ID: 1119684837

View in Genome Browser
Species Human (GRCh38)
Location 14:76623352-76623374
Sequence ATGTGGAGAAGAAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119684837_1119684844 -5 Left 1119684837 14:76623352-76623374 CCCTCCTCCCTTCTTCTCCACAT No data
Right 1119684844 14:76623370-76623392 CACATGAAGGTCCTTTCCAATGG No data
1119684837_1119684847 8 Left 1119684837 14:76623352-76623374 CCCTCCTCCCTTCTTCTCCACAT No data
Right 1119684847 14:76623383-76623405 TTTCCAATGGGTCCCATGCCAGG No data
1119684837_1119684845 -4 Left 1119684837 14:76623352-76623374 CCCTCCTCCCTTCTTCTCCACAT No data
Right 1119684845 14:76623371-76623393 ACATGAAGGTCCTTTCCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119684837 Original CRISPR ATGTGGAGAAGAAGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr