ID: 1119673425

View in Genome Browser
Species Human (GRCh38)
Location 14:76536878-76536900
Sequence AGTCCCGAGGGCTGCCCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119673418_1119673425 15 Left 1119673418 14:76536840-76536862 CCACGGAGGCGGGGGAAGGCTCA No data
Right 1119673425 14:76536878-76536900 AGTCCCGAGGGCTGCCCCGCGGG No data
1119673417_1119673425 16 Left 1119673417 14:76536839-76536861 CCCACGGAGGCGGGGGAAGGCTC No data
Right 1119673425 14:76536878-76536900 AGTCCCGAGGGCTGCCCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119673425 Original CRISPR AGTCCCGAGGGCTGCCCCGC GGG Intergenic