ID: 1119676990

View in Genome Browser
Species Human (GRCh38)
Location 14:76563191-76563213
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119676986_1119676990 16 Left 1119676986 14:76563152-76563174 CCTGTCAGGCAGTGACAAGAAAC No data
Right 1119676990 14:76563191-76563213 TCTCCCACCCAGAACTCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119676990 Original CRISPR TCTCCCACCCAGAACTCTGT TGG Intergenic
No off target data available for this crispr