ID: 1119668429

View in Genome Browser
Species Human (GRCh38)
Location 14:76500511-76500533
Sequence CTCTACTGTGAAGGTTTCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119668429_1119668435 -1 Left 1119668429 14:76500511-76500533 CCGGAGAAACCTTCACAGTAGAG 0: 1
1: 0
2: 3
3: 18
4: 201
Right 1119668435 14:76500533-76500555 GACCTTGGGGTGTGTGCTTTGGG 0: 1
1: 0
2: 1
3: 18
4: 199
1119668429_1119668434 -2 Left 1119668429 14:76500511-76500533 CCGGAGAAACCTTCACAGTAGAG 0: 1
1: 0
2: 3
3: 18
4: 201
Right 1119668434 14:76500532-76500554 AGACCTTGGGGTGTGTGCTTTGG 0: 1
1: 0
2: 2
3: 18
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119668429 Original CRISPR CTCTACTGTGAAGGTTTCTC CGG (reversed) Intronic
900134595 1:1110263-1110285 CTCAATTTTTAAGGTTTCTCTGG + Intronic
900795490 1:4705774-4705796 CTTGGCTGTGATGGTTTCTCAGG - Intronic
902801792 1:18835101-18835123 CTCTGTTTTTAAGGTTTCTCTGG + Intergenic
907383027 1:54107148-54107170 CTGTTCTGTGACAGTTTCTCAGG + Intronic
907534604 1:55138608-55138630 CTCGACAGTGAAGGTATCTTTGG + Exonic
910780367 1:90925922-90925944 CTCAATTTTTAAGGTTTCTCTGG - Intronic
911062293 1:93758887-93758909 CTGCACTGTGAACCTTTCTCAGG + Intronic
913065045 1:115243494-115243516 CTAAACTTTGAGGGTTTCTCCGG - Intergenic
913182367 1:116334411-116334433 CTAAAGTGTGAAGGATTCTCAGG + Intergenic
913676352 1:121144583-121144605 CTCTATGGTGAAGCTTTCCCAGG - Intergenic
913777737 1:122343400-122343422 CTCCTCTGTGAAGATTTCTTTGG + Intergenic
914028247 1:143932533-143932555 CTCTATGGTGAAGCTTTCCCAGG - Intergenic
915994062 1:160546447-160546469 CTCTTCTGTAAAGCTTTCCCTGG - Intronic
916653750 1:166854280-166854302 CTCTGCTGCCAGGGTTTCTCTGG + Exonic
917189101 1:172394749-172394771 CTCTACTGTGCATTTTTCACTGG - Intronic
917923111 1:179767201-179767223 CTCTTCTGGGAAGGTTTCTCTGG - Intronic
919595193 1:199552808-199552830 CTGTTCTATGAAGATTTCTCTGG - Intergenic
919775127 1:201189474-201189496 CTCTATTGTAAAGGTTACTGAGG - Intergenic
920463717 1:206163424-206163446 CTCTATGGTGAAGCTTTCCCAGG - Intergenic
924821623 1:247496708-247496730 CTCTGAGGTGAAGGTTTCTTGGG + Intergenic
1067196491 10:44123954-44123976 CTTGACTGTGATGGCTTCTCAGG + Intergenic
1067531098 10:47074124-47074146 CTTGACTGTAAAGGTTTCTTAGG + Intergenic
1067855767 10:49791575-49791597 CATTACAGTAAAGGTTTCTCAGG + Intergenic
1067936568 10:50617474-50617496 CTTCACTGTGATGGTTTCACAGG + Intronic
1069203376 10:65652364-65652386 CTCTGTTTTCAAGGTTTCTCTGG - Intergenic
1069607980 10:69752199-69752221 GTATACTGTGAAGATTTCTGGGG + Intergenic
1069725676 10:70576347-70576369 CTCCATTTTTAAGGTTTCTCGGG + Intergenic
1071188400 10:83071352-83071374 CTCTAGTGGGAATATTTCTCTGG + Intergenic
1073261925 10:102196950-102196972 CTCAACTTTAAAGATTTCTCGGG + Intergenic
1074813688 10:117128928-117128950 ATCTACTTTGGTGGTTTCTCAGG - Intronic
1076717997 10:132376569-132376591 CTCTCCTCTGAAGGTTTAACTGG + Exonic
1078683581 11:13505048-13505070 CTTGACTGTGACAGTTTCTCAGG - Intergenic
1079597084 11:22263361-22263383 CTTTCCTGTGAAGATTTCACTGG + Intronic
1080962163 11:37173148-37173170 CTCAACTTCCAAGGTTTCTCTGG + Intergenic
1080981141 11:37407748-37407770 CTCTCTGGTGAAGGTTTCCCGGG - Intergenic
1081239492 11:40686512-40686534 GTATACTGTGAAATTTTCTCAGG + Intronic
1082894986 11:58180341-58180363 CTCTATTGAGAATTTTTCTCAGG - Exonic
1086255009 11:84865259-84865281 CTCTACTGGGGAGGATTCTGAGG - Intronic
1087176433 11:95100298-95100320 CTCTACTCTGAAGGCCTCTTTGG + Intronic
1088530991 11:110809157-110809179 CTGGGCTGTGATGGTTTCTCAGG + Intergenic
1089388413 11:118083132-118083154 CTGGATTGTGAAGGTTTCTGTGG - Intronic
1092548839 12:9475392-9475414 CACAATTGTGAAGGGTTCTCCGG - Intergenic
1092922973 12:13248756-13248778 CTCAGTTTTGAAGGTTTCTCTGG - Intergenic
1093046653 12:14454237-14454259 CTCTACTCTGAAGCTCCCTCTGG + Intronic
1093789459 12:23231127-23231149 CTCTAGAGTGAAGGCTACTCTGG + Intergenic
1094455825 12:30631867-30631889 CTCCACTCTGGAGGTTACTCTGG + Intronic
1094504162 12:31047073-31047095 CACAATTGTGAAGGGTTCTCCGG + Intergenic
1095110804 12:38293804-38293826 CTGTAATGTGTATGTTTCTCAGG + Intergenic
1096318168 12:50587260-50587282 CTCTTCTGTGAACCTTTCCCTGG + Intronic
1097325416 12:58270973-58270995 CTCTGCTGTCTAGGGTTCTCTGG - Intergenic
1099541655 12:83917186-83917208 CTCTCTGGTGAAGCTTTCTCAGG + Intergenic
1099563057 12:84203565-84203587 CTTGACTGTGATAGTTTCTCAGG + Intergenic
1099615626 12:84931689-84931711 CTCTCTGGTGAAGCTTTCTCAGG - Intergenic
1099765581 12:86978850-86978872 CTCTCTGGTGAAGCTTTCTCAGG + Intergenic
1099902072 12:88723309-88723331 CACTACTGTGAAGTTTTATGTGG - Intergenic
1100094814 12:91020672-91020694 CTCAACTGTGAATTTTACTCTGG + Intergenic
1100698939 12:97125459-97125481 CTATAATATGAAAGTTTCTCTGG + Intergenic
1103447190 12:121001952-121001974 CTCTACTGGGAAGGCTACTTCGG + Exonic
1105710502 13:23003836-23003858 CTTCAATGTGAGGGTTTCTCTGG - Intergenic
1106158173 13:27176632-27176654 CTCTAATGAGAAAGTTTATCAGG + Intergenic
1106898306 13:34329100-34329122 CTTGGCTGTGAAAGTTTCTCAGG + Intergenic
1108206839 13:48098510-48098532 CTCTCCGGTGAAGCTTTCTCGGG + Intergenic
1112243466 13:97705490-97705512 CTCCATTTTTAAGGTTTCTCTGG - Intergenic
1112906930 13:104434239-104434261 CTTCACTGTGAAGGTTGTTCAGG + Intergenic
1113044185 13:106136878-106136900 CTCTTTGGTGAAGCTTTCTCAGG + Intergenic
1113529244 13:111008407-111008429 CTCTCTGGTGAAGCTTTCTCAGG + Intergenic
1114355867 14:21907549-21907571 CTCTTCTGTGAAGGTGAATCTGG + Intergenic
1115379213 14:32715019-32715041 CCCTACTGGGGAGGCTTCTCTGG + Intronic
1117213557 14:53526685-53526707 CTCTTGTATGAAGGCTTCTCTGG + Intergenic
1119668429 14:76500511-76500533 CTCTACTGTGAAGGTTTCTCCGG - Intronic
1119987410 14:79153627-79153649 TTCTTTTATGAAGGTTTCTCAGG + Intronic
1125829225 15:42701654-42701676 CTCAACTTTTAAGGTTTCTCTGG - Intronic
1126998850 15:54478471-54478493 CACTACTTTGAATGTGTCTCAGG + Intronic
1128450036 15:67800198-67800220 CTCTAATCTGAAGTTTTCTCCGG + Intronic
1130991068 15:88876298-88876320 CTCAACTCTCAAGGTTTGTCAGG - Intergenic
1132919007 16:2373450-2373472 CTGCTCTGTGAAGCTTTCTCTGG - Intergenic
1134595603 16:15493318-15493340 CTACACTGTGACAGTTTCTCAGG - Intronic
1135507636 16:23052684-23052706 CTCTACTAAAAAGGTTTCCCCGG - Intergenic
1136124243 16:28165733-28165755 CTCTACTGTAAAGGTTGATGTGG - Intronic
1138632675 16:58311489-58311511 CATTACAGTAAAGGTTTCTCAGG - Intronic
1139685111 16:68597296-68597318 CGCTACTGTGAAGGTGACTGGGG + Intergenic
1142896205 17:2980721-2980743 CTCTGCTGTGAAGGTTCCCCAGG - Intronic
1144503475 17:15809280-15809302 CTCTACTCTGAAGGCTTCGTGGG + Intergenic
1146418426 17:32659329-32659351 CTCTATTGTGAAGGTGTGGCGGG - Exonic
1146958639 17:36953238-36953260 CTCTAGTGTCAAAGTTTCTGAGG + Exonic
1148569583 17:48657489-48657511 CTCTACAGTGAAGGAATTTCTGG + Intergenic
1148569591 17:48657557-48657579 CTCTACAGTGAAGGAATTTCTGG + Intergenic
1150074861 17:62183805-62183827 CTCTACTTAGGAGATTTCTCAGG + Intergenic
1150584351 17:66504187-66504209 CTGTACTGTGAAGGTTACAAAGG + Intronic
1150910888 17:69386425-69386447 CTTCACAGTGAAGCTTTCTCTGG - Intergenic
1153131922 18:1863653-1863675 CTCTACAGTGAAGCGTTGTCTGG - Intergenic
1154399575 18:14023743-14023765 CTCTCCTGTAATGGTCTCTCTGG - Intergenic
1156383343 18:36583618-36583640 CACTACTGGGAAAGTTTCTTAGG + Intronic
1156914752 18:42452631-42452653 CTATAATGTTAGGGTTTCTCAGG - Intergenic
1157547224 18:48555019-48555041 CTCTTCCCTTAAGGTTTCTCTGG + Intronic
1159914775 18:74178823-74178845 CAGTACTGTGAAGATTTCTCAGG - Intergenic
1160047688 18:75402198-75402220 CTTTTCCCTGAAGGTTTCTCAGG + Intergenic
1160368822 18:78353243-78353265 CTCCACTGTGAAGGCTGCACCGG + Intergenic
1163807733 19:19410128-19410150 CTCACCTGTGAAGGTGCCTCTGG - Intronic
1167121090 19:47517204-47517226 CTTGGCTGTGATGGTTTCTCAGG - Intergenic
1167565112 19:50251155-50251177 CTCTTCTGTGAAGCTTTCCCAGG - Intronic
925580659 2:5406859-5406881 CTCTCCTGTGGAAGTCTCTCTGG + Intergenic
925738952 2:6988411-6988433 CTCCACTGGGACAGTTTCTCAGG + Intronic
928064813 2:28152532-28152554 TTTTACTGTGAAGGTGTCTTGGG + Intronic
930274553 2:49296352-49296374 CTCTGATGTGAAGGTGTCTATGG + Intergenic
931433048 2:62224812-62224834 CACTACTGTAATGGTTTCTGGGG - Intergenic
