ID: 1119672781

View in Genome Browser
Species Human (GRCh38)
Location 14:76532099-76532121
Sequence TTGTAATATTAGTGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119672781_1119672785 4 Left 1119672781 14:76532099-76532121 CCCTCTTCCCACTAATATTACAA No data
Right 1119672785 14:76532126-76532148 GTTAGAATAAAAAAGCATTATGG No data
1119672781_1119672786 12 Left 1119672781 14:76532099-76532121 CCCTCTTCCCACTAATATTACAA No data
Right 1119672786 14:76532134-76532156 AAAAAAGCATTATGGTTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119672781 Original CRISPR TTGTAATATTAGTGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr