ID: 1119662070

View in Genome Browser
Species Human (GRCh38)
Location 14:76459302-76459324
Sequence CAGTGGGACTAGAGAGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 330}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119662057_1119662070 26 Left 1119662057 14:76459253-76459275 CCAGTGTGAGCTCCCCGTGTGTG 0: 1
1: 0
2: 1
3: 15
4: 148
Right 1119662070 14:76459302-76459324 CAGTGGGACTAGAGAGGAGCTGG 0: 1
1: 0
2: 2
3: 34
4: 330
1119662061_1119662070 12 Left 1119662061 14:76459267-76459289 CCGTGTGTGCGCATTGAGCGGCT 0: 1
1: 0
2: 0
3: 1
4: 95
Right 1119662070 14:76459302-76459324 CAGTGGGACTAGAGAGGAGCTGG 0: 1
1: 0
2: 2
3: 34
4: 330
1119662060_1119662070 13 Left 1119662060 14:76459266-76459288 CCCGTGTGTGCGCATTGAGCGGC 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1119662070 14:76459302-76459324 CAGTGGGACTAGAGAGGAGCTGG 0: 1
1: 0
2: 2
3: 34
4: 330
1119662058_1119662070 14 Left 1119662058 14:76459265-76459287 CCCCGTGTGTGCGCATTGAGCGG 0: 1
1: 0
2: 1
3: 2
4: 24
Right 1119662070 14:76459302-76459324 CAGTGGGACTAGAGAGGAGCTGG 0: 1
1: 0
2: 2
3: 34
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119662070 Original CRISPR CAGTGGGACTAGAGAGGAGC TGG Intronic
901201841 1:7471620-7471642 CAGTGGGTCAGGGGAGGAGCAGG + Intronic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902615876 1:17623287-17623309 CAGTGGGATTAGAGGGTGGCAGG + Intronic
902702905 1:18184744-18184766 CAGTGGGTCACAAGAGGAGCTGG - Intronic
902820137 1:18938638-18938660 CAGAAGGTCTAGAGAGGTGCAGG - Intronic
903147420 1:21383549-21383571 GAGTGGGAGTGGGGAGGAGCGGG - Intergenic
903209882 1:21812006-21812028 CTGAGGGCCTAGAGAGCAGCAGG - Intergenic
903275036 1:22216197-22216219 CAGTGGGAATGGGGAGGAGAGGG + Intergenic
903560370 1:24222428-24222450 GAGTGGGAAGAGGGAGGAGCAGG + Intergenic
904276427 1:29387643-29387665 CAGGGGGTCTGGGGAGGAGCAGG + Intergenic
904823790 1:33261789-33261811 AAGTGGGAAGGGAGAGGAGCAGG + Intronic
904862168 1:33546569-33546591 CAGTGGCACAGGAGAGGAGATGG - Intronic
905397408 1:37675718-37675740 CAGTAGGACCAGAGAGAAGCTGG + Intergenic
905521759 1:38605777-38605799 CAGGGGGGCTGGAGAGGAGGTGG - Intergenic
905764979 1:40592808-40592830 CAGTGAGGCTAGAAAAGAGCAGG + Intergenic
906125440 1:43424409-43424431 CAGTGAGGATGGAGAGGAGCTGG - Exonic
906498161 1:46320265-46320287 CAGCGGGGTCAGAGAGGAGCTGG - Intergenic
906539737 1:46576087-46576109 AACTGGGGCTAGAGATGAGCCGG + Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
909213008 1:72848119-72848141 AAGTGTTACTAGAGAGGAGAGGG + Intergenic
909579490 1:77218390-77218412 CAGTGGAACTGGAGAGGTGAGGG + Intronic
910737599 1:90478071-90478093 GAGTGGGCCTAGAAAGGGGCAGG - Intergenic
912812691 1:112805838-112805860 TGGTGGGAATAGAAAGGAGCTGG - Intergenic
913207383 1:116552831-116552853 ATGTGGGAGTAGAGTGGAGCTGG + Intronic
913280433 1:117180428-117180450 CAGTGAGAATAAGGAGGAGCAGG - Intronic
913679620 1:121176803-121176825 CAATGGGAGTTGAGAGGAGGAGG - Intronic
914031454 1:143964450-143964472 CAATGGGAGTTGAGAGGAGGAGG - Intronic
914157993 1:145103514-145103536 CAATGGGAGTTGAGAGGAGGAGG + Intronic
914343289 1:146777591-146777613 CAGTGGGAGAAGTGTGGAGCTGG - Intergenic
914947806 1:152081269-152081291 CAGAGGCACTGGAGAGGACCCGG - Intergenic
916581648 1:166114647-166114669 TAGTGGGAGTAGGGAGGAGGTGG + Intronic
916683285 1:167123258-167123280 CAGAGGGACAAGAGAGAGGCTGG - Intronic
916946028 1:169728280-169728302 CAGTGGAACTAGAGAGTACTTGG + Intronic
917186150 1:172358371-172358393 CAGTGGGAAGAAAGAAGAGCGGG + Intronic
918048500 1:180955142-180955164 AAGTGGGGCTGGAGAAGAGCAGG + Intergenic
918975101 1:191473948-191473970 CAGAGGTAATAAAGAGGAGCAGG + Intergenic
919862213 1:201747578-201747600 CAGAGGGAATAAATAGGAGCAGG - Intronic
920466926 1:206195347-206195369 CAATGGGAGTTGAGAGGAGGAGG - Intronic
920742540 1:208595297-208595319 CAGTGGTAATAGGGAGGAGGAGG + Intergenic
923183630 1:231548534-231548556 CAGTGGGAATAGAGAGGAATGGG + Intronic
923784682 1:237055497-237055519 TTGTGGGAATAGAAAGGAGCGGG + Intronic
923933214 1:238727083-238727105 TAGTGGGTCAAGAGGGGAGCTGG - Intergenic
924769860 1:247069853-247069875 CAGGGGGACTAGGGAAGAGGTGG + Intronic
1063178326 10:3571797-3571819 CACTGGGAGGAGAGAGGGGCAGG - Intergenic
1068030777 10:51702241-51702263 CAGTGGGACTAAAGAGAACATGG - Intronic
1068121465 10:52785657-52785679 CAGTGGGGGCATAGAGGAGCAGG + Intergenic
1069890954 10:71652219-71652241 CAGGGAGATGAGAGAGGAGCAGG - Intronic
1069891228 10:71653567-71653589 CAGAGGGACCAGGGAGGAACTGG - Intronic
1071332027 10:84570352-84570374 CCCTGAGACTAGAGAGGAGGGGG + Intergenic
1071888131 10:89972722-89972744 CAATGGGAGCAGAGAGGAGAAGG + Intergenic
1072753575 10:98001870-98001892 CAGTAGGACTGGAGAAGAGAAGG + Intronic
1074705650 10:116127622-116127644 TAGAGGAGCTAGAGAGGAGCAGG - Intronic
1075951418 10:126481006-126481028 CAGTGGGACTGCAGAGCAGAGGG - Intronic
1076320947 10:129580944-129580966 CAGTGGGACCAGACAGCGGCTGG - Intronic
1076694542 10:132240770-132240792 CAGGGGGGTTAGAGAGGAGAGGG + Intronic
1077725011 11:4666008-4666030 CAGTGGGATGAGAGATGAGAAGG - Intergenic
1078598501 11:12710537-12710559 CAGTGAGAATAGAGTGGTGCTGG + Intronic
1078662435 11:13298212-13298234 GAGTGGAGCTAGAGAGGCGCAGG - Intronic
1080103504 11:28486576-28486598 CACTGCCACTAGAGAGGCGCAGG - Intergenic
1081574462 11:44310492-44310514 CAGTGGAAGGAGAGAGGAGGAGG - Intergenic
1081994334 11:47353936-47353958 CAGTAGGACTAGGGAGCTGCAGG + Intergenic
1083894083 11:65611533-65611555 CAGGGGAACTAGAGGGGAGTAGG + Intronic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085364073 11:75921794-75921816 CAGTGGGAAAAGAAAGGTGCTGG - Intronic
1085704164 11:78771045-78771067 CAGCTGGGCTGGAGAGGAGCTGG - Exonic
1086162641 11:83739835-83739857 CAGTGCAGCTGGAGAGGAGCTGG + Intronic
1086312644 11:85551941-85551963 CAGTGGGAAAAGAGAGTATCAGG + Intronic
1086560362 11:88161299-88161321 GAGTGGGAGTAGAGATGAGGAGG - Intronic
1086989547 11:93287990-93288012 CAGTGGGTCTAGGGAACAGCTGG + Intergenic
1087480509 11:98693967-98693989 CATTGAGACTTGAGAGGAGCCGG + Intergenic
1087681693 11:101225070-101225092 CAGTGGCACTGGAGAGTGGCGGG + Intergenic
1087970365 11:104473627-104473649 CAGTTGTTCTAGAGTGGAGCTGG + Intergenic
1088436826 11:109822878-109822900 CAGTTAGCCAAGAGAGGAGCAGG + Intergenic
1089093227 11:115896351-115896373 CATTGGGAAGAGAGAGGAGAGGG - Intergenic
1090414478 11:126531197-126531219 CAGTGGGAATAGAGAGGAAAGGG - Intronic
1090764486 11:129864913-129864935 CAGTGGAATCAGAGAGGAGCCGG + Intronic
1091297399 11:134483447-134483469 CAGTGGGACTCGAGGGGCACTGG + Intergenic
1092025521 12:5236514-5236536 CAGAGGGTATAGAGAGGAACAGG + Intergenic
1092104528 12:5912193-5912215 CAGTGGGTCTAGTGAAAAGCAGG - Intronic
1094525780 12:31229718-31229740 CAGTGGGGCTGGAGAGGCGGTGG - Intergenic
1094573404 12:31662050-31662072 CAGTGTCCCTGGAGAGGAGCTGG + Exonic
1096828059 12:54294520-54294542 CAGAGGGACTGAAGAGGAGAAGG - Intronic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1097780003 12:63691060-63691082 CAGTGAGAGTACAGAGGACCTGG - Intergenic
1097786838 12:63769755-63769777 CAGTGGGGCTTCTGAGGAGCTGG + Intergenic
1099717827 12:86319119-86319141 CAGTAGGAGTAGAAAGGAGTAGG - Intronic
1102534342 12:113569703-113569725 GATTAGGAGTAGAGAGGAGCTGG + Intergenic
1102755809 12:115339271-115339293 CAGTCGGTCTAGAGAGGACAAGG - Intergenic
1104603407 12:130169137-130169159 CAGTGGGGCTAGGGGGAAGCAGG + Intergenic
1105406488 13:20136738-20136760 CTGTGGGAGAAGAGAGGTGCAGG + Intergenic
1105959463 13:25317166-25317188 AAGTGAGACTAGAGATGAGAAGG + Intronic
1106414929 13:29538543-29538565 GAGTGGCACTAGGGAGGAGGAGG + Intronic
1107338916 13:39385397-39385419 CAGTGGGAATGGAAAAGAGCTGG + Intronic
1107460654 13:40598693-40598715 CACTGGGAGTAGAGCAGAGCTGG - Intronic
1108040848 13:46338347-46338369 AAGTGGGAAGAGAGAGGGGCAGG - Intergenic
1108586609 13:51875582-51875604 CAGTGGGTCTGGAGAGGGGTAGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1111991034 13:95117411-95117433 CAGTGGCCCTGGGGAGGAGCTGG + Intronic
1113018237 13:105852909-105852931 CGGTGGGAATAGGGAGGTGCAGG - Intergenic
1114429202 14:22645902-22645924 CAGTGGGGCTGGAGAGGGGGTGG - Intergenic
1114715427 14:24819016-24819038 AGGTGGGCCAAGAGAGGAGCAGG - Exonic
1115966974 14:38901445-38901467 CAGTGGGAGGATGGAGGAGCAGG + Intergenic
1117647432 14:57866237-57866259 CAGTGGGGCGCGAGAGGAGAAGG + Intronic
1118019409 14:61695647-61695669 TCGTGAGACTAGAGAGAAGCGGG - Intronic
1118675792 14:68183397-68183419 CAGTGTGGCTAGAAAGAAGCAGG - Intronic
1119662070 14:76459302-76459324 CAGTGGGACTAGAGAGGAGCTGG + Intronic
1119802464 14:77458009-77458031 CGGTGGGAGTGGGGAGGAGCCGG + Exonic
1119951999 14:78754706-78754728 CAGTAGGTCTAGAGTGGAGTGGG - Intronic
1120356913 14:83445661-83445683 CAGTAGGACTAGATAAGAGCTGG - Intergenic
1121250006 14:92492497-92492519 TACTGGCACTAGAGAGGAACTGG - Intronic
1122015336 14:98790269-98790291 CAGTGGGACCAGGTGGGAGCAGG - Intergenic
1123007703 14:105332392-105332414 CAGTGGGGAGTGAGAGGAGCAGG + Intronic
1125279541 15:38029129-38029151 CAGTGGGAGTAGTGATGATCTGG + Intergenic
1125944845 15:43704476-43704498 CAATGAGACCAGATAGGAGCAGG + Intergenic
1127172907 15:56322194-56322216 CAGTGTGGATAGAGAGGAGTAGG + Intronic
1128214000 15:65921950-65921972 CTGTGGGAGTGCAGAGGAGCTGG - Intronic
1128683134 15:69665908-69665930 CAGTGGGAGGAGAGAGGGGCTGG + Intergenic
1129789206 15:78329548-78329570 CAGTGGGGCAAGCGGGGAGCTGG - Intergenic
1129889958 15:79065449-79065471 CCGTGGGAGGAGAGAGCAGCAGG + Intronic
1130234297 15:82119951-82119973 CAAGGGAGCTAGAGAGGAGCTGG - Intergenic
1131259236 15:90880015-90880037 CAGTGGGACCTGAGAGTCGCAGG + Intronic
1131290374 15:91101581-91101603 CAGTGAGAGCAGAGAGGAGGAGG + Intronic
1132846184 16:2001914-2001936 CAGTGGGAAGGGAGAGGAGGAGG + Intronic
1133816790 16:9203723-9203745 CAGTGGGATGAATGAGGAGCTGG - Intergenic
1135520464 16:23172938-23172960 CAGTGGGGCTGGGGAGGGGCTGG - Intergenic
1136466938 16:30450772-30450794 CTGTGGGACTTAAGAGTAGCAGG + Intergenic
