ID: 1119662095

View in Genome Browser
Species Human (GRCh38)
Location 14:76459410-76459432
Sequence CTGGAGAAACAGAGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 716
Summary {0: 1, 1: 2, 2: 2, 3: 58, 4: 653}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119662086_1119662095 -7 Left 1119662086 14:76459394-76459416 CCTCCCCATGTGGGACCTGGAGA 0: 1
1: 0
2: 1
3: 30
4: 342
Right 1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG 0: 1
1: 2
2: 2
3: 58
4: 653
1119662087_1119662095 -10 Left 1119662087 14:76459397-76459419 CCCCATGTGGGACCTGGAGAAAC 0: 1
1: 0
2: 1
3: 15
4: 169
Right 1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG 0: 1
1: 2
2: 2
3: 58
4: 653

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119662095 Original CRISPR CTGGAGAAACAGAGGGTGGA GGG Intronic
900027696 1:292289-292311 CTGGACAAACAGAGTGTGCTGGG - Intergenic
900041651 1:471731-471753 CTGGACAAACAGAGTGTGCTGGG - Intergenic
900063086 1:706708-706730 CTGGACAAACAGAGTGTGCTGGG - Intergenic
900076089 1:819004-819026 CAGGAGAAACAGAGAGTGTCTGG - Intergenic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900369033 1:2323355-2323377 CTGGAGAGCCAAAGGCTGGAAGG - Intronic
900502890 1:3015295-3015317 CTGGAGGAACACAGGCAGGAGGG - Intergenic
900909002 1:5580922-5580944 CCAGAGAAACAGAGGCTGGGTGG - Intergenic
901059422 1:6465294-6465316 CTGGAGAGAAAGAGGGAGGGAGG - Intronic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
901748283 1:11389129-11389151 CTGCAGACTCAGAGGGGGGAAGG - Intergenic
902609347 1:17588156-17588178 CTGGAGCAGCTGGGGGTGGAGGG + Intronic
902941858 1:19806082-19806104 CTGGGGAAAAACAGGGTGAAAGG - Intergenic
903056038 1:20636830-20636852 CTATAGAAACAGGGGCTGGAAGG + Intronic
904783922 1:32971385-32971407 CTGGGGACACAAAGGATGGAGGG - Intergenic
904891089 1:33780146-33780168 CTGGAGATACAAAGAGTGGAAGG - Intronic
905253058 1:36662107-36662129 ATGGACAAACAGAGGCTGGGAGG - Intergenic
905573309 1:39023748-39023770 CTGGAGAGGCAGAGGTTGCAGGG - Intergenic
907224016 1:52927911-52927933 CTGGAGGGACAGAGGGAGGCCGG - Intronic
907490396 1:54805658-54805680 AAGGAGAGCCAGAGGGTGGAGGG - Intergenic
908852261 1:68387528-68387550 AAGGAGAAATGGAGGGTGGAAGG - Intergenic
910095559 1:83517671-83517693 CTGGAAAAACCTAGGGTGGCTGG + Intergenic
910628892 1:89337074-89337096 CTGTGGATTCAGAGGGTGGAAGG + Intergenic
911759935 1:101602520-101602542 AAGGAGAAATGGAGGGTGGAAGG + Intergenic
912152522 1:106878079-106878101 CTGGACAAACAGTTAGTGGAGGG - Intergenic
912155946 1:106920072-106920094 GTGGAAAAACAGGTGGTGGAAGG + Intergenic
913283797 1:117209657-117209679 CAGGAGAAGCAGTGGGTGGCAGG - Intronic
914847900 1:151292919-151292941 CTGGTGGAGCAGATGGTGGATGG - Exonic
915356616 1:155258913-155258935 CTGGACAAAAAGAAGGTAGAGGG + Exonic
916841950 1:168609862-168609884 CTGAGGAGACAGAGGGGGGAGGG + Intergenic
917127086 1:171696572-171696594 CTGGAAAAACAGAGGGTAAAGGG + Intergenic
917723750 1:177811034-177811056 GGAGGGAAACAGAGGGTGGAGGG + Intergenic
918102156 1:181385795-181385817 ATGGAGAAACGGAGGGAGGGAGG - Intergenic
918185842 1:182127191-182127213 CTTAATAAACAGAGGGTGGGGGG - Intergenic
918488406 1:185053998-185054020 CTAGAGAAACACTGGGTGGGGGG - Intronic
918532604 1:185539695-185539717 CAGGAGAGACAGAGAGTGAAGGG - Intergenic
918722818 1:187875598-187875620 CAGGAGAAATAGAGGGGAGAGGG + Intergenic
919091079 1:192979579-192979601 AAGGAGGAACGGAGGGTGGAAGG + Intergenic
919201882 1:194365694-194365716 ATGGGGAAACAAAGGGTAGAAGG - Intergenic
920068031 1:203282909-203282931 TGGGAGAAACAGAGGGTGGCAGG - Intergenic
920259740 1:204680720-204680742 CTGGAGAAAAAGAGGCTGAGAGG + Intronic
920841891 1:209562144-209562166 CTGGAAACACAGGGGGTGCAGGG + Intergenic
921070703 1:211655574-211655596 CTGGAGAAACATCGTTTGGAAGG + Intergenic
921372589 1:214439934-214439956 CAGAAGAAACAAAGGGTAGAGGG - Intronic
921981908 1:221267966-221267988 CAGGAGCAAGAGAGGGTTGAGGG + Intergenic
922081350 1:222300278-222300300 CAGGAGAGACAGAGAGTGAAGGG + Intergenic
922129041 1:222758566-222758588 CTGTATAAACATGGGGTGGAGGG - Intergenic
922183470 1:223254410-223254432 CAGGAGAGACAGAGGGTTAATGG + Intronic
922260029 1:223931733-223931755 CTGGACAAACAGAGTGTGCTGGG - Intergenic
922322610 1:224501952-224501974 CTGGAGGAAGGTAGGGTGGAGGG + Intronic
922845609 1:228681784-228681806 AAGGAGAAATGGAGGGTGGAAGG + Intergenic
922946790 1:229523247-229523269 CTGGAGGAAAGGAGGGAGGATGG - Intronic
923744832 1:236690837-236690859 CTGGAGACACAGAGTGGTGATGG - Intronic
923988894 1:239412337-239412359 CTGGAGGAAAAGAGGGAGGGAGG - Intronic
924283081 1:242457789-242457811 GTGGAGTGACAGAGGGTAGAAGG - Intronic
924341194 1:243034293-243034315 CTGGACAAACAGAGTGTGCTGGG - Intergenic
1062922505 10:1290652-1290674 CTTGAGCAACTGAGGGTTGACGG + Intronic
1063005382 10:1965204-1965226 CTGCAAAAACACAGGATGGAAGG + Intergenic
1063044100 10:2373887-2373909 AAGGAGAGACAGAGGCTGGAAGG - Intergenic
1064107567 10:12512976-12512998 CTGGAGGAACACAGTGGGGATGG + Intronic
1065127127 10:22584481-22584503 CTGGAGAAACAGAAGGGGAGAGG + Intronic
1065307077 10:24379485-24379507 CTTAAGAAACACAGGGCGGAAGG + Intronic
1065602143 10:27379907-27379929 CTGGACTACTAGAGGGTGGAGGG - Intergenic
1065694836 10:28370217-28370239 AGGGAGAAAGAGAGGATGGAAGG + Intergenic
1065695301 10:28374272-28374294 CTGGGCAAAGAGAGGGTGGATGG - Intergenic
1066376483 10:34861901-34861923 CTGGAGAGAGAGAGGGCGGTAGG - Intergenic
1067132469 10:43577030-43577052 CTGGAGAGAAATAGGGTGCAAGG - Intergenic
1067311288 10:45115891-45115913 ATGGAGAGAAAGAGAGTGGAAGG - Intergenic
1067344530 10:45427995-45428017 CTGCAGAAGCAGAGGGGGAAGGG - Intronic
1068725987 10:60304067-60304089 CTATAGAAACAGAGAGTAGAAGG + Intronic
1068979934 10:63051540-63051562 ATTGTGAAACAGAGGGTGAATGG + Intergenic
1069547800 10:69341235-69341257 CTGGGGAAGCAGAGGTTGCAGGG - Intronic
1069553632 10:69382406-69382428 GTGGAGAAAGAAAGGGTGGCCGG + Intronic
1070395970 10:76011498-76011520 ATGGAGGAACTGAGGATGGAGGG - Intronic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1070660252 10:78300585-78300607 CTGGGGAAACAGAAAGTGAAGGG - Intergenic
1071059052 10:81548429-81548451 CTGGAGCCAGAGAGGCTGGATGG + Intergenic
1071102112 10:82050793-82050815 CTGGAGAGACAGAGAGTAGGAGG - Intronic
1072191797 10:93081829-93081851 CTGGAGAAACATAAGGTAAATGG - Intergenic
1072306092 10:94108636-94108658 CAGGGGAAGCAGGGGGTGGAGGG - Intronic
1072742152 10:97915862-97915884 GTGGAGGAACAGAGGGAGGCTGG - Intronic
1073148025 10:101293023-101293045 CTGGAGAGACACAGGGTGGGTGG - Intergenic
1073630289 10:105141397-105141419 GTGGGGACAGAGAGGGTGGAGGG + Intronic
1073741918 10:106417076-106417098 CAGGAGAGACAGAGTGTGAAGGG + Intergenic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1074533195 10:114310918-114310940 CGGGAGAGCCAGAGGGTGGTTGG - Intronic
1074558407 10:114513054-114513076 CTGGGGAAAGGGAGGATGGATGG - Intronic
1074642605 10:115404401-115404423 ATGAGGAAACAGAGGGTGTATGG - Intronic
1074941215 10:118237326-118237348 CTGGGGGACCAGAGGCTGGAAGG - Intergenic
1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG + Intergenic
1075409254 10:122215257-122215279 CTGGAGTGACAGAGGTGGGAGGG + Intronic
1075667671 10:124242674-124242696 CAGGGGAAACAGAGGGGGAAGGG + Intergenic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1075874611 10:125796037-125796059 GTGGGGAAGCAGAGGGTGAAGGG - Intronic
1075963025 10:126585560-126585582 CAGGAGAAAGAGAGGAAGGAAGG + Intronic
1076799158 10:132812638-132812660 CTGCAGTCACAGAGGGTGGGGGG + Intronic
1076863522 10:133155272-133155294 CTGGCAAAACGGAGGGTGAAGGG + Intergenic
1076967926 11:107959-107981 CTGGACAAACAGAGTGTGCTGGG - Intergenic
1077444775 11:2585836-2585858 CTGGAGCAACAGGGGCAGGAAGG + Intronic
1077612036 11:3649168-3649190 ACGGAGGAACGGAGGGTGGAAGG - Intronic
1077988692 11:7381895-7381917 CTGGAGTACCAGTGGCTGGAAGG - Intronic
1078363360 11:10687345-10687367 CTAGAGAAACAGAAGAGGGAGGG - Intronic
1078530167 11:12130956-12130978 CTGGAGGAGCAGAGGCCGGAGGG + Intronic
1078745970 11:14114603-14114625 GTGAAGAAATAGAGGCTGGATGG - Intronic
1079244749 11:18743955-18743977 CTGGAGAGAGGGTGGGTGGAGGG - Intronic
1080164899 11:29224794-29224816 CTGGAGCCAAAGAGGCTGGATGG - Intergenic
1080582687 11:33656950-33656972 ATAGAGAAACAGGGGCTGGAGGG - Intronic
1081235564 11:40643470-40643492 CTGATGATACAAAGGGTGGAGGG - Intronic
1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG + Intronic
1081718602 11:45269044-45269066 CTGGAGAAGGGGAGGGTGGTAGG + Intronic
1082660978 11:55910962-55910984 TTAGAGAGACAGAGAGTGGAAGG + Intergenic
1082834272 11:57640194-57640216 CCAGAGAAACAGAGGCTGGAGGG - Intergenic
1083555277 11:63621124-63621146 CAGGAGAAAGAAAGGGTGCAAGG + Intergenic
1083738067 11:64693086-64693108 ATGCCGAAACAGCGGGTGGAGGG + Intronic
1084359874 11:68662218-68662240 CGTAAGAAACAGAAGGTGGAGGG + Intergenic
1085031514 11:73273758-73273780 ATGGAAAAACAGGTGGTGGATGG - Intronic
1085047099 11:73359974-73359996 CTGGGGAGCCAGAGGGTGGGAGG + Intronic
1085115523 11:73928232-73928254 CTAGAGGAAGAGATGGTGGAGGG + Intergenic
1085609794 11:77936754-77936776 CTGGAGAAAGAAAGGAAGGAAGG + Intronic
1086026840 11:82303928-82303950 CAGGAGAAGCAGTGGATGGAAGG - Intergenic
1086212304 11:84335247-84335269 ATGAAGGAACAGAGGGAGGAAGG + Intronic
1086781784 11:90916035-90916057 CTGCATAAACAGAAGGTGGAAGG - Intergenic
1086957263 11:92946225-92946247 GTGGGGCAACAGAGGGTAGAAGG + Intergenic
1087392867 11:97560753-97560775 GTGGAAAGACACAGGGTGGAGGG - Intergenic
1087781342 11:102304091-102304113 GAGGAGAAAGAGAGAGTGGAAGG + Intergenic
1088772607 11:113050124-113050146 GGGCAGAAACAGAGGGTGGGGGG + Intronic
1090602462 11:128387298-128387320 CTGGAGAAGCAGTGGGTGACAGG - Intergenic
1090736743 11:129617480-129617502 CAGGAGAAAGAGAGAGTGGCAGG - Intergenic
1091216365 11:133904802-133904824 TTGGAGAACTGGAGGGTGGAGGG - Intergenic
1091662286 12:2393365-2393387 CTGGAGCAGGAGATGGTGGAGGG - Intronic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092629267 12:10361072-10361094 TTGTAGAGACAGAGGGAGGAGGG + Intergenic
1092739463 12:11614146-11614168 AAGGAGAAATTGAGGGTGGAAGG + Intergenic
1092904272 12:13087873-13087895 CTGGAGTGAGAGAGGGTGGTTGG - Intronic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1092993541 12:13926499-13926521 CTGGAGAAACTGGGGAAGGAGGG - Intronic
1094057560 12:26282464-26282486 CTGAAGTAAAAGAGGATGGATGG - Intronic
1095093268 12:38127268-38127290 GTGGAGTGACAGAGGGTAGAAGG - Intergenic
1095487920 12:42703636-42703658 CGGGAGAAAGAGAGGATTGAAGG + Intergenic
1096088196 12:48880497-48880519 CTGGCAAAACAGAGGATGGGAGG - Intergenic
1096418477 12:51434690-51434712 CTAGAGAAACAGAGGGAGGGAGG - Intronic
1097173713 12:57130851-57130873 CTGGAGATACAGAGGGGGCGTGG - Intronic
1097238180 12:57553965-57553987 CTGGAGGTAGAGAGGGTGGGTGG + Intronic
1097357743 12:58621041-58621063 CTAGAGGAACAGAGGCTGGAAGG - Intronic
1098384297 12:69902424-69902446 ATGGAGAAACAGTGGTAGGAGGG - Intronic
1098521008 12:71435628-71435650 CAGGAGAGAGAGAGGGTGAATGG + Intronic
1098848387 12:75565851-75565873 ATGGAGTAACAGATGGGGGAAGG + Intergenic
1098905630 12:76159172-76159194 GAGAAGAAACAGAGAGTGGATGG - Intergenic
1099292238 12:80787528-80787550 AAGGAGGAATAGAGGGTGGAAGG + Intergenic
1099644232 12:85330426-85330448 GTGGAGAAAGGGAGGGAGGAAGG - Intergenic
1100787462 12:98093958-98093980 CTGGAGAATCAGTGGGAGGGTGG - Intergenic
1101502577 12:105317709-105317731 CTGGAGAAACTCAAGGTGGGTGG + Intronic
1101780771 12:107832938-107832960 ATGGATAAACAGTGAGTGGACGG + Intergenic
1101817990 12:108160512-108160534 CAGGAGAAAGAGAGGCTGGCAGG + Intronic
1102350120 12:112185627-112185649 ATGGAGAAACAGAGGTTGGGAGG + Intronic
1102490449 12:113287121-113287143 AGGGAGAAAGAGAGGGAGGACGG + Intronic
1102595547 12:113989723-113989745 CTGGAGTGAGAGAGGGTAGATGG + Intergenic
1103072579 12:117957123-117957145 GAGGAGAAACAGAGGGCGAAGGG - Intronic
1103701236 12:122849722-122849744 CTAGAGACAGAGAGGGTGGTTGG + Intronic
1103905686 12:124326266-124326288 CTGAGGAGACAGAGGGTGGCCGG + Exonic
1105714183 13:23045676-23045698 CTGGAGCAAGAGAGAGTGGGAGG + Intergenic
1106857998 13:33873685-33873707 ATGGAGCAAAAGAGGGTGAAGGG - Intronic
1107232153 13:38123003-38123025 CTGGAGAAAGAGAGCATGGAGGG + Intergenic
1107624345 13:42267705-42267727 CTGAAGAAACAGCCTGTGGAAGG + Intergenic
1107712741 13:43166748-43166770 CTGAAAATACAGAGGATGGATGG + Intergenic
