ID: 1119668510

View in Genome Browser
Species Human (GRCh38)
Location 14:76501018-76501040
Sequence ATGAGGACCCTCTCCGGGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119668502_1119668510 5 Left 1119668502 14:76500990-76501012 CCAACTTCTTAGCTGGAATCCTG 0: 1
1: 0
2: 0
3: 12
4: 156
Right 1119668510 14:76501018-76501040 ATGAGGACCCTCTCCGGGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119668510 Original CRISPR ATGAGGACCCTCTCCGGGGA AGG Exonic