ID: 1119665072

View in Genome Browser
Species Human (GRCh38)
Location 14:76479642-76479664
Sequence GGGCTGCCTACACTCTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 180}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119665059_1119665072 18 Left 1119665059 14:76479601-76479623 CCCAGGAGCAGGAAACCCAGTAG 0: 1
1: 0
2: 2
3: 21
4: 248
Right 1119665072 14:76479642-76479664 GGGCTGCCTACACTCTGCTGGGG 0: 1
1: 0
2: 1
3: 15
4: 180
1119665064_1119665072 2 Left 1119665064 14:76479617-76479639 CCAGTAGCCAGGACATACTGGCC 0: 1
1: 0
2: 0
3: 8
4: 111
Right 1119665072 14:76479642-76479664 GGGCTGCCTACACTCTGCTGGGG 0: 1
1: 0
2: 1
3: 15
4: 180
1119665060_1119665072 17 Left 1119665060 14:76479602-76479624 CCAGGAGCAGGAAACCCAGTAGC 0: 1
1: 0
2: 0
3: 18
4: 175
Right 1119665072 14:76479642-76479664 GGGCTGCCTACACTCTGCTGGGG 0: 1
1: 0
2: 1
3: 15
4: 180
1119665057_1119665072 28 Left 1119665057 14:76479591-76479613 CCCTGGAGAGCCCAGGAGCAGGA 0: 1
1: 2
2: 5
3: 46
4: 442
Right 1119665072 14:76479642-76479664 GGGCTGCCTACACTCTGCTGGGG 0: 1
1: 0
2: 1
3: 15
4: 180
1119665063_1119665072 3 Left 1119665063 14:76479616-76479638 CCCAGTAGCCAGGACATACTGGC 0: 1
1: 0
2: 1
3: 21
4: 266
Right 1119665072 14:76479642-76479664 GGGCTGCCTACACTCTGCTGGGG 0: 1
1: 0
2: 1
3: 15
4: 180
1119665068_1119665072 -5 Left 1119665068 14:76479624-76479646 CCAGGACATACTGGCCAGGGGCT 0: 1
1: 0
2: 2
3: 15
4: 168
Right 1119665072 14:76479642-76479664 GGGCTGCCTACACTCTGCTGGGG 0: 1
1: 0
2: 1
3: 15
4: 180
1119665058_1119665072 27 Left 1119665058 14:76479592-76479614 CCTGGAGAGCCCAGGAGCAGGAA 0: 1
1: 0
2: 7
3: 85
4: 541
Right 1119665072 14:76479642-76479664 GGGCTGCCTACACTCTGCTGGGG 0: 1
1: 0
2: 1
3: 15
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119665072 Original CRISPR GGGCTGCCTACACTCTGCTG GGG Intronic
901263007 1:7887314-7887336 TGGCTGCTCACACCCTGCTGTGG - Intergenic
901432322 1:9224545-9224567 GGGCTTCCTGCACAGTGCTGCGG - Intergenic
901768630 1:11519416-11519438 GGGCTGCCTCCAACCTGCTCGGG - Exonic
902536615 1:17122544-17122566 GGGCTGCCCACAGGCTGCTGTGG + Intergenic
902596933 1:17516107-17516129 GGGCTGCTTCCAGTGTGCTGGGG + Intergenic
903312500 1:22470718-22470740 GGGGTTCCTAGACTCTTCTGTGG - Intronic
904165726 1:28553534-28553556 GGGCTGGCTACGCGCCGCTGGGG - Intronic
905298101 1:36967387-36967409 GGCCTGACTACCCTCTGCTCAGG + Intronic
907188379 1:52629447-52629469 GGGCTGCTTTCACTCTGCCAGGG + Intergenic
908749739 1:67409305-67409327 GGGCTGCCTACATTTTTCTGTGG + Intronic
1064120110 10:12611230-12611252 GGGTTGCCTGCACTTTGATGGGG - Intronic
1064634158 10:17346624-17346646 GGGCTGCCTGGGCTCAGCTGGGG - Intronic
1065012749 10:21434075-21434097 GGTCTTCCTACAATCTGCAGGGG + Intergenic
1065883876 10:30059641-30059663 GGGCTGCCTCCTCTGCGCTGAGG + Intronic
1065889227 10:30106922-30106944 GGGCTGCCTGCACCCAGCCGTGG - Intronic
1066624276 10:37390497-37390519 AGGCTGCCTCCATTGTGCTGTGG - Intergenic
1067765538 10:49083069-49083091 GGGGTTCCTGGACTCTGCTGAGG - Intronic
1068266464 10:54656498-54656520 GGGGTGCCCACACTCTTCTCAGG + Intronic
1069943975 10:71973466-71973488 GGGCTTCCTTCTCTCTGCTCAGG - Intronic
1070357117 10:75650936-75650958 GGGCAGCCTACTCTCTCCTCAGG + Intronic
1071230624 10:83580902-83580924 GGGCTGTGTCCACTGTGCTGAGG - Intergenic
1071437563 10:85661561-85661583 TGGCTGCCAGCACTCTGCAGAGG - Intronic
1073180614 10:101580802-101580824 GGGCTGCCTAGACCTGGCTGAGG - Intronic
1075731527 10:124639355-124639377 GGGCTGCATGCCCACTGCTGAGG - Intronic
1076652133 10:131997118-131997140 TTGCTGCCTACACACTGCTTGGG - Intergenic
1077434827 11:2533978-2534000 CGGCTTCCTCCCCTCTGCTGAGG + Intronic
1078091844 11:8268776-8268798 ATGCAGCCTTCACTCTGCTGAGG - Intergenic
1078350976 11:10593266-10593288 GAGCTGCCAACACCATGCTGAGG + Intronic
1079869521 11:25780588-25780610 GGGGTGGCTACACTGTGCTGGGG - Intergenic
1084035034 11:66504521-66504543 GGGCTGACCACAATCAGCTGTGG + Intronic
1084271769 11:68032974-68032996 GGGCAGCCCGCACCCTGCTGTGG + Exonic
1085015372 11:73170297-73170319 GGCCTGACTACACTCTGCAGGGG - Intergenic
1085039009 11:73315978-73316000 GGGGTGCCTCCACCCTGCTTTGG - Intronic
1085408882 11:76280111-76280133 GCCCTGCCCTCACTCTGCTGTGG - Intergenic
1088349647 11:108871354-108871376 GGGCATCCTGCCCTCTGCTGGGG + Intronic
1088940634 11:114452022-114452044 TGACTGCCTACATTGTGCTGAGG + Intergenic
1101968525 12:109296635-109296657 GGGCTGCCTGCACCCAGCAGGGG - Intronic
1102508516 12:113398904-113398926 GGACTGCGTACCCTCTACTGGGG + Intronic
1103744330 12:123111785-123111807 GACCTGCATCCACTCTGCTGTGG - Intronic
1104016492 12:124965465-124965487 GGGCTGCCAACCCCTTGCTGAGG - Intronic
1106000936 13:25722409-25722431 GTGCTGCCTGCATTTTGCTGGGG + Intronic
1108574027 13:51776611-51776633 AGGCTGCCTTCTCTCTGCTGTGG - Intronic
1112578981 13:100662284-100662306 GCGGTGCCTGCACTCTGCTGGGG - Intronic
1113803421 13:113098172-113098194 CGCCTGCCTCCACTGTGCTGGGG - Intronic
1113956711 13:114103282-114103304 GGGCAGCCTTCACTGTGCTGAGG - Intronic
1114131673 14:19800107-19800129 GGGCTGCATCCACGGTGCTGAGG + Intronic
1118616979 14:67580661-67580683 GGGCTGCCTAGCCTCTGGGGAGG + Intronic
1119085283 14:71733353-71733375 GTGCTGCCTAGGCCCTGCTGTGG + Intronic
1119665072 14:76479642-76479664 GGGCTGCCTACACTCTGCTGGGG + Intronic
1121529638 14:94643463-94643485 GGGCTTCATCCACTCAGCTGAGG - Intergenic
1123037278 14:105476626-105476648 GGGCTGCCAGCACTGTGCTCTGG - Intronic
1123574739 15:21655812-21655834 GGGCTGCATCCACGGTGCTGAGG + Intergenic
1123611353 15:22098308-22098330 GGGCTGCATCCACGGTGCTGAGG + Intergenic
1124338756 15:28876476-28876498 GGGTTGCTTTCTCTCTGCTGTGG - Intergenic
1129714012 15:77836519-77836541 AGGCTGCCTCCTCACTGCTGAGG - Intergenic
1202983605 15_KI270727v1_random:390064-390086 GGGCTGCATCCACGGTGCTGAGG + Intergenic
1132793806 16:1708319-1708341 GGGCTGCCCTCGCTCAGCTGTGG + Intronic
1133167422 16:3958034-3958056 GGGCTGCCTCCACTGTGCCAGGG + Intronic
1134121639 16:11588030-11588052 GGGCTGGGGACACTTTGCTGAGG - Intronic
1137656281 16:50161028-50161050 GGACAGCCTAGAGTCTGCTGAGG + Intronic
1138268382 16:55677151-55677173 GGGCCTCCTTCACTCTTCTGAGG + Intronic
1144507730 17:15847181-15847203 GAGAAGCCTACATTCTGCTGAGG - Intergenic
1145119401 17:20243801-20243823 GAGACGCCTACATTCTGCTGAGG - Intronic
1145171854 17:20664812-20664834 GAGAAGCCTACATTCTGCTGAGG - Intergenic
1145202071 17:20954856-20954878 GAGAAGCCTACACTCTGCTGAGG - Intergenic
1148231033 17:45935190-45935212 GGGCTGCCCAGACTCTCCCGAGG - Intronic
1149540703 17:57466040-57466062 GGGCTGCCCACACTCCTCAGGGG - Intronic
1151450416 17:74195343-74195365 GGGCTCCTTGCACTGTGCTGGGG + Intergenic
1151456900 17:74231915-74231937 GGGCTGCCACCCCTCTGCTGGGG + Intronic
1152306555 17:79524370-79524392 GGGCTGCCTCCATTAAGCTGGGG - Intergenic
1152897474 17:82921029-82921051 GGGCTCCCTTCACTGTGCTCTGG - Intronic
1155830834 18:30513522-30513544 GGGCTGCCTCCTCTCTATTGAGG - Intergenic
1157536871 18:48466011-48466033 GGACTGCTTGCACTCTGCTTTGG - Intergenic
1160515769 18:79478460-79478482 GGGCTGCATAGACCCGGCTGGGG + Intronic
1161081091 19:2310513-2310535 GGGCTGCAGAGACTCTGCAGTGG + Intronic
1161856711 19:6769919-6769941 GGCCTGCTTACACTCTACTGGGG + Intergenic
1162475541 19:10897361-10897383 GGCCTGCCCACACCCTGCAGAGG - Intronic
1167032908 19:46975338-46975360 GGGCTTCCTGCACCCTTCTGAGG + Intronic
925405850 2:3605253-3605275 CGGCGGCCTGGACTCTGCTGCGG - Intronic
928412643 2:31066667-31066689 GGGCTGCCTGCTCTGTGCTCCGG - Intronic
929055045 2:37869401-37869423 GGGCTGCAGACATTCTGGTGAGG - Intergenic
934662021 2:96148061-96148083 GCCCTGCCTCCTCTCTGCTGTGG - Intergenic
935292852 2:101624747-101624769 GGGCTGCCTCTCCTGTGCTGCGG + Intergenic
936086132 2:109470651-109470673 GGGGTGCCTAGAAACTGCTGTGG + Intronic
936151424 2:110024213-110024235 GGGCTGCCCCCACTCTGCCCCGG - Intergenic
