ID: 1119676719

View in Genome Browser
Species Human (GRCh38)
Location 14:76561244-76561266
Sequence ATTTGTAAAAGGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119676715_1119676719 -7 Left 1119676715 14:76561228-76561250 CCTGGAATTGGAGGATATTTGTA No data
Right 1119676719 14:76561244-76561266 ATTTGTAAAAGGAGGGAAGAAGG No data
1119676711_1119676719 30 Left 1119676711 14:76561191-76561213 CCGGCTGCACGTTTAGGTTGGAA No data
Right 1119676719 14:76561244-76561266 ATTTGTAAAAGGAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119676719 Original CRISPR ATTTGTAAAAGGAGGGAAGA AGG Intergenic
No off target data available for this crispr