1107727960 13:43318966-43318988 CTGGAGGGAGAGAGGGAGGAAGG + Intronic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1110650663 13:77938143-77938165 CAGGAGGAATGGAGGGTGGAAGG + Intergenic
1110702297 13:78562841-78562863 CTGAATAAATAGAGGATGGATGG + Intergenic
1110717967 13:78729689-78729711 CTGGAGTAATAGAAGCTGGAGGG - Intergenic
1110738452 13:78965963-78965985 CTGGATAACCACAGGGTGTAGGG + Intergenic
1111880900 13:93955838-93955860 CTGGAGAAAAAGAAGATAGAAGG - Intronic
1111899105 13:94179327-94179349 TTTGAGATAGAGAGGGTGGATGG + Intronic
1112437154 13:99398751-99398773 CTGTGGAAATAAAGGGTGGAGGG - Intergenic
1112487792 13:99835439-99835461 ATGGAGGAAGAGAGAGTGGAGGG + Intronic
1112552038 13:100430483-100430505 CTGGAGGAACACAGAGAGGATGG - Intronic
1112580976 13:100675628-100675650 CTGGAAAAACAGAAGGTGGGGGG - Intergenic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1112945088 13:104918633-104918655 CGGGAGCAAGAGAGAGTGGAGGG - Intergenic
1113188572 13:107717985-107718007 CTGGAACAACAGCAGGTGGAGGG - Intronic
1113522103 13:110948474-110948496 GTGAAGAGACAGAGGGTGGTAGG - Intergenic
1114450474 14:22822180-22822202 CCGGAGAAAGCGAGGGTGGTGGG - Intronic
1116109421 14:40558249-40558271 GTGAAGAAAAGGAGGGTGGAAGG - Intergenic
1116198643 14:41761269-41761291 CAGGAGAAAGAGAGGAAGGAAGG + Intronic
1116280002 14:42894505-42894527 GTGGACTACCAGAGGGTGGAGGG - Intergenic
1116837383 14:49783409-49783431 CTGGAAAAACAAAGTGTGGAGGG + Exonic
1116998117 14:51345594-51345616 CAGGAGAGACAGAGAGTGAAGGG - Intergenic
1117287171 14:54297438-54297460 ATGTAGAAATTGAGGGTGGAGGG - Intergenic
1117334206 14:54743009-54743031 CTGGAGAAGCAGAGGTTCAAAGG - Intronic
1118054424 14:62064611-62064633 ATGGGGAAACAGATGGTAGAGGG + Intronic
1118147527 14:63156792-63156814 TTGTAGAAACAGAGAGTAGAAGG - Intergenic
1119264495 14:73256001-73256023 CTAGCTAAGCAGAGGGTGGAAGG + Intronic
1119483728 14:74975222-74975244 CTGAAGAGATAGAGGCTGGAGGG + Intergenic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1120131716 14:80815941-80815963 CTGGAGACCCAGAGGGTGGGAGG + Intronic
1121212084 14:92214668-92214690 CTGGAGAAAGATGGGGTGGAAGG + Intergenic
1122011671 14:98754345-98754367 AAGTAGAAACAGAGGGTGGAAGG + Intergenic
1122049264 14:99044055-99044077 CTGAAAAAACAGGGGGTGGGGGG - Intergenic
1122151522 14:99728552-99728574 CTGGAAATGGAGAGGGTGGAGGG - Intergenic
1122211969 14:100179137-100179159 GTGGAGTCACACAGGGTGGAGGG + Intergenic
1122707236 14:103629093-103629115 CTGGGGAAACTGAGGCTGGGTGG - Intronic
1122880170 14:104687269-104687291 CTGGAGGTACAGAGGGTTGAGGG + Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1124395067 15:29293927-29293949 GTGGGGAAACTGAGGGTGGGGGG + Intronic
1125400722 15:39299779-39299801 TTGGGGAAGCAGAGGGTGGGGGG + Intergenic
1126549952 15:49917624-49917646 CTGGAGAATCAGATGGTGTTGGG + Intronic
1126834516 15:52646208-52646230 CTGGAGAAATAAAAAGTGGACGG + Intronic
1128145859 15:65332188-65332210 CTGGAGATACACAGGGTGAGAGG + Intronic
1128177671 15:65570525-65570547 CTGAAGAAACAGGAGGTTGAAGG + Intronic
1128283574 15:66417461-66417483 CTTGAGAAACTGAGGTGGGAGGG + Intronic
1128709532 15:69861317-69861339 GTGGGGAAACTGAGGCTGGAAGG + Intergenic
1128954122 15:71921463-71921485 CGGGAGAAGGAGTGGGTGGAAGG - Intronic
1129114778 15:73359208-73359230 CTGGGGGAGCAGTGGGTGGAGGG + Intronic
1129249639 15:74301862-74301884 GTGGAGAGAGAGAGGGGGGAGGG - Intronic
1129455731 15:75675416-75675438 CTGGAGACACCAGGGGTGGAGGG - Exonic
1129885838 15:79036420-79036442 GTGGAGAAACAGAGGCGGGAGGG - Intronic
1130733740 15:86526839-86526861 TTGGAGAAACAGAAGGGGGTTGG + Intronic
1131040922 15:89266102-89266124 CTTGGGAAGCAGAGGCTGGAGGG - Intronic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1131801214 15:96071271-96071293 GTGGAGGGACAGCGGGTGGAAGG + Intergenic
1131867807 15:96730710-96730732 CCAGAGAAGCAGAGGGTAGAGGG + Intergenic
1132130536 15:99273914-99273936 CTAGGGAACCAGTGGGTGGAGGG - Intronic
1132714005 16:1281734-1281756 GTGGGGAAACTGAGGCTGGAGGG - Intergenic
1133869752 16:9675938-9675960 AAGGAGAAATGGAGGGTGGAAGG + Intronic
1133971939 16:10574495-10574517 CTGGAGGAGCAGTGGGTGCATGG - Intronic
1135007497 16:18839592-18839614 CTGGAGGGACAGAGGAAGGAAGG + Intronic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136108462 16:28048971-28048993 CTGGAGAAAAAAAGGGAGAAGGG + Intronic
1136360409 16:29775818-29775840 TTGGAGAAAAAGAGAGGGGAAGG + Intergenic
1137758794 16:50923963-50923985 AAGGAGAAAAAGAGGGAGGATGG + Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1139249322 16:65479880-65479902 CTGAAGAAATAGAGGTAGGAGGG + Intergenic
1139699858 16:68701508-68701530 CAGGAGAAACAGATCCTGGAAGG - Intronic
1141263445 16:82474512-82474534 CTGGAGAAACAAAATCTGGAAGG + Intergenic
1141375982 16:83531267-83531289 CAGGAGAAACTGAGGCTGAAAGG - Intronic
1141664566 16:85459224-85459246 GTGGAGACACAGAGGGTGCCTGG - Intergenic
1142429370 16:90018331-90018353 CTGCAGATACACAGGGTGGGTGG + Intronic
1142452754 16:90191180-90191202 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1142683983 17:1566697-1566719 CTTGAGAAACTGAGAGAGGACGG - Intergenic
1142923039 17:3207765-3207787 CTGGAGAAGCAGTGGCAGGATGG - Intergenic
1143141110 17:4742308-4742330 CTGGGGACACAGCGGGTGGTGGG - Intronic
1143141452 17:4743892-4743914 CTGGAGAACCAGAGCCTGGGTGG + Intronic
1143377253 17:6474096-6474118 CAGGAGAAGGAGAGGGTGGGAGG + Intronic
1143481201 17:7228169-7228191 CTAGAGAAGGTGAGGGTGGAAGG + Intronic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144190748 17:12843240-12843262 GGGGAGAAACAGAGGGAGGCAGG - Intronic
1146122456 17:30207732-30207754 CAGGAGAAACAGAGGGCTGATGG + Exonic
1146373478 17:32279762-32279784 ATGGAGAAACAGAGGCAGGGTGG + Intronic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1147986031 17:44308422-44308444 CGGGAGAAGCAGAGATTGGAAGG - Intronic
1148492537 17:48032603-48032625 CAGGAGAAAAACAGGGAGGAAGG + Intronic
1148533753 17:48420664-48420686 CTGGAGAATCAGGGGGTGCCAGG - Intronic
1149621906 17:58051697-58051719 CTGGGGAACCAGTGTGTGGAAGG - Intergenic
1150266689 17:63836855-63836877 CTGGAAAACAAGGGGGTGGAAGG + Intronic
1150305329 17:64079815-64079837 ATGGAGGAATAGAGAGTGGAGGG + Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1151021553 17:70623151-70623173 CTGAAGATAGAGAGGGTTGATGG - Intergenic
1151284346 17:73099174-73099196 CTGCAGGACAAGAGGGTGGATGG + Intergenic
1151702272 17:75749884-75749906 CTGGAGGAACAGAAGCGGGAGGG - Intronic
1151868075 17:76818065-76818087 CAGGAGGAAGAGAGGGGGGAGGG + Intergenic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1151937312 17:77270522-77270544 CAGGAAAAACAGAGGGCTGAGGG - Intergenic
1152063505 17:78096783-78096805 CTGGAGAAGAAGAGCGAGGATGG - Intronic
1152145686 17:78567351-78567373 CTGCAGAAAGAGGGGATGGAAGG + Intronic
1152448764 17:80363244-80363266 GTGGAGAACCTGAGGGTAGATGG - Exonic
1152859879 17:82690162-82690184 CTGAAGAATCAGAGGGAGCATGG + Intronic
1152988026 18:337222-337244 CTGGAGCAATGGAGGATGGATGG + Intronic
1155691651 18:28632156-28632178 CTTGAGAAAGTGAGAGTGGATGG + Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1155813770 18:30276298-30276320 AGGGAGAAAGAGAGGGAGGAAGG + Intergenic
1156021914 18:32609145-32609167 TTGGAGAAACCGTGGCTGGAAGG + Intergenic
1157382545 18:47232560-47232582 CTGGGGACACAGAGGAGGGATGG - Intronic
1157461762 18:47903357-47903379 CTAGAGAAAGAGGGGGTGGGGGG + Intronic
1157511174 18:48275987-48276009 CTCAAGATACAGAGGGAGGAGGG + Intronic
1157523920 18:48364215-48364237 CTGGAGACACAAAGAATGGAAGG + Intronic
1157743081 18:50110364-50110386 CTGGAGCAAATGAGGGAGGAAGG - Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1157880853 18:51319839-51319861 CTGGAGACAGAGAGAGTGAAGGG + Intergenic
1159088978 18:63825017-63825039 CAGAAGGAAGAGAGGGTGGAGGG + Intergenic
1160246304 18:77162861-77162883 CTGGAGACACTGTGGGTGAAAGG + Intergenic
1160644731 19:177582-177604 CTGGACAAACAGAGTGTGCTGGG - Intergenic
1161283966 19:3459444-3459466 CTGGGTAAACCGAGGGTGGGGGG + Intronic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1162131769 19:8530366-8530388 CTGCGGGGACAGAGGGTGGAGGG + Intronic
1162153293 19:8660342-8660364 CTGTAGACACAGAGGGGGAATGG + Intergenic
1162155547 19:8675888-8675910 ATGGAGGAATAGATGGTGGATGG + Intergenic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163608463 19:18288576-18288598 CTGGAGAACCAGAGGGTTTGGGG + Intergenic
1163855333 19:19697307-19697329 CTGGAGCAGCAAAGGATGGAAGG + Intergenic
1164393800 19:27846798-27846820 CTGGACAAACAGATACTGGAGGG + Intergenic
1164441816 19:28284869-28284891 GTGGAGAGAAGGAGGGTGGAGGG + Intergenic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165750335 19:38255810-38255832 CTGGAGAAAGAGTGGGGGAAGGG - Intronic
1166097315 19:40549061-40549083 CTGAACAAGGAGAGGGTGGAAGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166443546 19:42838032-42838054 CTTGAGAAACAGAAGCTGAACGG - Intronic
1166463237 19:43008694-43008716 CTTGAGAAACAGAAGCTGAATGG - Intronic
1166469381 19:43065252-43065274 CTTGAGAAACAGAAGCTGAACGG - Intronic
1166480511 19:43168790-43168812 CTTGAGAAACAGAAGCTGAATGG - Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167685241 19:50951903-50951925 CTGGAGGGATAGAGGGTGCAGGG - Intronic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167769915 19:51508659-51508681 CTGGAGCATCTGAGGCTGGAAGG - Intergenic
1167792442 19:51690355-51690377 CTAGAGGAACAGAGGGTTGGGGG - Intergenic
1168160500 19:54507550-54507572 CTAGAGGGACAGAGGGTGGGAGG - Intronic
1168595072 19:57668865-57668887 CTGGTGAAACAGAGGGGGCCCGG - Intergenic
924979872 2:209801-209823 CTGGAGAAACATAAATTGGAGGG - Intergenic
925421211 2:3713431-3713453 GTGGAGCAGCAGAGGGGGGAAGG - Intronic
925470461 2:4155760-4155782 ATGGATAAACAGATGATGGATGG - Intergenic
925615506 2:5741074-5741096 CTGCGGAAGCAGAGGATGGAAGG - Intergenic
925693509 2:6549579-6549601 CAGGAGGAAGAGAGGGAGGAAGG - Intergenic
925837991 2:7964679-7964701 CTGGAGAAGCAGAGGTAGGGCGG - Intergenic
926175598 2:10588921-10588943 ATGGAGGTGCAGAGGGTGGAGGG - Intronic
926638093 2:15205774-15205796 CAGGAGAGAGAGGGGGTGGAAGG - Intronic
926726803 2:16004910-16004932 ATGGGGAAACCGAGGCTGGAAGG + Intergenic
926746338 2:16161435-16161457 CTGGAAATACACAGGGAGGATGG + Intergenic
926796276 2:16621691-16621713 CTGGAGAAAGTGAGGGAGCAAGG - Intronic
927049808 2:19316193-19316215 TTGGAGAGTCAGAGGGAGGAGGG - Intergenic
927173608 2:20390378-20390400 CTGGAGAGGCAGAGGTTGCAAGG - Intergenic
927333291 2:21891343-21891365 CTTGACAAACAGTGGGTCGAGGG + Intergenic
927589444 2:24340572-24340594 CTGGTGGGACAGAGGCTGGAAGG - Intronic
928075117 2:28257385-28257407 CTAGAGAAACAGAAAGTGGTCGG - Intronic
928365384 2:30696444-30696466 GTTAAGAAACAGTGGGTGGAAGG - Intergenic
928925473 2:36574817-36574839 CTGGAGGAGCAGAGGATGGGGGG - Intronic
929193410 2:39161650-39161672 CCTGAGAAAAGGAGGGTGGATGG + Intergenic
929834478 2:45382489-45382511 ATGGGGTAACAGAGGGAGGAAGG - Intergenic
930003176 2:46874958-46874980 CTGGATAAACTGAGGCAGGAAGG + Intergenic
930213547 2:48669107-48669129 CTGGAAATACAGAGTGGGGATGG - Intronic
931815588 2:65897601-65897623 CTAGAGAAAAAGAGGAGGGATGG - Intergenic
932703302 2:74004976-74004998 CTGGAGATACAGAGGAGAGAGGG - Intronic
932820509 2:74895689-74895711 TGGGAGAAACAGGGGGTTGAGGG - Intergenic
933035720 2:77394910-77394932 CTTGTGGAACAGGGGGTGGAGGG + Intronic
933990244 2:87628651-87628673 CAAGGGAGACAGAGGGTGGAGGG + Intergenic
934508246 2:94914084-94914106 CTGGAGAGACAGAGGGTGCATGG - Intergenic
935248705 2:101242254-101242276 GTGGAGTGACAGAGGGTAGAAGG - Intronic
936303602 2:111322173-111322195 CAAGGGAGACAGAGGGTGGAGGG - Intergenic
936327617 2:111519301-111519323 CTAGAGAAACTGCTGGTGGAGGG - Intergenic
937097492 2:119245246-119245268 CAGGAGGGACAAAGGGTGGAGGG + Intronic
937680183 2:124635234-124635256 CAGGAGAAAGAGAGGTTGTAGGG + Intronic
937757382 2:125556768-125556790 CAGGAGAAACAGAGAGAGGCAGG - Intergenic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938575638 2:132600947-132600969 CTGGAGATGCAGAGGAGGGAAGG - Intronic
938920178 2:135987671-135987693 CTGGAACATGAGAGGGTGGAAGG + Intergenic
939143846 2:138389342-138389364 CTGGAGAAAGAGAGGGGTGTGGG - Intergenic
942305005 2:174598776-174598798 ATAGAGATAAAGAGGGTGGAAGG + Intronic
942604655 2:177677600-177677622 TTGAAGAAGGAGAGGGTGGAAGG + Intronic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
942924065 2:181411393-181411415 CTGGAGCCACGGAGGCTGGATGG + Intergenic
945268711 2:207917017-207917039 CTGGAGAAAAAGAAGGGAGAGGG + Intronic
945935985 2:215903160-215903182 TTGGAGAAGAAGAGGGTGAAGGG - Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946190270 2:218004077-218004099 CTGGACCAACTGAGGGTGGGTGG + Intergenic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
946986867 2:225283121-225283143 TTGGAGAAACAGAAGGTGGTGGG - Intergenic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947199603 2:227602953-227602975 AAGGAGAAGCAGAGGGTAGAGGG - Intergenic
947288740 2:228547363-228547385 CTGGAGAAAGAGAGGAAGGGAGG - Intergenic
947576481 2:231279017-231279039 CTGTGGCAACAGAGAGTGGATGG - Intronic
947797180 2:232901881-232901903 CTGGAGACACGGAGCCTGGATGG - Intronic
947889770 2:233606740-233606762 CAGGAGAAAGAGAGAGTCGATGG + Intergenic
948522854 2:238551856-238551878 TTGGACAAAGAAAGGGTGGATGG + Intergenic
948645026 2:239399398-239399420 CTGGGGAGAGGGAGGGTGGAAGG - Intronic
948906643 2:240982830-240982852 CTGGAGACACTGGGGGTGGGAGG - Intronic
1169318230 20:4610597-4610619 CTGGAGGAGCAGTGGGTGCAGGG - Intergenic
1171163126 20:22946634-22946656 CTGGAGTCACAGAGGCTGGCTGG + Intergenic
1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG + Intergenic
1172240749 20:33411132-33411154 TAGGAGAAAGAGTGGGTGGAGGG - Intronic
1172330593 20:34073796-34073818 CTGGGGAAACAAAGGGGAGAGGG - Intronic
1172770332 20:37378835-37378857 CTGGAGATAGACAGGGTGGAGGG + Intronic
1173620528 20:44432405-44432427 ATGGACAAACAGAGGGTTGCTGG + Exonic
1174100236 20:48121640-48121662 CTGGAGAACCAGAGGGGAGCTGG - Intergenic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1175128995 20:56775112-56775134 CAGGAGAAAGAGAAGGGGGAGGG - Intergenic
1175217679 20:57400138-57400160 ATGGGGAAACAGAGGCCGGAGGG + Intronic
1175522378 20:59610177-59610199 CTGGGGAAGCAGAGGTTGCATGG + Intronic
1175529212 20:59662679-59662701 CTGGAGGAAAAGGGGCTGGAGGG + Intronic
1175906572 20:62382809-62382831 CTGTACAGACAGCGGGTGGAGGG + Intergenic
1176280777 20:64308329-64308351 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1176975116 21:15312245-15312267 CAGGAGAGAGAGAGCGTGGAGGG - Intergenic
1176997386 21:15571357-15571379 CTAGAGAAACAGAGAGTGGAAGG + Intergenic
1177787307 21:25685099-25685121 CTGGAGAAAGATAGGTTTGAAGG + Intronic
1179438073 21:41375593-41375615 CTGGAGACACACAGGGAGAAGGG - Intronic
1179479929 21:41670532-41670554 CTGCAGCAACAGGAGGTGGAGGG + Intergenic
1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG + Intergenic
1179486273 21:41712593-41712615 CTGGAGAGACAAAGGGAGGTGGG - Intergenic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180226758 21:46398056-46398078 CAGGAGATTCAGAGGCTGGAGGG + Exonic
1181618518 22:24071554-24071576 AGGGAGAAACAAAGGCTGGAGGG - Intronic
1181832322 22:25570716-25570738 CAGGAGAAGCAGAGGGGGGCCGG - Intronic
1182411438 22:30190213-30190235 GTAGAGAAAGAGAGGGTTGAGGG - Intergenic
1182476448 22:30579141-30579163 CTGGAAGAGCAGAGGATGGAGGG - Exonic
1183946574 22:41329650-41329672 CTGGAGAAGCCTAGGGTGAAGGG + Intronic
1184144310 22:42599882-42599904 CTGGAGAAACAAAGGGACCAAGG + Intronic
1184435039 22:44467701-44467723 CTGGAGAGGCAGAGGTTGCAGGG - Intergenic
949861532 3:8509710-8509732 CTGGAAAATCTGAGGGTGGTTGG - Intronic
950289074 3:11769029-11769051 GAGCAGAGACAGAGGGTGGAGGG + Intergenic
950403755 3:12791437-12791459 TTGGAGATACAGATGGGGGAAGG - Intergenic
950627178 3:14255981-14256003 ATGGAGAAATTGAGGCTGGAGGG - Intergenic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
951778051 3:26332136-26332158 CTGGAGATACTGAGAGAGGAGGG + Intergenic
953029149 3:39166135-39166157 CTGAAGAAAAAAAGGGTGGAAGG + Intergenic
953242215 3:41159742-41159764 TTGGAGAAAGTGAGAGTGGAAGG - Intergenic
953313815 3:41907162-41907184 CTGGAGAAACATGGGGTGGCGGG + Intronic
954660461 3:52224274-52224296 CAGGAGAGACAGCGGGTGCAGGG + Exonic
955123427 3:56085032-56085054 ATGGAGAAACTGAGGCTGAAAGG - Intronic
955465697 3:59235077-59235099 CTAGAGAAACACAGGAAGGAGGG - Intergenic
955518624 3:59752731-59752753 CAGGAGGAAGAGAGAGTGGAGGG - Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
957269061 3:78005032-78005054 CTGGAAAAACAGCCAGTGGATGG + Intergenic
957593784 3:82233937-82233959 AGGGAGAAAGAGAGGGAGGAAGG + Intergenic
958574244 3:95927060-95927082 CTACAGAAACAGAGGGAGGGGGG + Intergenic
960650779 3:119946670-119946692 CTGAAGAGAAAGAGGTTGGAAGG + Intronic
961041179 3:123679524-123679546 TTGGAGTAACAGAGATTGGAGGG + Intronic
961235072 3:125359185-125359207 CTGGAGACTCAGAGTGTTGAAGG - Intronic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
961781487 3:129323325-129323347 GTGGAGAACGAGAGGGTGGCAGG - Intergenic
962414941 3:135173472-135173494 CTGGAAAAGCAGTGGGTGGGAGG - Intronic
963154877 3:142085847-142085869 CTGGTAAAACAGAGAATGGATGG + Intronic
963425067 3:145114211-145114233 ATGGAGGAATGGAGGGTGGAAGG - Intergenic
963456814 3:145555622-145555644 ATGGAGGAATGGAGGGTGGAAGG + Intergenic
963609752 3:147452412-147452434 CTGGAGACACAGGTGGTTGAGGG + Intronic
964762423 3:160146850-160146872 TTGGAGGAAGAGAAGGTGGAGGG - Intergenic
967081026 3:186049597-186049619 CTGGAGACGCAGAGGGGGAAGGG + Intronic
967133045 3:186490202-186490224 CTGGAGAATGGGATGGTGGAAGG + Intergenic
967218865 3:187232520-187232542 CTGGAAAAACAAAGGGGAGAAGG - Intronic
967540775 3:190665139-190665161 CTGGAGAAGGATAGGGCGGATGG + Intergenic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968478427 4:823611-823633 CTGGGGGAACACAGGATGGACGG + Intronic
968519153 4:1027935-1027957 CTGGAGTAGGGGAGGGTGGAAGG + Intergenic
968666637 4:1825959-1825981 CAGGAGAAACAGCAGGTGGCAGG - Intronic
968936532 4:3614039-3614061 CTGGAGAAGCTGAGGATGGGAGG - Intergenic
969102583 4:4780473-4780495 ATGGAGAAACTGAGGCTTGAGGG - Intergenic
969436500 4:7192301-7192323 CTGGAGAGAGGGAGGGAGGACGG + Intergenic
969654256 4:8487293-8487315 ATGGAGGAATGGAGGGTGGAAGG + Intronic
969872161 4:10111398-10111420 CAGGGGAAGCAGAGGGTGGTGGG - Intronic
970491433 4:16579004-16579026 CTGGAGATAGAGAGTGGGGATGG + Intronic
970659069 4:18264251-18264273 CTGGAGACACAGAGAGTGAAGGG + Intergenic
971195013 4:24464834-24464856 CAGGAGAAACATGCGGTGGAGGG - Intergenic
971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG + Intergenic
971954867 4:33403557-33403579 CTGGAGAAAGAGAGGAAGAAAGG - Intergenic
972636757 4:40891125-40891147 CTGGGGAAACTGAGGCTGAAAGG + Intronic
972935665 4:44131846-44131868 CTGGAGGAAGGGAGAGTGGAGGG + Intergenic
974506257 4:62776772-62776794 CAGGAGAAAGAGAGAGTGAATGG - Intergenic
974593844 4:63991133-63991155 CTGGAGATCCAGAGGAGGGAGGG + Intergenic
974777665 4:66507683-66507705 CTGCAGAAACCCAGGGTGTATGG + Intergenic
974903630 4:68031862-68031884 ATGGAGGAATGGAGGGTGGAAGG - Intergenic
975259972 4:72286942-72286964 GTAGAGAAAAAGAGGCTGGAAGG + Intronic
975561782 4:75715423-75715445 ATGGACAAAGAGAGGGTAGAAGG - Intronic
976126079 4:81835053-81835075 AAGGAGGAACAGAGGGAGGAAGG + Intronic
977271101 4:94917970-94917992 CAGGAGAAAGAGAGTGAGGAGGG - Intronic
978502155 4:109421031-109421053 CAGGAGAGACAGAGAGTGAAGGG + Intergenic
979027091 4:115591268-115591290 CTGAAGAAACAGAGTGTAGTGGG - Intergenic
979996304 4:127435548-127435570 CTGGGGAAGCAGAGGTTGGGAGG + Intergenic
980468757 4:133221536-133221558 ATGGAGACACAGAGGCTAGAAGG - Intergenic
981145359 4:141317621-141317643 CTGGAGAAACAAAGTGTGCAAGG + Intergenic
982215789 4:153081694-153081716 CAGGAGAACCAGAGTGTGGTGGG - Intergenic
982712358 4:158769506-158769528 GTGGAGAAAGAGCGGGAGGAAGG - Intronic
982743959 4:159087006-159087028 CTTGAGAGACAGAGGCAGGAGGG + Intergenic
983150205 4:164269248-164269270 CTGGACAAACAGAGTGTGCTGGG - Intronic
984521045 4:180801294-180801316 CTTGAGAAACAGCAGCTGGAAGG + Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
984763572 4:183383052-183383074 CAGCAGAATCAGAGGATGGAGGG + Intergenic
984822837 4:183898160-183898182 CTGGAGAAGGAGAGGGAGGGCGG - Intronic
985356630 4:189126764-189126786 CTGGAGAGAGAGAGAGTGAAGGG + Intergenic
985763375 5:1763365-1763387 CTCTAGACACAGAGGGTGGCCGG + Intergenic
985803450 5:2021423-2021445 CTGGAGAAGCAGGTGGCGGAGGG - Intergenic
985897415 5:2757011-2757033 CTGGAGGGACGGAGGGTTGAGGG - Intergenic
986193393 5:5516832-5516854 GAGGAGAAATGGAGGGTGGAAGG - Intergenic
986455104 5:7910791-7910813 CTGGAGAAACACCAGGTTGATGG + Intergenic
986755411 5:10831589-10831611 CTGCAGAAGCACTGGGTGGAGGG - Intergenic
986919733 5:12666990-12667012 AAGGAGGAATAGAGGGTGGAAGG + Intergenic
986958341 5:13183381-13183403 ATGGAGATTCAGAGGGTGGGAGG - Intergenic
986996298 5:13611225-13611247 CATGAGAAACCCAGGGTGGAGGG - Intergenic
987365762 5:17147190-17147212 TTGGACAAACAGAGAGTGTAGGG + Intronic
987761524 5:22169039-22169061 CTAGAGAAACAGAGATTGGATGG - Intronic
988774390 5:34464082-34464104 GTGGAGTCACAGAGGGTGGAAGG + Intergenic
988987957 5:36639096-36639118 CTGGAGAAGCAGTGTGTGGTAGG + Intronic
989122859 5:38021601-38021623 AGGGAGAAACAAAGGGTGAATGG - Intergenic
990317858 5:54601077-54601099 ATGGACAGACAGAGGGAGGACGG - Intergenic
990553084 5:56903810-56903832 GTGGAGATGGAGAGGGTGGATGG - Intergenic
991063706 5:62403983-62404005 TTGGAGTCACAGAGGGAGGAAGG + Intronic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
991565675 5:68001795-68001817 CTGGAGGTACTGAGAGTGGAAGG - Intergenic
991896312 5:71402506-71402528 CTAGAGAAACAGAGATTGGATGG - Intergenic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
993628031 5:90249586-90249608 CTGGAGACTCAGAGGGGTGAGGG + Intergenic
993681964 5:90889859-90889881 GTGGAGAAAGAGAGGGCTGATGG + Intronic
993875821 5:93305505-93305527 AAGGAGAAAAAGAGGGAGGAAGG + Intergenic
994864862 5:105255009-105255031 AGAGAGAAACAGAGGATGGAAGG + Intergenic
995412266 5:111872169-111872191 CTGGAGACCCAGAGAGTTGATGG + Intronic
995452746 5:112320616-112320638 CTGGAGATAGAGAGGTTGAAGGG + Intronic
995469968 5:112490955-112490977 ATAGAGACACAGAGGGAGGAAGG + Intergenic
996027134 5:118658665-118658687 CAGGAGAAAGAGAGAGTGAAGGG + Intergenic
996288381 5:121822824-121822846 GTGGACTACCAGAGGGTGGAGGG - Intergenic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996413101 5:123180339-123180361 TAAGAGAAAGAGAGGGTGGAGGG - Intronic
996527902 5:124498288-124498310 ATGGAGGAATGGAGGGTGGAAGG - Intergenic
997453333 5:134000696-134000718 ATGGAGAAAGAGAGCCTGGATGG + Intronic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
997979633 5:138460830-138460852 CTGGGGAAAATGAGGCTGGAAGG - Intergenic
998226390 5:140329958-140329980 CTGGAGAAACAAAGTGTGCTTGG + Intergenic
998680839 5:144465449-144465471 CTGGAGAAAGAAAGGGTGTCAGG - Intronic
999524187 5:152384430-152384452 CAGGAGAAACCCAGGGTAGATGG - Intergenic
1000821935 5:165995487-165995509 CCGGAGACACAGAGGGGAGAAGG + Intergenic
1001106535 5:168859157-168859179 CGGCAGAAGCAGGGGGTGGAGGG + Intronic
1001284388 5:170411921-170411943 ATGGAGAGAGAGAGGTTGGAGGG + Intronic
1001310033 5:170603932-170603954 AGGGAGAAACAGGAGGTGGAGGG + Intronic
1002732193 5:181347198-181347220 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1002752342 6:126906-126928 CTGGACAAACAGAGTGTGCTGGG - Intergenic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003879996 6:10471244-10471266 CTGCAGAAAGAGAGGCTGCAGGG + Intergenic
1003967408 6:11266244-11266266 CTGGAGTAAGTGAGGGGGGAGGG - Intronic
1005619064 6:27603214-27603236 CTGGAGCAAGAAAGGGTGGTAGG + Intergenic
1005963696 6:30711666-30711688 CTGGAGAATCAGGGCCTGGAAGG - Exonic
1006245221 6:32728033-32728055 AGGGAGAAAGAGAGGGAGGATGG - Intergenic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007411344 6:41663753-41663775 CCCGAGAAACAGAGGCTGCAAGG + Intergenic
1007717989 6:43868376-43868398 CTGGAGACATAGAGGGTACATGG - Intergenic
1008360510 6:50612126-50612148 TTAGAAAAACAGATGGTGGAGGG + Intergenic
1008395639 6:51003586-51003608 CTGGAGAAAGAGAGGAGGCATGG + Intergenic
1008418322 6:51268709-51268731 CTGGAGGAACAGGGGGAAGAGGG - Intergenic
1008464464 6:51815052-51815074 CTTGGCAAACAAAGGGTGGATGG - Intronic
1010155086 6:72783181-72783203 CTGTAGAGAGAGATGGTGGAGGG + Intronic
1010724518 6:79318104-79318126 ATGGAGCAACAGAGCCTGGATGG - Intergenic
1011713467 6:90079214-90079236 CTGTAGACACAGATGTTGGAGGG - Intronic
1012420748 6:99062278-99062300 GTAGAGAAACACAGGGTGGTGGG - Intergenic
1012867983 6:104641023-104641045 CAGGAGCAAGAGAGGGTGGGAGG - Intergenic
1013178120 6:107694515-107694537 CAGGAGCAAGAGAGGGTGGGAGG + Intergenic
1013439430 6:110147853-110147875 CTTGGGAAACTGAGGGTGGGAGG - Intronic