1137674920 16:50299464-50299486 CAGGGGACCTAGAGGGGAGCGGG - Intronic
1138008372 16:53357374-53357396 CAGTGGGACTTGAGAGATGTGGG + Intergenic
1139990699 16:70937736-70937758 CAGTGGGAGAAGTGTGGAGCTGG + Intronic
1141005168 16:80345144-80345166 CAGTGGGTTTAGGTAGGAGCTGG - Intergenic
1141506912 16:84483848-84483870 CAGTGGGGCTTGAGAGCATCGGG + Intronic
1142502335 17:340060-340082 CAGTGGGTCTGGTGGGGAGCAGG - Intronic
1143622078 17:8086465-8086487 GAGTGGGAGAAGACAGGAGCTGG - Intronic
1144833801 17:18146110-18146132 GAGTGGGACTGGATAGGGGCTGG + Intronic
1145939337 17:28734332-28734354 CACTGGGACCAGAGAGGACAAGG - Intronic
1146907884 17:36629690-36629712 CAGAGGGACCAGAGGGCAGCTGG + Intergenic
1147006362 17:37407009-37407031 TAGCGGGACTAGGGAGAAGCGGG + Intronic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1147542799 17:41374987-41375009 CAATGGGAATAGAGTTGAGCTGG + Intronic
1148582444 17:48753021-48753043 TGTTGGGACTAGAAAGGAGCGGG + Intergenic
1149611139 17:57958302-57958324 CAGGGGGAATAGAGTGGGGCAGG + Intergenic
1149775654 17:59354892-59354914 CAGTGAGAGAAGAGAGGAGTTGG + Intronic
1151247683 17:72807666-72807688 CAGTGGGCCTGGAGAGGAAATGG + Intronic
1152285445 17:79410053-79410075 GAGTGGCAGTGGAGAGGAGCAGG - Intronic
1152932404 17:83116553-83116575 CAGTGGGACTGGAGTTGAGCTGG - Intergenic
1154197442 18:12276913-12276935 CAGTGGGTCTGGCCAGGAGCAGG - Intronic
1156492697 18:37505731-37505753 CAGTGGGGCTAGAGAGGTTAAGG - Intronic
1157161665 18:45319143-45319165 CAGTGGTCCTAAAGAGGAGCTGG - Intronic
1157188786 18:45562866-45562888 CAGAGGGACCAGAGCAGAGCAGG - Intronic
1157327783 18:46681385-46681407 CAGTGGGAGATGAGAGGAGGGGG - Intronic
1157627369 18:49061683-49061705 CAGTGGGAACAGAGGAGAGCTGG + Intronic
1158499178 18:57984486-57984508 CTGTGGGACAAGAGAGCAGCTGG - Intergenic
1159012972 18:63075762-63075784 CGGTGGCACTAGAGATCAGCAGG - Intergenic
1160372204 18:78383194-78383216 CAGAGTGAGTAGAGAGGACCTGG - Intergenic
1161694489 19:5758419-5758441 CGGTGGGACTAGAACAGAGCAGG + Intronic
1164771732 19:30815030-30815052 CAGTGTGACTAGAGAGGAGGAGG + Intergenic
1165152198 19:33767327-33767349 CTGTGAGCCTAGAGAGGAGCGGG + Intronic
1165460896 19:35943809-35943831 CAGGGAGGCTAGAGCGGAGCTGG + Intronic
1165556590 19:36637990-36638012 CAGTGGGATTAAAGAGTATCTGG - Exonic
1166665340 19:44676441-44676463 CAGTGGGAGCAGACAGGAGAGGG - Intronic
1167716083 19:51143641-51143663 GAGAGGGGCTGGAGAGGAGCTGG - Intronic
925814260 2:7732369-7732391 AAGTGGGAATGGAGAGGAGCAGG - Intergenic
926331801 2:11831987-11832009 CATGGGGAGGAGAGAGGAGCAGG + Intergenic
926432178 2:12799071-12799093 GAGTGAGAATAAAGAGGAGCAGG + Intergenic
926504826 2:13700359-13700381 AAATGAGACTAGAGAGGACCTGG + Intergenic
926634201 2:15163287-15163309 GAGTGGGACTAGAAGGGAGAAGG + Intergenic
927783090 2:25954890-25954912 CAGTGGCTTTGGAGAGGAGCAGG - Intronic
928077476 2:28278358-28278380 CAGTGGGAATAGGGAGGAAGAGG + Intronic
928615285 2:33032000-33032022 CACAGGGACTTGAGAGGAGAGGG + Intronic
929450644 2:42034800-42034822 CAGTGGGACTAGGAAAGAGAAGG + Intergenic
932418349 2:71586935-71586957 CAGTGGGAGTAGGGAGGATAGGG - Intronic
932460066 2:71876268-71876290 CAGTGGGAATAGAATGGTGCTGG + Intergenic
932468744 2:71940208-71940230 AACTGGGGCTAGAGAGGAGGAGG - Intergenic
934067067 2:88350467-88350489 CAGTGGGTCTGGGGAGGAGGAGG + Intergenic
