG + Intergenic
1136933101 16:34436249-34436271 TTTCTTCTCCCATCTGTGTCTGG - Intergenic
1136971471 16:34975565-34975587 TTTCTTCTCCCATCTGTGTCTGG + Intergenic
1140128889 16:72140381-72140403 CTTCTTCTAGAACATGTCTCTGG - Intronic
1141834145 16:86527519-86527541 CTTCTCCACACACCTGTGGCAGG - Intergenic
1142933978 17:3311760-3311782 CTTCTTCAGTTACATGTGTCTGG + Intergenic
1144711874 17:17406503-17406525 CTTCTTCTCCAAGATGTGTTTGG - Intergenic
1149827546 17:59843385-59843407 GATCTTCTTACACATGGGTCAGG - Intergenic
1150926577 17:69538747-69538769 CTTCTTCTCTCAAATGTCACTGG + Intronic
1151041071 17:70861479-70861501 CTTCTTCTCACAGCTGAGTGTGG - Intergenic
1152041396 17:77906161-77906183 TTTCTTCTAACACAAGTGTCTGG + Intergenic
1153474741 18:5487244-5487266 CATCTTCTCACTCATATGTGGGG + Intronic
1159157299 18:64601241-64601263 CCTCTTCTCACACATCTGCTAGG + Intergenic
1163055317 19:14713578-14713600 CTTCTTCTCCAACATGTTGCTGG - Intronic
1164625974 19:29728271-29728293 TTGCTTATCACACATGTGTATGG + Intergenic
1165823542 19:38692700-38692722 CTTCTTATCACCCATCTGGCAGG - Intronic
925833091 2:7915539-7915561 CATCTTCACACGCATGTGTGGGG - Intergenic
926105786 2:10149929-10149951 CTTCTTCCCAAACATCTGTGTGG + Intronic
926817705 2:16816239-16816261 CTTCATCTCCCACATCTATCAGG + Intergenic
927236922 2:20883071-20883093 ATTGTCCTCACACCTGTGTCTGG + Intergenic
927690173 2:25202574-25202596 CTGCTGCTCACACAGGTGTGTGG + Intergenic
927880279 2:26685472-26685494 CTCCTACTCGCGCATGTGTCTGG + Intergenic
928483504 2:31707010-31707032 CTTCTTCTCACACCTGCAGCTGG + Intergenic
931799702 2:65746875-65746897 ATTCTTGACACATATGTGTCTGG - Intergenic
933385160 2:81601184-81601206 CTTTCACTCACAGATGTGTCAGG + Intergenic
933441598 2:82321571-82321593 CTTCTTCTCACCCATGCAACTGG - Intergenic
934992272 2:98930206-98930228 CTTCTCCTCACACATTAGTGGGG + Intronic
935124126 2:100207898-100207920 CTTCTTATCAGACATGTGCGTGG - Intergenic
937388688 2:121463338-121463360 CTTCTTACCACTCATGTATCTGG + Intronic
938731378 2:134150501-134150523 CTTCTTCTGACACCAGTGCCTGG + Intronic
938750572 2:134325245-134325267 CTTCTTGGAACACATGTGGCAGG + Intronic
941919939 2:170840378-170840400 CTTCTCCTTACAGATGTGGCAGG - Intronic
942295927 2:174517262-174517284 CTACTTCTCTCACATGTTTAAGG - Intergenic
944025687 2:195164066-195164088 TTTCTTCTAACACATTTTTCAGG - Intergenic
944591359 2:201220729-201220751 TTAATTCTTACACATGTGTCAGG + Exonic
945978544 2:216289689-216289711 TTTCTGCCCACACAGGTGTCAGG + Intronic
946160436 2:217832434-217832456 CTTCTTCTCAGAGCTGTGTCAGG - Intronic
946994399 2:225374769-225374791 TTTTTTCTCACTCATGAGTCAGG + Intergenic
947237469 2:227957630-227957652 CTTCTTCACACACAAGTGTTTGG - Intergenic
1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG + Intronic
1169233640 20:3911189-3911211 ATTCTACACACACATGTGTGTGG - Intronic
1169737916 20:8856954-8856976 GTTGTTCTCACTTATGTGTCTGG + Intronic
1170432710 20:16291400-16291422 CTTCCTTGGACACATGTGTCTGG + Intronic
1170618060 20:17969948-17969970 CTTCCTCTTACTCATGTGGCCGG + Exonic
1170705298 20:18738935-18738957 TTTCTTTTCAAACATGTATCTGG - Intronic
1173330817 20:42074958-42074980 TTTCTTCTGACACATTTTTCAGG - Exonic
1174633436 20:51978352-51978374 CCTCTTACCACACATGTGTCAGG - Intergenic
1177033480 21:16012311-16012333 TCTCTTCTTGCACATGTGTCTGG - Intergenic
1178158357 21:29881507-29881529 ATTCATCTAACACATGTATCTGG + Intronic
1181164665 22:20976859-20976881 GTTGTTCTCAAACATCTGTCAGG - Exonic
1181685176 22:24523171-24523193 CTGCTCCTTACACATGTGTGGGG + Intronic
1181933270 22:26420167-26420189 CATCTTATAACACATGTGTGTGG + Intergenic
1183133247 22:35860265-35860287 CTTCTTCACACAGTAGTGTCGGG - Intronic
1184027702 22:41870203-41870225 TTGCTTCTCAGCCATGTGTCTGG + Intronic
1184356120 22:43980623-43980645 TTTCTTCTCAGCCAGGTGTCCGG - Intronic
1185205103 22:49533334-49533356 CCTCTTCTCCCACCTGTGACCGG - Intronic
950697386 3:14713744-14713766 CTTCCTCTCACAGATGAGTAGGG - Intronic
952205084 3:31173117-31173139 CTTCATCTCACTCAAGGGTCAGG + Intergenic
953277734 3:41519740-41519762 GTTCCTCTCAAACATGAGTCAGG - Intronic
958920606 3:100101342-100101364 CTTCTTCCCACAAAAGTCTCTGG - Intronic
961523599 3:127482793-127482815 ATTCTTCTCTCACATTTGCCCGG - Intergenic
964013311 3:151916998-151917020 TTTCTTCTCAGACATGAATCAGG - Intergenic
964096002 3:152932612-152932634 ATTCTTCTCCCACATGAGACAGG - Intergenic
964179827 3:153869491-153869513 ATTCTTCTCACCCATGAGTATGG + Intergenic
968944738 4:3657713-3657735 CTTATTCTCACCAAAGTGTCAGG - Intergenic
971555069 4:28003320-28003342 CTTCTACTGACATATTTGTCAGG - Intergenic
973030641 4:45333257-45333279 CTTCTTTTCACTCATGAGACTGG - Intergenic
979435503 4:120684048-120684070 CTTCTGCTTACTCATGTGCCAGG + Intergenic
979827815 4:125261242-125261264 TTTCTTCAAACACATGAGTCAGG + Intergenic
980041257 4:127943287-127943309 TTTCTTCTCTGACATGTCTCTGG - Intronic
980082461 4:128358470-128358492 TTTCTTGTCACATATGTGTCTGG - Intergenic
982541917 4:156683046-156683068 CTTCTTCTCATATCTGTATCAGG - Intergenic
984372136 4:178882135-178882157 ATTCTTCTCTCCTATGTGTCTGG - Intergenic
985543597 5:498328-498350 CTTCTTGTCACACTTGTCCCGGG + Intronic
987267400 5:16271200-16271222 CATATTCTCACACATTTGTGAGG + Intergenic
987770963 5:22304727-22304749 TTTCTACACACACATTTGTCAGG - Intronic
987785420 5:22492784-22492806 CTTATTCCCACACAGGTGTGTGG - Intronic
987955887 5:24739292-24739314 CTTCCTCTCACACATCATTCAGG - Intergenic
989510537 5:42281876-42281898 GGTTTTCTCACACATGTGTCTGG - Intergenic
997388556 5:133495101-133495123 ATCCTTCTCACAAATGTTTCTGG - Intronic
997762697 5:136464680-136464702 CTTCCTCTAAGACATGTGGCAGG - Intergenic
998517104 5:142766513-142766535 TTTCTTATTAAACATGTGTCCGG + Intergenic
998532273 5:142896476-142896498 TTACTTCTCACACATCTGTGAGG + Intronic
999230476 5:150058924-150058946 ATTCATGTCACACATGAGTCAGG - Intronic
1001748281 5:174108719-174108741 CTGCCTCTCACAAATGTTTCAGG + Exonic
1001834510 5:174820269-174820291 CTTCTACTCACACCTGTGCCCGG + Intergenic
1002461710 5:179377103-179377125 CATCTTCTCACTCCTGTCTCAGG + Intergenic
1003056098 6:2821763-2821785 CTTCTCCTGGCACATGTCTCAGG + Intergenic
1003459245 6:6314772-6314794 CTGGTTTTCACATATGTGTCAGG - Intronic
1004183600 6:13402421-13402443 TTTCTTCTCACATCTGTGACTGG - Intronic
1004873913 6:19936064-19936086 CTTCTTCTCACACATGCATGGGG + Intergenic
1005899582 6:30205986-30206008 CTGCTTCTCAAGCATATGTCTGG + Intronic
1009852231 6:69211673-69211695 CTTCTTCTCACTCAAATGTATGG + Intronic
1010888347 6:81271929-81271951 CTTCTTCCAACACATGTATATGG - Intergenic
1011790106 6:90889754-90889776 CTTCTTATCACACGTGTCTCGGG + Intergenic
1013008409 6:106096793-106096815 CTTCTTCCCATAGATGTCTCAGG + Intronic
1013727657 6:113119623-113119645 CTTCTTGTCACTGATATGTCCGG + Intergenic
1014341537 6:120213893-120213915 CATCTTCTCACAGATATGCCTGG + Intergenic
1016118633 6:140319996-140320018 CTTCTGTTCACACATGGCTCTGG - Intergenic
1018301069 6:162403611-162403633 CTATTTCTGACACCTGTGTCAGG - Intronic