1013464563 6:110406474-110406496 CTGTAGAAACAGAGAGTAGATGG - Intronic
1013847534 6:114471938-114471960 CTGGAGAGACAGAAGCTGGTAGG - Intergenic
1013979090 6:116108841-116108863 ATGAAGAAAGAGAGGGTGGTGGG - Intronic
1014247854 6:119085863-119085885 CAGGAGAAAGAGAGAGTGGGGGG + Intronic
1014405564 6:121046499-121046521 GTGGAGTGACAGAGGGTAGAAGG - Intergenic
1014419847 6:121229941-121229963 CTGGAGAGAGAGAGAGTGAAGGG - Intronic
1014565817 6:122946558-122946580 CTTGAGAATCAGAGGATGAAAGG + Intergenic
1015102670 6:129499923-129499945 TTGGAGAGACAGAGGGGGGCAGG + Intronic
1015128684 6:129785349-129785371 CTGGGTGAACTGAGGGTGGATGG + Intergenic
1015144266 6:129968024-129968046 CTGGAGAAACAGAGTTTGCAAGG + Intergenic
1015358184 6:132305176-132305198 CTGGAGCCAGAGAGGCTGGATGG + Intronic
1015680979 6:135808138-135808160 CTGGAGAGACAGAGGGTGACTGG - Intergenic
1015763753 6:136693349-136693371 CTGGAAAAGCACAAGGTGGAAGG - Intronic
1015904034 6:138097896-138097918 CTGGAGGAAGAGGGGATGGAGGG - Intronic
1016119544 6:140329498-140329520 CTGGAGAACCAGAGGCTAAAAGG - Intergenic
1016409339 6:143765571-143765593 CTGGAGCCACAGGGGGTGGAGGG - Exonic
1016581644 6:145634732-145634754 CTGGAGGAAGAGTGAGTGGAGGG - Intronic
1017006080 6:150028875-150028897 CTGGAGAAAGAGCAGGTGGGTGG + Intergenic
1017039323 6:150295117-150295139 CTGAAGAGACAAAGGGAGGAAGG + Intergenic
1017484354 6:154889400-154889422 CAGGAGAAACAGGGCTTGGATGG + Intronic
1017506684 6:155074929-155074951 CTGGGGAGTCAGAGGGTGGAGGG + Intronic
1017950838 6:159133317-159133339 CTGGAGAAAATGAAGGTGTAAGG - Intergenic
1018347817 6:162921206-162921228 CAGGAGAGACAGAGTGGGGAGGG + Intronic
1018463033 6:164017205-164017227 ATGGAGAAATAGAGGGACGAGGG - Intergenic
1019033997 6:169039493-169039515 CTGGAGACTTGGAGGGTGGAAGG + Intergenic
1019171656 6:170136420-170136442 TTAGAGAAGCAAAGGGTGGACGG - Intergenic
1019236445 6:170619512-170619534 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1019311686 7:365005-365027 CTGCAGAAACAGAAAGTGCAGGG - Intergenic
1019721317 7:2573706-2573728 CTGGAGAAGCAGAGCACGGATGG - Intronic
1019770376 7:2880627-2880649 CTGGAGAAACTGAGGGGCGGGGG - Intergenic
1019779223 7:2929808-2929830 CTGGAGGGAGAGAGGGTGGTGGG + Intronic
1020774478 7:12435829-12435851 CAGGAGAGACAGAGAGTGCAGGG + Intergenic
1021253477 7:18360035-18360057 GAGGAGAATCGGAGGGTGGAAGG - Intronic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021642111 7:22748212-22748234 ATGGAGAAATAAAAGGTGGATGG + Intergenic
1021787382 7:24165173-24165195 CAGTAGCAACAGAGGGTGGGAGG + Intergenic
1023247392 7:38219726-38219748 ATTGAGAAACAGAGGGGGTAGGG - Intronic
1024099489 7:46015712-46015734 CTGGAGCCAGGGAGGGTGGACGG + Intergenic
1024147563 7:46532881-46532903 CTCCAGAAAGAGAGTGTGGAGGG - Intergenic
1024369428 7:48563346-48563368 CTGAAGAAAGAGAGGGTTAAAGG + Intronic
1024512195 7:50212990-50213012 CTGGAGAAAGAGTGGGAGGCAGG + Intergenic
1024793942 7:53000980-53001002 CTGGAGATAAAGAGGGTGTCTGG + Intergenic
1024932683 7:54680391-54680413 CTGGGGACACAGAAGGTGGTGGG - Intergenic
1024983877 7:55179549-55179571 CAGGAGGACCAGAGGCTGGAGGG + Intronic
1025117309 7:56269159-56269181 CAGGAGAAAGAGAGAGTGAAAGG + Intergenic
1025843308 7:65172227-65172249 CTGGAGAAAGAAAGGAAGGAAGG - Intergenic
1025879735 7:65523740-65523762 CTGGAGAAAGAAAGGAAGGAAGG + Intergenic
1025893702 7:65678850-65678872 CTGGAGAAAGAAAGGAAGGAAGG - Intergenic
1026105723 7:67419277-67419299 GTGAAGAAACAGAGGGTCTAGGG + Intergenic
1026311928 7:69193498-69193520 ATGGATAAACAGAGGGTTGTTGG + Intergenic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1026903473 7:74049625-74049647 ATGGAGGAATAGATGGTGGATGG - Intronic
1027376145 7:77551953-77551975 AAGGAGAAACATAGGGTGGGTGG + Intronic
1027528723 7:79303145-79303167 TTGGAGACTCAGAGGGTGGAAGG + Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1028210568 7:88069196-88069218 AAGGAGAAACATAGGGAGGAAGG - Intronic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028669551 7:93385980-93386002 GTGGAAACACAGAGGATGGAGGG + Intergenic
1028882987 7:95900732-95900754 TTTGAGAAAGAGAGGATGGATGG - Intronic
1028999169 7:97135015-97135037 CAGGAGAAAGAGAGGGTTAAAGG - Intronic
1029585579 7:101468722-101468744 CTGGGGAAACTGTGGGAGGAGGG + Intronic
1029969877 7:104778518-104778540 CTGGAGAAACACAGAGTGAAGGG - Intronic
1029969977 7:104779411-104779433 CTGGAGAAACACAGAGTGAAGGG + Intronic
1030545655 7:110892079-110892101 GTTGAGAAACAGGAGGTGGAAGG - Intronic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1034111811 7:148544481-148544503 CTGGAGAAATAAGGGGAGGAAGG + Intergenic
1034263825 7:149772306-149772328 CTGGGGAGACAGAGGGGGAAGGG - Intronic
1034295196 7:149966233-149966255 CTGGAGAAACAGAGGCTGGAAGG + Intergenic
1034492509 7:151401365-151401387 CTGAGGAAACAGAGGGTTTAGGG - Intronic
1034551907 7:151826130-151826152 ATGGAGAAAGAGAGAATGGATGG - Intronic
1034810867 7:154130714-154130736 CTGGAGAAACAGAGGCTGGAAGG - Intronic
1035203653 7:157281361-157281383 CTGCAGAGACAGAGGGCAGATGG + Intergenic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035311613 7:157973160-157973182 CTGGAGCAGCAGTGGGTGGGAGG + Intronic
1035417485 7:158702524-158702546 CTGGAAAAACACAGGCAGGATGG - Intronic
1035511325 8:187095-187117 CTGGACAAACAGAGTGTGCTGGG - Intergenic
1036059615 8:5301375-5301397 TTGGAGAAAGAGGTGGTGGAGGG + Intergenic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036752498 8:11452128-11452150 ATTGAGAACCACAGGGTGGATGG + Intronic
1038397604 8:27258613-27258635 CTGGAGAACCAGAGGGGTGAGGG + Intergenic
1038402681 8:27297395-27297417 CTGGAGGAAGAGAGGGTGCCAGG + Intronic
1038740952 8:30216140-30216162 CTGTAGAGACAGAGGAGGGAGGG - Intergenic
1038958063 8:32488745-32488767 ATGGAGAGACAGTGGGTGGAGGG + Intronic
1039897772 8:41728404-41728426 CTGAAGACTCAGAGGGTGGGAGG + Intronic
1040352964 8:46587029-46587051 CTGGTGAGACAGAAGGTGTAAGG - Intergenic
1040393889 8:46976123-46976145 ATGGAGACGCAGCGGGTGGAAGG + Intergenic
1040941374 8:52836752-52836774 CAGAAGAAATAGAGGATGGATGG + Intergenic
1041419220 8:57647733-57647755 CTGGAGAAATGGAAGATGGATGG - Intergenic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1041576177 8:59398218-59398240 GTGGAATACCAGAGGGTGGAAGG + Intergenic