934077333 2:88439310-88439332 CAGTGGGAGCAAAGAGGGGCTGG - Intergenic
934981768 2:98849088-98849110 CAGTGGGGCTCAAGAGAAGCTGG + Intronic
937261887 2:120591822-120591844 TAGGAGGACTAGGGAGGAGCTGG - Intergenic
938176992 2:129142812-129142834 CGGTGGGAGTGGAGTGGAGCAGG - Intergenic
938900089 2:135792310-135792332 CAGTGGAATTAGGGAGGGGCAGG + Intronic
942976141 2:182020664-182020686 CAGTGGGGAAAGAGAGGATCAGG - Intronic
943178882 2:184515993-184516015 TAGAGAGACTAGAGAGAAGCAGG + Intergenic
944508273 2:200438114-200438136 CCATGGGAGTAGAGAGAAGCAGG + Intronic
945923452 2:215779669-215779691 AAGTGGGACTTGAGTTGAGCAGG - Intergenic
946085158 2:217163458-217163480 CAGAGGAACCAGAGAGGATCTGG + Intergenic
946375023 2:219302687-219302709 CAGAGGGGACAGAGAGGAGCTGG + Exonic
946434457 2:219642535-219642557 CTGGGGGACTTGAGGGGAGCGGG + Intergenic
947763444 2:232620789-232620811 CACTGGGTCTGGAGATGAGCGGG - Intronic
947876279 2:233470159-233470181 CAGTGGGGGGAGGGAGGAGCGGG - Exonic
948010108 2:234645678-234645700 CAGTGGGAGTAGACAGCAGTGGG - Intergenic
948010195 2:234646032-234646054 CAGTGGGAGTAGGCAGCAGCGGG - Intergenic
948010269 2:234646333-234646355 CAGTGGGAGTAGGGAGGCACGGG - Intergenic
948010285 2:234646398-234646420 CAGTGGGAGTAGGCAGCAGCGGG - Intergenic
948010501 2:234647237-234647259 CAGTGGGAGTAGGGAGGCACGGG - Intergenic
948010517 2:234647302-234647324 CAGTGGGAGTAGGCAGCAGCGGG - Intergenic
948010591 2:234647603-234647625 CAGTGGGAGTAGGGAGGCACGGG - Intergenic
948010607 2:234647668-234647690 CAGTGGGAGTAGGCAGCAGCGGG - Intergenic
948010797 2:234648434-234648456 CAGTGGGAGTAGGGAGGCACGGG - Intergenic
948010811 2:234648485-234648507 CAGTGGGAGTAGGGAGGCACGGG - Intergenic
948010822 2:234648533-234648555 CAGTGGGAGTAGGCAGCAGCGGG - Intergenic
948530166 2:238599158-238599180 TAGTGGGACCAGGGAGGAGAAGG + Intergenic
1169633152 20:7656520-7656542 TAGTGGAACTAGAGTGGGGCTGG + Intergenic
1169806617 20:9566486-9566508 CAGTGGGAGATGAGAGGATCTGG + Intronic
1170064423 20:12295058-12295080 TGGTGGGATTAGAGAGGTGCTGG + Intergenic
1170098744 20:12675455-12675477 CAGTGGGAGGAGAGACAAGCAGG + Intergenic
1170906058 20:20516064-20516086 CAATGGGAGTGGAGAGTAGCAGG - Intronic
1171327869 20:24311553-24311575 CAGTGAGATTAGAGAGGAGGTGG + Intergenic
1171473658 20:25390938-25390960 CCTTGGAACTAGAGAGGAGGTGG - Exonic
1172703380 20:36865546-36865568 CAGTGGGCCGTGAGGGGAGCTGG - Intergenic
1172890591 20:38260953-38260975 CCGTGGGAAGAGCGAGGAGCGGG - Intronic
1173236224 20:41248021-41248043 CAGTGAAACTGGAGAGGCGCAGG - Intronic
1173403834 20:42747932-42747954 CAATGGGGCAAGAGTGGAGCAGG + Intronic
1174061588 20:47836750-47836772 CAGTGAGATAGGAGAGGAGCAGG + Intergenic
1174364713 20:50049622-50049644 GAGTGGCATTACAGAGGAGCTGG + Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175243484 20:57567045-57567067 CACTGGGAGTAGAGGAGAGCAGG - Exonic
1175306282 20:57977836-57977858 CAGTGGGACTAGGGAAGGCCGGG - Intergenic
1175365718 20:58454373-58454395 CAGTCAGTCCAGAGAGGAGCAGG - Intergenic
1176004445 20:62852612-62852634 CTGGGTGACTAGGGAGGAGCCGG - Intronic
1179994141 21:44966223-44966245 CAGCGGGATTGGAGAGGAGCTGG + Intronic
1180629803 22:17220666-17220688 GAGTGGGACTGGGGAGGAGTGGG - Intronic
1180700324 22:17778019-17778041 CACAGGGACTAGTGAGGGGCTGG - Intergenic