934752309 2:96800914-96800936 CTCTGCTGGGAAGGGTGCTCAGG - Intronic
935152172 2:100447736-100447758 CTCTCAGGAGAAGGTTTCTCTGG - Intergenic
938224489 2:129604215-129604237 CTCTGCTGTGCAGGTGTCCCTGG - Intergenic
941035749 2:160567580-160567602 CTACACTGTGAAGGTACCTCTGG + Intergenic
941339224 2:164285844-164285866 CTGTGCTGTGAAGGTTTCTCAGG - Intergenic
942309012 2:174636654-174636676 CTTGGCTGTGATGGTTTCTCAGG + Intronic
949039505 2:241841205-241841227 CTCAGGTGTTAAGGTTTCTCTGG + Intergenic
1169292351 20:4363651-4363673 CTGTACTGAGAAGGGTTCTGAGG + Intergenic
1169809733 20:9597195-9597217 CTGTACTGAGAGGGTTTCCCTGG + Intronic
1173822128 20:46026310-46026332 CTTTAGTGAGAGGGTTTCTCTGG + Intronic
1175831692 20:61968059-61968081 CTTGACTGTGATGGTTTCACAGG - Intronic
1176033424 20:63024862-63024884 CTCTGCTGTGAAGGGTTCCCTGG + Intergenic
1177994841 21:28084254-28084276 CTCTCTGGTGAAGGTTTCCCGGG + Intergenic
1178835189 21:36091321-36091343 CTCAGCTTTCAAGGTTTCTCTGG - Intergenic
1183663067 22:39232889-39232911 CTCACCTGGGAGGGTTTCTCTGG + Intronic
1183701359 22:39453088-39453110 CTCAGCTTTCAAGGTTTCTCTGG + Intergenic
1184387141 22:44182677-44182699 CTCTCCTGTGAAGGCTTCGCTGG - Intronic
949699219 3:6736548-6736570 CTCAACTGTGATGGTTTCCAAGG - Intergenic
951176803 3:19611121-19611143 CTCTAATGTTAAGGTTTTTTTGG + Intergenic
951650407 3:24945536-24945558 CTCTCCTGTGATTCTTTCTCTGG + Intergenic
956163924 3:66382222-66382244 CTCTGCTGTGACTGTGTCTCTGG - Intronic
957542482 3:81591149-81591171 TTCTAAGGTCAAGGTTTCTCAGG - Exonic
958227094 3:90839213-90839235 TTCTTCTGTCAAGGTTTCTATGG - Intergenic
958251219 3:91244036-91244058 TTCTTCTGTCAAGGTTTCTATGG - Intergenic
959451675 3:106512663-106512685 CTCTACTTTGAGGGCCTCTCAGG - Intergenic
959959585 3:112282465-112282487 CTCTCTGGTGAAGCTTTCTCCGG - Intronic
960571212 3:119187142-119187164 CTCTGCTGTTAAGGTTTTTTGGG + Intronic
962206103 3:133435219-133435241 CTCTCTAGTGAAGCTTTCTCAGG + Intronic
962494538 3:135925996-135926018 CTCTTCTGTGAAGTCTTCTCTGG - Intergenic
966064107 3:175795934-175795956 CTCTGCTGTGAAGTTGTCTTGGG + Intronic
967008240 3:185405684-185405706 TTTTTCTGTGAAGTTTTCTCTGG + Intronic
967648901 3:191961477-191961499 CTCAATTTTTAAGGTTTCTCTGG - Intergenic
967865295 3:194185311-194185333 CTCTACTTTGAAAATTCCTCTGG - Intergenic
969614604 4:8244973-8244995 CTCTCCTGAGCAGGGTTCTCCGG + Intergenic
971146195 4:23979502-23979524 TTCTATTCTGAAGGTTTTTCTGG + Intergenic
971640011 4:29118620-29118642 CACTACTGTGTGGGTTTCTGTGG + Intergenic
976892788 4:90070650-90070672 CTCAAGTGGGAAGGTTTCTTTGG + Intergenic
977683813 4:99824887-99824909 CTGTACTGTGAAGGCTTCCCTGG + Intronic
977914311 4:102574249-102574271 CCCTAGAGTAAAGGTTTCTCTGG - Intronic