936193251 2:110347156-110347178 GGGCTGCCCCCACTCTGCCCCGG + Intergenic
937951003 2:127387926-127387948 GGGCTGCCTGCCCTCAGCGGCGG - Intronic
938370560 2:130765788-130765810 GGGCAGCATTCAATCTGCTGAGG - Exonic
940581288 2:155584147-155584169 GGGCTGCATCCACAGTGCTGAGG + Intergenic
942490838 2:176488274-176488296 GGTCTGCCACCTCTCTGCTGTGG - Intergenic
946308717 2:218871274-218871296 GGGCTGCTTTCTCCCTGCTGTGG + Intronic
948295574 2:236857741-236857763 GGGCTGCTTTTGCTCTGCTGTGG - Intergenic
948576171 2:238950952-238950974 GGGCTGCCTTCATTCTGCAGGGG - Intergenic
948655818 2:239476168-239476190 GGGAGGTCTACACTCTGATGTGG - Intergenic
948692008 2:239712028-239712050 GGGCACCCCTCACTCTGCTGTGG - Intergenic
948732116 2:239972315-239972337 GGGTGGGCTTCACTCTGCTGGGG + Intronic
948863966 2:240766129-240766151 GCCCTGCCTACCCTCTCCTGTGG - Intronic
1168970706 20:1928910-1928932 GTGCTGCCTCTGCTCTGCTGGGG - Intronic
1170282873 20:14670818-14670840 GTGCTGACTACACTATGGTGTGG - Intronic
1170581178 20:17700748-17700770 GGGCCACCTGCACTCGGCTGAGG + Intronic
1171493471 20:25538281-25538303 GGGCTGCCCCACCTCTGCTGTGG + Intronic
1172212220 20:33208441-33208463 GTGCTGAATACACTCTGCTCAGG + Intergenic
1172620540 20:36315823-36315845 TGGCTGCCTGCCCACTGCTGAGG + Intronic
1173024814 20:39298181-39298203 GGGCTGGCTACAGGCTGGTGAGG - Intergenic
1173217039 20:41094713-41094735 GTGCTGCCTACTCTCTGGGGAGG + Intronic
1173352659 20:42259524-42259546 GGGCTGCCAAGACCCAGCTGGGG + Intronic
1173873609 20:46356670-46356692 GGGAGGTCCACACTCTGCTGGGG + Intronic
1174116681 20:48231074-48231096 GGGCTGCCCACACACACCTGGGG + Intergenic
1175698110 20:61117599-61117621 GGGCAGCCTTCAGTCTGCGGTGG - Intergenic
1177989272 21:28018778-28018800 GGGCTTTCTACACTCTGCTGAGG - Intergenic
1178246981 21:30962445-30962467 GGGTAGCCTATGCTCTGCTGTGG - Intergenic
1180083502 21:45497339-45497361 GGGCTGCTTCCACCCTGCTTTGG - Intronic
1180176502 21:46093034-46093056 GGGCAGCCTGCAGCCTGCTGGGG + Intergenic
1182075500 22:27492812-27492834 AGGCTACATACACTCAGCTGGGG + Intergenic
1182757474 22:32691411-32691433 GGGCTGCCTTTACTTTTCTGGGG + Intronic
1184235271 22:43179866-43179888 AGGTGGCCTACACGCTGCTGTGG - Exonic
1184372845 22:44093538-44093560 GGGCTGCCTTCCCTCTGCCGGGG - Intronic
949111996 3:272240-272262 GGGGTGCCTACTCTGTGCAGGGG + Intronic
949891586 3:8737454-8737476 GGGGTGCCTCCCCTCTACTGGGG - Intronic
950459479 3:13112661-13112683 CTGCAGCCCACACTCTGCTGCGG - Intergenic
950529163 3:13543206-13543228 GGGCTGCCTTCGCTGTCCTGCGG + Intergenic
952212426 3:31241671-31241693 GTGCTGGCTACACTCTGCAGGGG - Intergenic
953763226 3:45711018-45711040 TGGGAGCCTACAGTCTGCTGGGG + Intronic
958838246 3:99171748-99171770 GGGTTGGCTACACTGTGCAGGGG - Intergenic
960953328 3:123013652-123013674 GGGCCTCAGACACTCTGCTGAGG - Intronic
961684501 3:128620361-128620383 AGGGTGCCTGCACTTTGCTGTGG - Exonic
961908866 3:130293398-130293420 GAGCTGCCTACTATCTGCAGTGG + Intergenic
963245276 3:143052615-143052637 GGGTGGCTTTCACTCTGCTGTGG + Intronic
967309118 3:188089431-188089453 TGGCTGCTTACACCATGCTGTGG + Intergenic
967649836 3:191973243-191973265 TGGCTTCCTGCTCTCTGCTGAGG - Intergenic
967811117 3:193762002-193762024 GGGCTGCCGACAAGCTGCTGCGG + Intergenic
967992003 3:195138474-195138496 GGGCCGCCTGCACCCAGCTGTGG - Intronic
973713231 4:53650033-53650055 GGGCTGCTCACTCTCTGCTCAGG - Intronic
974012616 4:56620733-56620755 AGGCTGCATGCATTCTGCTGTGG + Intergenic
979515464 4:121604312-121604334 GAAATGCTTACACTCTGCTGTGG - Intergenic
981404199 4:144348483-144348505 GGGTTGCCTTATCTCTGCTGGGG - Intergenic
981780862 4:148427571-148427593 GGGCTGTCCTCACCCTGCTGGGG - Intronic
982079919 4:151779096-151779118 GGGCTGCCAGCTCTATGCTGTGG + Intergenic
983666279 4:170188301-170188323 AGTGTGCATACACTCTGCTGTGG + Intergenic
985570572 5:642642-642664 GGGCTGCCTGCAAACTGCAGGGG - Intronic
985745608 5:1645213-1645235 GTGCTGCCCACACTCTCTTGTGG + Intergenic
985987597 5:3529709-3529731 GGGCTGCCTAGAAGGTGCTGAGG - Intergenic
987162095 5:15155212-15155234 AGCCTGCCTAGCCTCTGCTGAGG + Intergenic
997795913 5:136810731-136810753 GAGCTGCCTACACTCTGCCTTGG - Intergenic
999087347 5:148904525-148904547 GTGCTGCCAACACAGTGCTGTGG - Intergenic
1000533508 5:162453064-162453086 GGCTTGCCTTCACTCTGGTGAGG + Intergenic
1001683208 5:173573802-173573824 GGGCGTCCTGCAATCTGCTGAGG - Intergenic
1001837695 5:174845642-174845664 GGGCTGCCAGTCCTCTGCTGGGG + Intergenic
1002401202 5:178992397-178992419 GGGCTGCAGGCCCTCTGCTGGGG - Intronic
1002781529 6:370356-370378 GGGCTCCCTACAGTGGGCTGTGG + Intergenic
1003141809 6:3477987-3478009 GGGCTGCCTTCCCTCTGATCTGG + Intergenic
1003564089 6:7207983-7208005 GTGATGCCTCCAGTCTGCTGTGG + Intronic
1006439360 6:34043557-34043579 GAGCTGCCTTCTCTCTGCAGCGG - Intronic
1008019044 6:46555090-46555112 GGGCTGGCTGTATTCTGCTGTGG - Intronic
1009545339 6:65012672-65012694 GGACTGCCTAGAAGCTGCTGAGG + Intronic
1010235497 6:73571960-73571982 AGGCTGCCCAAACTCTGCAGTGG - Intergenic
1013822695 6:114174361-114174383 ATGCTGCTTACACTCTGGTGGGG - Intronic
1021612554 7:22472347-22472369 GGCCTGCCTTCACCCTTCTGTGG - Intronic
1022831960 7:34076780-34076802 CTGCTGCCCACACTCTCCTGTGG - Intronic
1023802387 7:43846262-43846284 GGGCTGCCTGGATTCTGCTTTGG - Intergenic
1029449369 7:100632347-100632369 GGGCTGCCTAGGAGCTGCTGAGG - Intronic
1032080746 7:128857294-128857316 GGGCTGCCCACGATGTGCTGGGG - Exonic
1032091508 7:128913866-128913888 GGGCTGCCCACGATGTGCTGGGG + Intergenic
1032646479 7:133830343-133830365 GGCCAGCCTACTCTCTGCTCGGG - Intronic
1035056832 7:156041461-156041483 GGGATCCCTACACCTTGCTGGGG + Intergenic
1035412425 7:158655741-158655763 TGCCTGGCTCCACTCTGCTGGGG + Intronic
1035670646 8:1414565-1414587 GTTCTGCCTCCACTCTGGTGTGG - Intergenic
1037622963 8:20583238-20583260 AGGCTCCCTACTCTCTACTGGGG - Intergenic
1038388414 8:27171905-27171927 GATCTGCCTGCACTTTGCTGTGG + Intergenic
1040014746 8:42691279-42691301 GGGCTGCCATCAAACTGCTGGGG - Intergenic
1040576618 8:48657540-48657562 GAGCTTCCTACACTCTGCATTGG + Intergenic
1042755621 8:72207387-72207409 ATGCTGCCTACACTCTGTAGAGG - Intergenic
1046596980 8:116272693-116272715 GCCCTGCCTCCACTGTGCTGTGG - Intergenic
1049095763 8:140547288-140547310 TGGCTGCTCACGCTCTGCTGGGG - Intronic
1049303357 8:141883598-141883620 GGGCTGCAGGCCCTCTGCTGAGG + Intergenic
1052403374 9:28028817-28028839 GGGCTGCCTACACTCATATAGGG + Intronic
1054323757 9:63702951-63702973 GGTCTGCCGACACCCTCCTGCGG + Intergenic
1055495966 9:76856192-76856214 GGGCTCACTGCACTGTGCTGTGG - Intronic
1055695744 9:78882354-78882376 GATCTGCCTGAACTCTGCTGTGG + Intergenic
1056489231 9:87088438-87088460 GGGCTGGCTGCACTTGGCTGGGG - Intergenic
1057917702 9:99070119-99070141 GGGATGCGTTCACACTGCTGGGG - Exonic
1059450430 9:114368233-114368255 GGGCTGCCCCCAGGCTGCTGTGG + Intronic
1060556061 9:124507673-124507695 GGGCTGCCTACCCGCCTCTGTGG - Intergenic
1060796428 9:126515387-126515409 GGGAGGCCTACACTCTGGCGTGG - Intergenic
1185949614 X:4417096-4417118 GGGCTGCCAACATTTTCCTGTGG - Intergenic
1189550769 X:42090488-42090510 GGGCTACCTGCTCTCTTCTGGGG + Intergenic
1190115894 X:47626252-47626274 GGGTTTCCAACTCTCTGCTGTGG - Intronic
1196020874 X:110989789-110989811 TGGCTGCCTCCCTTCTGCTGAGG + Intronic
1196234402 X:113261887-113261909 GGGATGGCTGCACTGTGCTGGGG + Intergenic
1197602872 X:128550857-128550879 AGGCTGGATAGACTCTGCTGTGG - Intergenic
1198910290 X:141606189-141606211 GGGATGCCTAAACTATGCTCTGG + Intronic
1199855494 X:151755908-151755930 GAGCTGGCTCCCCTCTGCTGGGG + Intergenic
1199951428 X:152708972-152708994 GGCCTGCCTTCACTGTCCTGGGG - Intergenic
1199954076 X:152728196-152728218 GGCCTGCCTTCACTGTCCTGGGG - Exonic
1199955617 X:152740257-152740279 GGCCTGCCTTCACTGTCCTGGGG + Intergenic
1199958255 X:152759489-152759511 GGCCTGCCTTCACTGTCCTGGGG + Intergenic
1200108762 X:153728344-153728366 GGGAGGCCTACCCACTGCTGAGG + Intronic