1181172153 22:21015796-21015818 AAGTGGGGCCAGAGAGGAGGTGG + Intronic
1182387575 22:29958555-29958577 CACTGAGACAAGAGGGGAGCAGG - Intronic
1183279130 22:36922822-36922844 GACGGGGACTAGAGAGGAGGTGG + Intronic
1184335339 22:43849530-43849552 CAGTGTGACTTCAGAGGAACAGG + Intronic
1184526940 22:45029620-45029642 CAGTGTGTCCAGAGAGCAGCAGG + Intergenic
1184880219 22:47299889-47299911 CACTGGGACTGCAGGGGAGCTGG - Intergenic
1185271546 22:49931618-49931640 CACTGGGACTCGAGAGGCGGAGG + Intergenic
1185281754 22:49972645-49972667 CAGTGGGACCAGGGAGGAGGAGG - Intergenic
949248547 3:1954814-1954836 AAGTGGGACAAGTGAGGAGATGG - Intergenic
950759481 3:15207729-15207751 CAGTGGGACAAGATTGGAGGTGG - Intronic
950874923 3:16263176-16263198 CAGTGTGACCAGAGCAGAGCAGG - Intronic
954043047 3:47904653-47904675 CGGGGGGGCTAGAGAGGGGCGGG + Intronic
954094962 3:48318933-48318955 CAAGGGGAATAGTGAGGAGCAGG - Intronic
954212802 3:49107837-49107859 CAGTGGGATGAAAGAGCAGCAGG + Intergenic
954722761 3:52579775-52579797 CAGTGGGAATTGAGAGCAGGAGG - Intronic
956878854 3:73490445-73490467 CAGTGGGTGTTGAGAGGGGCTGG - Intronic
957343477 3:78931022-78931044 CAATGGGAGGTGAGAGGAGCAGG - Intronic
958794840 3:98695813-98695835 AAGTGGGAGTAGAAGGGAGCTGG - Intergenic
959254088 3:103989061-103989083 CAGTGGGATGGGTGAGGAGCTGG + Intergenic
959600786 3:108182467-108182489 CACTGTGACTAGAGAGGCCCAGG + Intronic
960423869 3:117482358-117482380 CTGTGGGACTTGAGAGGAAGAGG + Intergenic
963071524 3:141308907-141308929 CAGTGGGACAAAAGGGCAGCTGG - Intergenic
963289449 3:143473130-143473152 CAGTGGGAAATGAGAGGAGCTGG - Intronic
963667237 3:148203631-148203653 CAATAGGGCTAGAGAGGAGCTGG + Intergenic
963728229 3:148945834-148945856 CAGTGTGGCTAGAGTGGGGCTGG - Intergenic
964808679 3:160639339-160639361 CATTGGTACTAGATAGAAGCAGG - Intergenic
965513252 3:169592515-169592537 TAGGGGAACTAGAGAGGAGAGGG - Intronic
966431257 3:179833172-179833194 CAGTGGGAATGGAGAGGAAAGGG + Intronic
966747362 3:183290327-183290349 AATTGGGACTTGAGAGGAGAAGG + Intronic
967127697 3:186439899-186439921 CAGTGGGACAGGAGGGGAGGCGG - Intergenic
968058742 3:195712692-195712714 CAGTGGCACTAGAAAGGGGATGG - Intergenic
969895734 4:10302817-10302839 CAATGGGACAAGAGTTGAGCAGG - Intergenic
970254735 4:14155567-14155589 CAGTGGGCGTTGAGAGGAGGTGG + Intergenic
970485538 4:16521100-16521122 CAGGGAGATTAGAGAGAAGCAGG + Intronic
971346629 4:25817481-25817503 CACTGGGCCTACAGAGAAGCTGG + Intronic
971764414 4:30811214-30811236 CAGTGGCACTTGATAGGAGTTGG + Intronic
975060093 4:69986189-69986211 CAGTGGGATGGGTGAGGAGCTGG + Intergenic
975978466 4:80126866-80126888 CAGAGCGACTAGAAAGGAGGAGG - Intergenic
977447074 4:97144481-97144503 AAGTGAGGATAGAGAGGAGCTGG + Intergenic
978293043 4:107168971-107168993 CAGTGGGAGAAGGGATGAGCTGG + Intronic
980623699 4:135344503-135344525 CAATGGGACTGGGGAGTAGCTGG + Intergenic
981420046 4:144538980-144539002 CAATGTGAGTTGAGAGGAGCTGG - Intergenic
981643744 4:146974663-146974685 CAGTTAGACTGGACAGGAGCTGG - Intergenic
984295750 4:177852802-177852824 CAGTGGGACTACTGAGTAGCTGG + Intronic
985045744 4:185938807-185938829 CAGGGGGAGAATAGAGGAGCAGG - Intronic
986294980 5:6430630-6430652 CAGTGGGGACACAGAGGAGCTGG + Intergenic
986823498 5:11495852-11495874 GAGTGGGAGCAGAGAGGAGCTGG - Intronic
