ID: 1119671492

View in Genome Browser
Species Human (GRCh38)
Location 14:76522792-76522814
Sequence CAAAAACCCTTCAGGAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119671492_1119671498 -3 Left 1119671492 14:76522792-76522814 CCTTCATTCCTGAAGGGTTTTTG No data
Right 1119671498 14:76522812-76522834 TTGGTTGTTCTTGTTGTTGGGGG No data
1119671492_1119671497 -4 Left 1119671492 14:76522792-76522814 CCTTCATTCCTGAAGGGTTTTTG No data
Right 1119671497 14:76522811-76522833 TTTGGTTGTTCTTGTTGTTGGGG No data
1119671492_1119671496 -5 Left 1119671492 14:76522792-76522814 CCTTCATTCCTGAAGGGTTTTTG No data
Right 1119671496 14:76522810-76522832 TTTTGGTTGTTCTTGTTGTTGGG No data
1119671492_1119671500 18 Left 1119671492 14:76522792-76522814 CCTTCATTCCTGAAGGGTTTTTG No data
Right 1119671500 14:76522833-76522855 GGTATCGGATTCTTGATTGATGG No data
1119671492_1119671495 -6 Left 1119671492 14:76522792-76522814 CCTTCATTCCTGAAGGGTTTTTG No data
Right 1119671495 14:76522809-76522831 TTTTTGGTTGTTCTTGTTGTTGG No data
1119671492_1119671499 3 Left 1119671492 14:76522792-76522814 CCTTCATTCCTGAAGGGTTTTTG No data
Right 1119671499 14:76522818-76522840 GTTCTTGTTGTTGGGGGTATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119671492 Original CRISPR CAAAAACCCTTCAGGAATGA AGG (reversed) Intergenic
No off target data available for this crispr