ID: 1119676491

View in Genome Browser
Species Human (GRCh38)
Location 14:76559554-76559576
Sequence GGGTCCAATCCAGGATAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119676491_1119676494 -10 Left 1119676491 14:76559554-76559576 CCAGGTTATCCTGGATTGGACCC No data
Right 1119676494 14:76559567-76559589 GATTGGACCCTGGACTGAAGAGG No data
1119676491_1119676499 22 Left 1119676491 14:76559554-76559576 CCAGGTTATCCTGGATTGGACCC No data
Right 1119676499 14:76559599-76559621 TATAAAAGAAACTTGCTTTAGGG No data
1119676491_1119676498 21 Left 1119676491 14:76559554-76559576 CCAGGTTATCCTGGATTGGACCC No data
Right 1119676498 14:76559598-76559620 CTATAAAAGAAACTTGCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119676491 Original CRISPR GGGTCCAATCCAGGATAACC TGG (reversed) Intergenic
No off target data available for this crispr