1042146990 8:65740339-65740361 GTGGAGAATGAGGGGGTGGATGG - Intronic
1043085423 8:75826171-75826193 CAGGAGAAACAGAGAGTAGGGGG - Intergenic
1043127496 8:76418064-76418086 CTGGAGAAAGAGAGAGTGAAGGG - Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043511699 8:80956609-80956631 CTGGGAACACTGAGGGTGGAGGG + Intergenic
1044295287 8:90519806-90519828 CAGGAGAGACAGAGGGTGAAGGG - Intergenic
1044850645 8:96424197-96424219 CTGGAGAAGAAGAGGGTGAGGGG + Intergenic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1046199875 8:110911143-110911165 CTGGGGATACAGAGGGCGGGGGG + Intergenic
1046391397 8:113577346-113577368 CAGGAGAAAGAGAGAGTGAAGGG - Intergenic
1047167686 8:122458420-122458442 CAGTGGAAACAGTGGGTGGAGGG + Intergenic
1047859616 8:128950844-128950866 CTGGAGATAAAGTGGGTGAATGG + Intergenic
1048165607 8:132059061-132059083 AGGGAGAAAGAGAGGGTAGAAGG - Intronic
1048993849 8:139776918-139776940 CAGGAGCTACAGAGGGTGCAAGG - Intronic
1049250667 8:141587254-141587276 CTGGGGACACAGAGGTTGGCAGG + Intergenic
1049350714 8:142163098-142163120 ATGGATGAACAGAGGATGGATGG + Intergenic
1049350789 8:142163494-142163516 ATGGATGAACAGAGGATGGATGG + Intergenic
1049350903 8:142164107-142164129 ATGGATGAACAGAGGATGGATGG + Intergenic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1049503130 8:142978725-142978747 CTGGAGAGACAGAGGGGACATGG + Intergenic
1049868970 8:144958745-144958767 ATGGAGGAATGGAGGGTGGAAGG + Intergenic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1049952576 9:659691-659713 CAGGAGAAAAAGAGGGAAGAAGG + Intronic
1050446581 9:5729027-5729049 CTGGAGACAGAGAGGGGAGAGGG - Intronic
1050847491 9:10240387-10240409 CTAGAGAAACAGAAGGTCCAGGG + Intronic
1050895925 9:10885991-10886013 AAGGAGGAATAGAGGGTGGAAGG - Intergenic
1051507959 9:17846201-17846223 CTGCAGAAAGAGAGGGGGAAAGG - Intergenic
1051839425 9:21378631-21378653 CTGAAGAAAAAGCCGGTGGAAGG + Intergenic
1051845586 9:21448191-21448213 CTGAAGAAAAAGCTGGTGGAAGG - Intergenic
1052061726 9:23967732-23967754 CTGGAGACTCAGAGGATGGGAGG - Intergenic
1052158563 9:25226411-25226433 CTGGAGTCCCAAAGGGTGGAGGG + Intergenic
1052823825 9:33161068-33161090 CTGGAGAAGCAGCGGGTGTGGGG + Intronic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1054862988 9:69972250-69972272 CAGGAGTAACAGAGGGGGAAGGG - Intergenic
1054878221 9:70118724-70118746 CTGGAGAAACAGCACGTAGAAGG + Intronic
1055672070 9:78617824-78617846 TGGGAGATTCAGAGGGTGGAAGG + Intergenic
1055791922 9:79931580-79931602 CTGGAGAGAGGCAGGGTGGAGGG + Intergenic
1055868948 9:80850956-80850978 CTGGAGAGACAGAGGTTACATGG + Intergenic
1056109654 9:83382482-83382504 ATTGAGACACAGAGGGTGTAAGG + Intronic
1056276980 9:85002970-85002992 TTGGAGAAACAGTTGGGGGACGG + Intronic
1056545054 9:87606478-87606500 AGGGAGAGACAGAGGGAGGAAGG - Intronic
1056821336 9:89844179-89844201 TTGGAGAAACAGAGGCTCGGGGG + Intergenic
1057047987 9:91900450-91900472 CTGGAGCAAGAGAGGCTGGCAGG + Intronic
1057226944 9:93297424-93297446 CAGGGGAAACAGACAGTGGAAGG - Intronic
1057414121 9:94846225-94846247 CTGGAGAAGCACAACGTGGAAGG + Intronic
1057981931 9:99671425-99671447 ATGGAGGAATGGAGGGTGGAAGG - Intergenic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058608700 9:106751921-106751943 CTGGAGAAACAGAGCAGAGAGGG + Intergenic
1058634071 9:107019440-107019462 CTTGAGAGAGAGAGGGTTGAGGG + Intergenic
1058858980 9:109095886-109095908 CTGGAGAAAAAGAGACTAGAGGG + Intronic
1058901542 9:109446629-109446651 CTGGAGAAAGAGGAGGTGAATGG + Intronic
1059351103 9:113665654-113665676 CTGAAGAAAAAGAGAGAGGATGG - Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060018512 9:120108101-120108123 TTGGAGGGACACAGGGTGGAAGG + Intergenic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1061582907 9:131548311-131548333 AAGGAGGAATAGAGGGTGGAAGG - Intergenic
1061634918 9:131901527-131901549 CTTGAGGAACGGAGGGAGGAGGG + Intronic
1062024534 9:134334186-134334208 CTGGGAAAAAAGAGGCTGGATGG - Intronic
1062201236 9:135303911-135303933 ATGGATAAATGGAGGGTGGATGG + Intergenic
1062266269 9:135687845-135687867 CTTGGGAAACAGAGCTTGGAGGG - Intergenic
1062315292 9:135964231-135964253 CTGGGGGAACAGAGAGAGGAGGG + Intergenic
1062322102 9:135995106-135995128 CTGTGGAGACAGACGGTGGAGGG - Intergenic
1062756595 9:138299524-138299546 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1185825385 X:3244271-3244293 ATGGATAAACAGAGGAAGGAAGG + Intergenic
1186113024 X:6276639-6276661 AAGGAGGAATAGAGGGTGGAAGG + Intergenic
1187731942 X:22264282-22264304 CTGGAGAATGGGAGGGAGGATGG - Intergenic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188640792 X:32501754-32501776 CTGGTGGAACAGATGGTGAATGG - Exonic
1189757062 X:44282793-44282815 TGGAAGAAACTGAGGGTGGAGGG + Intronic
1190534175 X:51409101-51409123 CTGGAGAAAAGGAGGGGTGATGG + Intergenic
1191836619 X:65470205-65470227 GTGGAGAAAAAGGAGGTGGAGGG + Intronic
1192088401 X:68125789-68125811 CTGAAAAAATAGAGGGGGGAGGG + Intronic
1192930263 X:75799319-75799341 CTGGAGCCAGAGAGGCTGGACGG - Intergenic
1193300259 X:79881060-79881082 GTGAAGAAACTGAGGGTGGATGG + Intergenic
1194200473 X:90948776-90948798 CAGGAGAAAGAGAGGGAGGGAGG - Intergenic
1195250066 X:103034931-103034953 CTGGGGAAACGTAGTGTGGAGGG - Intergenic
1195473889 X:105262723-105262745 TTGGAGAAACAGAGCTTGGAAGG + Intronic
1196465623 X:115969091-115969113 CAGGAGACACAGAAGATGGAGGG - Intergenic
1197440112 X:126477130-126477152 CTGGAGAAAGAGAAGGTGAAGGG + Intergenic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198483596 X:137064081-137064103 CTGGAAAAATTGAGGGTGGCTGG + Intergenic
1199010842 X:142756738-142756760 TTGGAGACACAGAGAGGGGAGGG - Intergenic
1199795331 X:151190470-151190492 CAGGAGAGACAGAGAGTGCAGGG - Intergenic
1199922982 X:152429286-152429308 CTGGAGAAAGAGAGGGAGGGAGG - Intronic
1201253811 Y:12087759-12087781 ATGGATAAACAGAGGAAGGAAGG - Intergenic
1201622527 Y:15976014-15976036 GTGGAGGGACAGAGGGTAGAAGG + Intergenic
1202092523 Y:21208840-21208862 CTGGAGCAAGGGAGGCTGGAGGG + Intergenic
1202383717 Y:24302541-24302563 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1202487066 Y:25367579-25367601 CTGGACAAACAGAGTGTGCTGGG - Intergenic