ID: 1119678974

View in Genome Browser
Species Human (GRCh38)
Location 14:76577707-76577729
Sequence CTTCTGGTCTGAAGGACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119678974_1119678983 13 Left 1119678974 14:76577707-76577729 CCATTTGTCCTTCAGACCAGAAG No data
Right 1119678983 14:76577743-76577765 TATCTGGATTGGGCCTCAGAGGG No data
1119678974_1119678986 27 Left 1119678974 14:76577707-76577729 CCATTTGTCCTTCAGACCAGAAG No data
Right 1119678986 14:76577757-76577779 CTCAGAGGGCACAGAACCCTGGG No data
1119678974_1119678987 28 Left 1119678974 14:76577707-76577729 CCATTTGTCCTTCAGACCAGAAG No data
Right 1119678987 14:76577758-76577780 TCAGAGGGCACAGAACCCTGGGG No data
1119678974_1119678985 26 Left 1119678974 14:76577707-76577729 CCATTTGTCCTTCAGACCAGAAG No data
Right 1119678985 14:76577756-76577778 CCTCAGAGGGCACAGAACCCTGG No data
1119678974_1119678980 2 Left 1119678974 14:76577707-76577729 CCATTTGTCCTTCAGACCAGAAG No data
Right 1119678980 14:76577732-76577754 AGAATGGCTGGTATCTGGATTGG No data
1119678974_1119678981 3 Left 1119678974 14:76577707-76577729 CCATTTGTCCTTCAGACCAGAAG No data
Right 1119678981 14:76577733-76577755 GAATGGCTGGTATCTGGATTGGG No data
1119678974_1119678977 -10 Left 1119678974 14:76577707-76577729 CCATTTGTCCTTCAGACCAGAAG No data
Right 1119678977 14:76577720-76577742 AGACCAGAAGAGAGAATGGCTGG No data
1119678974_1119678982 12 Left 1119678974 14:76577707-76577729 CCATTTGTCCTTCAGACCAGAAG No data
Right 1119678982 14:76577742-76577764 GTATCTGGATTGGGCCTCAGAGG No data
1119678974_1119678979 -3 Left 1119678974 14:76577707-76577729 CCATTTGTCCTTCAGACCAGAAG No data
Right 1119678979 14:76577727-76577749 AAGAGAGAATGGCTGGTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119678974 Original CRISPR CTTCTGGTCTGAAGGACAAA TGG (reversed) Intergenic
No off target data available for this crispr