979135330 4:117104185-117104207 CTGAGCTGTGAATGTTTCTCAGG - Intergenic
981103346 4:140854715-140854737 CTCTACTTGGAAGGTTCCTCTGG + Intergenic
981265204 4:142774956-142774978 CTTTACTGTGACAGTTTCTCAGG + Intronic
982415816 4:155130423-155130445 CACTATTCTGAAGGTTGCTCAGG - Intergenic
982467671 4:155750390-155750412 CTCCACTGTGATGGTTTTTAGGG - Intergenic
984504373 4:180598431-180598453 CTCTACTGGGAAGGACTCTGTGG + Intergenic
986962968 5:13237969-13237991 CTGTACTGTGAAAGACTCTCGGG + Intergenic
987299725 5:16586600-16586622 CTGGACTGCGAAGGTGTCTCAGG + Intronic
989105210 5:37856803-37856825 CTCTACTTTGCAGGTTTTACAGG + Intergenic
990598575 5:57334748-57334770 CTCTACATTGCTGGTTTCTCTGG + Intergenic
991357757 5:65787615-65787637 CATTTCTGTGAAGGTTTATCTGG - Intronic
991999555 5:72422316-72422338 CTCTCCAGTGAAGCTTTCCCAGG + Intergenic
995369635 5:111404756-111404778 CTCCATTGTTAAGGTTTTTCTGG + Intronic
997587325 5:135051150-135051172 CTCTTCTGAGAAGCCTTCTCCGG + Intronic
997752455 5:136359596-136359618 CTCTCCTGTAAAGGTTTTTCTGG - Intronic
998567876 5:143232118-143232140 CTCTTCCGTGAAACTTTCTCTGG - Intergenic
998793623 5:145793444-145793466 CTCAGCTGTGAAGGTTTATCAGG + Intronic
999862863 5:155667236-155667258 CTCTATTCTGATGGATTCTCAGG + Intergenic
1000152015 5:158512277-158512299 ATCTCCTGTGTAGGCTTCTCAGG + Intergenic
1003129529 6:3383671-3383693 CTCTCCTGTGACTTTTTCTCAGG - Intronic
1003595872 6:7473702-7473724 CCCTACTGTGAAAGTTTCTCAGG - Intergenic
1007046061 6:38775245-38775267 GTCCACTGTGAGGGTTTCCCAGG + Intronic
1008263880 6:49399991-49400013 CTCTGCTGTGAAGTTTTCTATGG - Intergenic
1008367116 6:50694465-50694487 CTCTTCAGGGAAGATTTCTCTGG + Intergenic
1008656445 6:53618814-53618836 CCCTACTGTAATGGCTTCTCAGG + Intergenic
1010981521 6:82375260-82375282 CTCTACAGTGAGGGAATCTCTGG + Intergenic
1011380556 6:86738235-86738257 CTTTGCTGTGACAGTTTCTCAGG + Intergenic
1011736440 6:90314932-90314954 CTCCTCTTGGAAGGTTTCTCAGG - Intergenic
1012351091 6:98251309-98251331 CTCCACTTGGAAGCTTTCTCTGG - Intergenic
1013459785 6:110364097-110364119 CTCTACCGGGGATGTTTCTCAGG + Intergenic
1015106155 6:129539366-129539388 CTCTATTATGAAGCTTCCTCAGG - Intergenic
1016010453 6:139133985-139134007 CTCTCCTGGGAAGGTCTCTGTGG + Intergenic
1016736877 6:147488902-147488924 CTGTTCTGGGAAGGTCTCTCTGG - Intergenic
1016801117 6:148169921-148169943 CCCTGCTGTGAAGATTTCTCTGG + Intergenic
1018287003 6:162251335-162251357 CTCTATGTTGAAGGTTTCACAGG - Intronic
1019017013 6:168887304-168887326 TTCGACTGTGAATGTTTCTGAGG - Intergenic
1022887858 7:34664810-34664832 CTCTGCTGTGAAGATTTTCCAGG + Intronic
1024730452 7:52247923-52247945 CTCTAGTGTAAGGGATTCTCAGG + Intergenic
1024936218 7:54714585-54714607 CTCTACAATGAAGGAGTCTCTGG + Intergenic
