ID: 1119681317

View in Genome Browser
Species Human (GRCh38)
Location 14:76594218-76594240
Sequence CTGGATAGTACTCCTTTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119681312_1119681317 1 Left 1119681312 14:76594194-76594216 CCGGAGGACCCTGAATATTACAG No data
Right 1119681317 14:76594218-76594240 CTGGATAGTACTCCTTTTGCAGG No data
1119681316_1119681317 -8 Left 1119681316 14:76594203-76594225 CCTGAATATTACAGGCTGGATAG No data
Right 1119681317 14:76594218-76594240 CTGGATAGTACTCCTTTTGCAGG No data
1119681310_1119681317 19 Left 1119681310 14:76594176-76594198 CCTATCAGCTCTGACTCTCCGGA No data
Right 1119681317 14:76594218-76594240 CTGGATAGTACTCCTTTTGCAGG No data
1119681315_1119681317 -7 Left 1119681315 14:76594202-76594224 CCCTGAATATTACAGGCTGGATA No data
Right 1119681317 14:76594218-76594240 CTGGATAGTACTCCTTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119681317 Original CRISPR CTGGATAGTACTCCTTTTGC AGG Intergenic
No off target data available for this crispr