1020332787 7:7036960-7036982 CTTCTAATCACATATGTCTCTGG + Intergenic
1022770392 7:33465544-33465566 CTTATTCTCTCAAAAGTGTCTGG + Intronic
1023052487 7:36265340-36265362 CTTCTTCACAGAAATGTGCCTGG + Intronic
1023090276 7:36610964-36610986 TTTCTTCTCACCCGTGCGTCCGG - Intronic
1024344623 7:48300613-48300635 CTTCTGCTCACTCCTGTCTCTGG - Intronic
1025284827 7:57652765-57652787 CATCTTCTCTGACGTGTGTCCGG + Intergenic
1025769489 7:64490783-64490805 CTACTTGGCACAAATGTGTCAGG + Intergenic
1028350778 7:89844793-89844815 CTTCTTTTGACTCATGTATCAGG + Intergenic
1028998962 7:97132724-97132746 CTTCTTCTGACACATCAATCAGG + Intronic
1032278619 7:130482908-130482930 TTTGTTCTTAGACATGTGTCAGG + Intergenic
1033497805 7:141917274-141917296 CTTCCTCTCAAACCTGTGTTAGG - Intronic
1034875889 7:154724570-154724592 CTCCTACTCACACCTCTGTCAGG + Intronic
1034944962 7:155255895-155255917 TTTCGACTCACACATGTGGCTGG - Intergenic
1035883097 8:3264414-3264436 CTTTTTGCCACACAAGTGTCAGG + Intronic
1036228968 8:6983552-6983574 CATATTCTCACACATGTTTATGG + Intergenic
1036231419 8:7002657-7002679 CATATTCTCACACATGTTTATGG + Intronic
1036233877 8:7021753-7021775 CATATTCTCACACATGTTTATGG + Intergenic
1039729315 8:40257196-40257218 CCTCTTCCTGCACATGTGTCAGG + Intergenic
1040008540 8:42641564-42641586 ATCCTTCTCAGACAAGTGTCAGG - Intergenic
1042207352 8:66342834-66342856 TTTCCTTTCTCACATGTGTCAGG - Intergenic
1042387921 8:68199195-68199217 CTTTCTCTCACACCTGTGTGGGG - Intronic
1042743794 8:72081626-72081648 TTTCTTCTCACAATTCTGTCAGG + Intronic
1044006362 8:86941893-86941915 CATTTTCTCACACATGAGTGAGG - Intronic
1046302513 8:112315023-112315045 CTTCTACTCACTCAGGTGTGTGG + Intronic
1047155814 8:122316748-122316770 CTTCTTATCATACAGGTGTAAGG + Intergenic
1050124655 9:2344229-2344251 CTGCTTCTCACATATGTTACAGG + Intergenic
1055715830 9:79117016-79117038 CCTCTTCTCTCTCTTGTGTCTGG + Intergenic
1055879183 9:80978351-80978373 CATCTTCTCAGTCATGTGTAGGG - Intergenic
1056204389 9:84306151-84306173 CTCCTTCTCCCACTTGAGTCTGG + Intronic
1056684786 9:88750656-88750678 CTGCTTCACACACTTCTGTCTGG - Intergenic
1056941218 9:90958302-90958324 CTACCTCCCAAACATGTGTCAGG - Intergenic
1057243676 9:93435488-93435510 CCTCTCCTCTCACCTGTGTCTGG + Intergenic
1058974107 9:110110099-110110121 GTTCTCCTCACACATATGTGAGG + Intronic
1059613516 9:115924368-115924390 CTGCTTCTGACCCAGGTGTCTGG - Intergenic
1060108812 9:120891884-120891906 CTTCTGCACACAAATGTGCCAGG + Intronic
1060804753 9:126567889-126567911 CATCTTCTCACCCATGTGGGAGG - Intergenic
1061736251 9:132661723-132661745 TTTCTTCTTACTCATGAGTCTGG + Intronic
1061930486 9:133830281-133830303 CTTCTCCTCACTCCTGTGCCTGG + Intronic
1187581566 X:20612744-20612766 CTTCTTTTCTCACATGTCTGGGG + Intergenic
1190038439 X:47049118-47049140 TTTCTTCTAAAACATATGTCTGG - Intronic
1192851966 X:74966402-74966424 GTTCTACTAACACATGTGTTAGG + Intergenic
1194036640 X:88883045-88883067 TTTCTTCTCACCAATGAGTCTGG + Intergenic
1194392424 X:93336715-93336737 CTTCTTCTAACATATGTGACGGG + Intergenic
1197900330 X:131364800-131364822 CTTCTTCTCCCACTTTTATCCGG + Intronic
1198766869 X:140089352-140089374 CATATTCTCACACAGTTGTCCGG + Intergenic
1200169022 X:154058572-154058594 TTATTTCTCACACATGGGTCTGG - Intronic
1202254389 Y:22906044-22906066 GTTCCTCTCATACATGTGTCTGG + Intergenic
1202407380 Y:24539793-24539815 GTTCCTCTCATACATGTGTCTGG + Intergenic
1202463402 Y:25130288-25130310 GTTCCTCTCATACATGTGTCTGG - Intergenic