989169187 5:38458454-38458476 CAGTGGGACTACAAGGGAACTGG - Intronic
990408484 5:55516226-55516248 CAGTGAGACTAAAGAGGTGGTGG - Intronic
990798756 5:59575067-59575089 CAATGAGACTAGAAAGGAGGAGG + Intronic
992035910 5:72775876-72775898 CTGTGGGACAGGAGAGGAGTAGG - Intergenic
992547836 5:77832483-77832505 CAGTGGGACTAGAGGCGAGGAGG - Intronic
993068895 5:83133940-83133962 CAGTGTGAAGAGAGAGGCGCTGG + Intronic
993970041 5:94408173-94408195 CTTTGGGACTAGATGGGAGCAGG + Intronic
994714717 5:103307415-103307437 CAGTGGGAGGACAGAGGAGAAGG - Intergenic
995229274 5:109740274-109740296 GAGTGAGAGAAGAGAGGAGCTGG + Intronic
996772648 5:127101347-127101369 CAGTAGAATTAGAGAGGAGAAGG - Intergenic
997369434 5:133348667-133348689 CAGCTGGACTAGAGAGGCACAGG - Intronic
998403043 5:141858049-141858071 CAGTGAGACAGGTGAGGAGCTGG - Intronic
1001748769 5:174111940-174111962 CAGTGAGGAGAGAGAGGAGCGGG - Intronic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002308539 5:178298560-178298582 CAGGGGCAACAGAGAGGAGCAGG - Intronic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1003014959 6:2461091-2461113 CACAGGGAACAGAGAGGAGCTGG - Intergenic
1005997580 6:30940756-30940778 CAGAGGAACCAGAAAGGAGCAGG - Intergenic
1010144785 6:72655496-72655518 AAGTGGAATTAGAGAGGAACGGG + Intronic
1011249150 6:85352678-85352700 CAGTGGGACAAGATGGGAGGTGG - Intergenic
1011352217 6:86435198-86435220 TCGTGGGGTTAGAGAGGAGCTGG - Intergenic
1011873599 6:91927296-91927318 CAGTGGTACGGGAGTGGAGCAGG - Intergenic
1012412213 6:98971419-98971441 CAGTGTGAGTGGAGTGGAGCAGG + Intergenic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1013590136 6:111612852-111612874 CTGTGGGACTAGAGTGGGTCTGG - Intergenic
1013655527 6:112242923-112242945 CAGAGGGTCCAGAGAGGAGAAGG - Intronic
1015921735 6:138273187-138273209 CATTGGGCCTTGAGAGAAGCGGG + Intronic
1017010263 6:150058493-150058515 CAGCGGGGCTAGAGGAGAGCAGG - Intergenic
1017847760 6:158274316-158274338 GAGAGGGACAAGAGAGCAGCTGG - Intronic
1019118671 6:169786015-169786037 CACTGGCACTAGAGAGGGGCAGG - Intergenic
1019376809 7:697180-697202 CTGTGGGACGGGATAGGAGCAGG - Intronic
1019624681 7:2009946-2009968 CAGTGGGAATCGCGAGGTGCTGG - Intronic
1019729537 7:2622636-2622658 CAGTAGGAGTTGAGAGGAGGAGG - Intergenic
1022938590 7:35207148-35207170 CAGTGAGAGTATAGAGGACCTGG - Intronic
1023857870 7:44196184-44196206 GAGTGAGGCCAGAGAGGAGCAGG + Intronic
1023889117 7:44380260-44380282 CAGAGGGTCTAGAGAGGAAGGGG - Exonic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1027340231 7:77199653-77199675 CAGTGAGACTAGAAAGCAGAGGG - Exonic
1029011985 7:97271822-97271844 CAGTGAGCCTAGAAAGCAGCAGG - Intergenic
1029839588 7:103347835-103347857 CCTTGGCACTGGAGAGGAGCTGG + Intronic
1030327057 7:108230806-108230828 CAGTGGGAGGAGATAGGAGTGGG - Intronic
1032490107 7:132318141-132318163 CAGGGGGACTGGAGCGGAGAGGG + Intronic
1032598450 7:133267050-133267072 AAGTGGGACTAAAGAGATGCAGG - Intronic
1033712341 7:143960750-143960772 CAGAGGGACTGGAGTGGGGCTGG - Exonic
1033731712 7:144187196-144187218 CAGTGGGAAGAGCGAGGAGCAGG - Exonic
1033742562 7:144285779-144285801 CAGTGGGAAGAGCGAGGAGCAGG - Intergenic
1033751341 7:144363835-144363857 CAGTGGGAAGAGCGAGGAGCAGG + Exonic
1034440870 7:151085621-151085643 CAATGGGACTGCAGAGGAACTGG + Intergenic
1036095046 8:5714545-5714567 GAGTGGGACTGGGGAGGAGTAGG - Intergenic
1037463826 8:19139563-19139585 CAGTGGGCCTAGAGTGGGGCGGG - Intergenic
1037718617 8:21421866-21421888 CGGTGGCAGAAGAGAGGAGCTGG + Intergenic
1037730111 8:21517166-21517188 CAGTTGGACTGGTGATGAGCAGG + Intergenic
1037951022 8:23018896-23018918 GAGTTGGTCTAGAGAGGAGGAGG + Intronic
1039175460 8:34799259-34799281 AAGTGAGGCTAGAGAGGAGGAGG - Intergenic
1042110369 8:65375244-65375266 CAGTGGGCCTTCTGAGGAGCTGG - Intergenic
1043014109 8:74916803-74916825 CAGTGTGATTGCAGAGGAGCAGG + Intergenic
1043821676 8:84873965-84873987 GACTGGTACTAGAAAGGAGCTGG - Intronic
1044080016 8:87872326-87872348 CAGTGGGAGAGGAGAGGAGGGGG - Exonic
1044414687 8:91924012-91924034 CAGTGGGACAAGATTGGAGGTGG + Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1046098048 8:109583533-109583555 CAGTGGGACATGTGAGGAACAGG - Intronic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047139045 8:122115186-122115208 GAGTAGGACCAGAGAGGACCTGG - Intergenic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1049022432 8:139966632-139966654 CAGTGGGATTAGAAAGGAGCTGG - Intronic
1049240492 8:141535319-141535341 CAGAGGGACTGGGGAGGAGGGGG + Intergenic
1049688789 8:143949859-143949881 CACTGGGACAGGAGAGGAGGCGG + Intronic
1052955322 9:34249523-34249545 AAGTGGGACTAGGGCAGAGCAGG + Intronic
1053036172 9:34828149-34828171 CAGAGGGACAAGTGGGGAGCTGG - Intergenic
1053562394 9:39209864-39209886 CAGAGGGACTAGAAAGGAGGAGG + Intronic
1053828200 9:42047856-42047878 CAGAGGGACTAGAAAGGAGGAGG + Intronic
1054134757 9:61409175-61409197 CAGAGGGACTAGAAAGGAGGAGG - Intergenic
1054602359 9:67139598-67139620 CAGAGGGACTAGAAAGGAGGAGG - Intergenic
1055511475 9:76999655-76999677 CAGTAGGTCTAGGGAGGATCAGG - Intergenic
1056823253 9:89859410-89859432 CAGTGGTTCTAGGGAGGACCTGG + Intergenic
1057133925 9:92673245-92673267 CAGTGGGAATGCAGAGGAGAGGG + Intergenic
1057786913 9:98094651-98094673 CAGTGTGACTGGAGAAGGGCAGG + Intronic
1059093264 9:111384482-111384504 CATTGGGAATGGAGTGGAGCAGG - Intronic
1060531146 9:124347640-124347662 CAGAAGGACTAGAGAGGAGGAGG - Intronic
1061208899 9:129179395-129179417 CAGTGGGAGAAGAGAGGGACAGG + Intergenic
1061455868 9:130697157-130697179 CAAAGGGGCTTGAGAGGAGCAGG + Intronic
1061824391 9:133248758-133248780 CACCGGGACTGGAGAGGAGTGGG + Intergenic
1062367544 9:136218447-136218469 CGGTGGGTGTAGAGAGGGGCGGG - Intronic
1062441630 9:136572333-136572355 CAATGGGGGTAGAGAGGAGGTGG - Intergenic
1062614441 9:137389666-137389688 CAGTGAGACCAGCAAGGAGCTGG + Intronic
1187185525 X:16981181-16981203 CTGTGGGACAAGAAAGGAGGAGG - Intronic
1187464296 X:19514692-19514714 GAGGGGGACTAGAGACGAGGGGG + Intronic
1189114503 X:38328849-38328871 CATTGGTGCCAGAGAGGAGCAGG + Intronic
1192163193 X:68803982-68804004 CAGTGAGAATGGAGAGGAGGGGG + Intergenic
1193189448 X:78552213-78552235 CAGAGGTACAAGGGAGGAGCTGG + Intergenic
1196064491 X:111447973-111447995 TAGTGGAACTAGAAAGCAGCCGG - Intergenic
1196265745 X:113644144-113644166 CAGTGGGAATAGAGAGGTATAGG - Intergenic
1196418247 X:115496048-115496070 TAGAGGGACTGGAGAGGGGCTGG + Intergenic
1197252418 X:124229619-124229641 GGGTGGGGATAGAGAGGAGCAGG + Intronic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1198338846 X:135693876-135693898 CAGTGGGGCCAAGGAGGAGCAGG - Intergenic
1199762135 X:150913029-150913051 CAGTGGGACCAGGGAGCAGCTGG - Intergenic