1029952198 7:104598658-104598680 CTCTATGATGAAGCTTTCTCTGG - Intronic
1031713548 7:125078743-125078765 CTTTCCTGAGATGGTTTCTCTGG + Intergenic
1034822441 7:154229053-154229075 CTCTGTGGTGAAGGTTTCTTGGG + Intronic
1035981761 8:4380493-4380515 CTTGGCTGTGACGGTTTCTCAGG - Intronic
1037275751 8:17176506-17176528 CTTTATCTTGAAGGTTTCTCTGG - Intronic
1037461605 8:19115956-19115978 CTCTATTGTGAAGGGTTGTGGGG + Intergenic
1038046186 8:23767432-23767454 CTCTTCTGTGAAGCCTTCCCTGG - Intergenic
1039034326 8:33343338-33343360 CTGTGCTGAGAAGGTTTCTAAGG + Intergenic
1039629895 8:39099429-39099451 CTGTACTGGGAAGTTTCCTCTGG + Intronic
1039851090 8:41365640-41365662 CTTGACTGTGACGGTCTCTCAGG - Intergenic
1040010731 8:42659144-42659166 CTCAACTTTGGAGATTTCTCTGG + Intergenic
1041894177 8:62904811-62904833 CTCTACTATGAAGCTCTTTCAGG - Intronic
1042509155 8:69593138-69593160 CTTTGCTGTGAAGGTCTCCCTGG + Intronic
1043338816 8:79211665-79211687 CACTACTGAGAAGGTCACTCTGG - Intergenic
1044016116 8:87050404-87050426 CTCATCTGAGAAGGCTTCTCAGG - Intronic
1044328531 8:90889498-90889520 ATCTACTGTGGAAGTTTCTGTGG + Intronic
1048001480 8:130382920-130382942 CTCTTCAATGAAGCTTTCTCTGG - Intronic
1048036717 8:130684077-130684099 CTCTAGTGTGAGAGGTTCTCTGG - Intergenic
1053376837 9:37614544-37614566 CCCCACTGTGAAGGTTTTTTGGG - Intronic
1053413427 9:37930335-37930357 CTCTATTGCGGAGGATTCTCTGG + Intronic
1055168861 9:73229923-73229945 CTCTGTGGTTAAGGTTTCTCGGG - Intergenic
1056664712 9:88572337-88572359 CTCTCCTGTGAACCTTTCTTCGG + Intronic
1056722426 9:89083158-89083180 CACTACTCTGAAGGCTTCTGGGG - Intronic
1056947229 9:91008726-91008748 CTTCACTGTGGAGGTTTGTCAGG + Intergenic
1058373592 9:104297927-104297949 CTCTCTGGTGAAGCTTTCTCAGG + Intergenic
1059044021 9:110844589-110844611 CTTTACTGTGACAGTTTCTCAGG - Intergenic
1059378510 9:113905363-113905385 CTCTATTCTGAAGGTTGCTCTGG - Intronic
1061768260 9:132896566-132896588 CTCTGGTGTGGGGGTTTCTCTGG + Exonic
1188982327 X:36737739-36737761 CTCTCTGGTGAAGCTTTCTCAGG + Intergenic
1189546230 X:42045417-42045439 CTCTACAGTAAAGGAGTCTCAGG - Intergenic
1189551282 X:42096194-42096216 CTCCACTTTTCAGGTTTCTCTGG - Intergenic
1190527415 X:51342049-51342071 CTCTACAGTGAAGAAGTCTCAGG + Intergenic
1191911985 X:66161122-66161144 CTCTAATGTGAAGGTCCCTGGGG + Intergenic
1192129307 X:68533256-68533278 CACAAGTGTGAAGGTTTTTCAGG + Exonic
1192531129 X:71887154-71887176 CGCTCCGGTGAAGTTTTCTCAGG - Intergenic
1192845086 X:74898415-74898437 CTTGACTGTGACAGTTTCTCAGG - Intronic
1194522649 X:94937141-94937163 CTCAGCTATCAAGGTTTCTCTGG - Intergenic
1194807388 X:98346174-98346196 CTCTACCATAAAGGCTTCTCTGG - Intergenic
1200006278 X:153086997-153087019 CTCTTCTGTGAGGGTGTCTGTGG + Intergenic